ID: 1162421327

View in Genome Browser
Species Human (GRCh38)
Location 19:10567660-10567682
Sequence GTTCCTTGAAAGTTTCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162421327_1162421330 -4 Left 1162421327 19:10567660-10567682 CCCCATGGAAACTTTCAAGGAAC No data
Right 1162421330 19:10567679-10567701 GAACCTAAGACTCTCCCCCAAGG No data
1162421327_1162421331 -3 Left 1162421327 19:10567660-10567682 CCCCATGGAAACTTTCAAGGAAC No data
Right 1162421331 19:10567680-10567702 AACCTAAGACTCTCCCCCAAGGG No data
1162421327_1162421339 21 Left 1162421327 19:10567660-10567682 CCCCATGGAAACTTTCAAGGAAC No data
Right 1162421339 19:10567704-10567726 CCAAAGACGCCCCCAGATATGGG No data
1162421327_1162421337 20 Left 1162421327 19:10567660-10567682 CCCCATGGAAACTTTCAAGGAAC No data
Right 1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162421327 Original CRISPR GTTCCTTGAAAGTTTCCATG GGG (reversed) Intronic