ID: 1162421328

View in Genome Browser
Species Human (GRCh38)
Location 19:10567661-10567683
Sequence GGTTCCTTGAAAGTTTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162421328_1162421339 20 Left 1162421328 19:10567661-10567683 CCCATGGAAACTTTCAAGGAACC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1162421339 19:10567704-10567726 CCAAAGACGCCCCCAGATATGGG 0: 1
1: 0
2: 0
3: 3
4: 67
1162421328_1162421330 -5 Left 1162421328 19:10567661-10567683 CCCATGGAAACTTTCAAGGAACC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1162421330 19:10567679-10567701 GAACCTAAGACTCTCCCCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 137
1162421328_1162421331 -4 Left 1162421328 19:10567661-10567683 CCCATGGAAACTTTCAAGGAACC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1162421331 19:10567680-10567702 AACCTAAGACTCTCCCCCAAGGG 0: 1
1: 0
2: 1
3: 5
4: 72
1162421328_1162421337 19 Left 1162421328 19:10567661-10567683 CCCATGGAAACTTTCAAGGAACC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG 0: 1
1: 0
2: 1
3: 1
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162421328 Original CRISPR GGTTCCTTGAAAGTTTCCAT GGG (reversed) Intronic
901097308 1:6692509-6692531 GCTTCCTGGAAAGTTGACATGGG - Intronic
902171944 1:14618863-14618885 GGTTCCCTGACAGTTTCCAAAGG + Intronic
903658713 1:24964210-24964232 GGGTCCCTGAGAGTTTCCCTTGG + Intronic
904767676 1:32862863-32862885 GGTTCCATGAAAGTTACCCAGGG - Exonic
908375465 1:63534145-63534167 GTTTCCTTCACAGTTACCATGGG + Exonic
908874168 1:68650948-68650970 TGTTCATTGATAGTATCCATTGG + Intergenic
908987746 1:70045332-70045354 GGTACCTTGAAATTAGCCATAGG - Intronic
912034751 1:105299003-105299025 TGTTCTTTTAAGGTTTCCATTGG + Intergenic
912118427 1:106437765-106437787 GGTTCCTTGGCATTTGCCATAGG + Intergenic
915042697 1:152982156-152982178 GGTTCCCTCAATCTTTCCATAGG - Intergenic
917392544 1:174554489-174554511 AGTTCCTTGAAATTTTGTATTGG + Intronic
917653666 1:177104228-177104250 GGGTCCTTGAAAGCTTTCAAGGG - Intronic
918245008 1:182651623-182651645 GTTTCCTTGAGAGATTTCATGGG - Intronic
919768201 1:201140769-201140791 GGTTCCTTGAAAGTTCGCCTAGG - Intronic
920548636 1:206839518-206839540 GGTTCCTGGAAAGATTTCAGTGG + Intronic
923951618 1:238962379-238962401 GTTTCTTTACAAGTTTCCATTGG - Intergenic
1064245440 10:13664275-13664297 GGGTCCTTGGATGTTTCTATAGG + Intronic
1068029291 10:51687135-51687157 TTTTTCTTGAAAGTTTTCATTGG - Intronic
1072184495 10:93022828-93022850 GGATGCTTTAAAGTTTCAATAGG + Intronic
1072553324 10:96495298-96495320 AGTTCATTGCAAGTTTCCAGCGG + Intronic
1073831862 10:107393891-107393913 AGATCTTTGAAGGTTTCCATGGG - Intergenic
1075524674 10:123173654-123173676 GTTTCCCTGCATGTTTCCATAGG - Intergenic
1078480606 11:11672162-11672184 GAGTCCTTGAAAGTGGCCATGGG - Intergenic
1081667271 11:44923850-44923872 TGTTCCTGGGAAGCTTCCATTGG + Intronic
1081896851 11:46594078-46594100 GGTTCCTTGAACGATTGCTTGGG - Intronic
1082266292 11:50122088-50122110 ATTTCCTTAAAAGTTTCCAGTGG + Intergenic
1082289797 11:50356484-50356506 ATTTCCTTAAAAGTTTCCAGTGG - Intergenic
1083576057 11:63792420-63792442 GGTTCCATGAAAAGTTCTATTGG - Intergenic
1083578478 11:63809790-63809812 GGTGCCTTGAGGGTTTCCCTGGG - Intergenic
1086617595 11:88840924-88840946 TTTTCCTTGATTGTTTCCATCGG - Intronic
1089170193 11:116506451-116506473 GGGTCCCTGGCAGTTTCCATGGG + Intergenic
1091371530 11:135064251-135064273 GTTACCTTGAGAATTTCCATAGG - Intergenic
1093426615 12:19035123-19035145 GGCTCCTGGAAAGTGTCCAGTGG - Intergenic
1097020274 12:56015883-56015905 GGTTCCTTGAAGGGTCCCTTAGG - Intronic
1097957705 12:65503447-65503469 GGTTCTTTATAAGTTTTCATTGG - Intergenic
1099254232 12:80295859-80295881 GGTTCCTTAAAAGTTTTAATTGG - Intronic
1100072014 12:90733353-90733375 GTTTCCTTGAAGGTTGCCAATGG - Intergenic
1104525667 12:129518961-129518983 AGTTCTTTGAAGCTTTCCATTGG + Intronic
1106671413 13:31909761-31909783 GCTTCGTAGAAAATTTCCATGGG - Intergenic
1107753242 13:43591871-43591893 TTTGCCTTCAAAGTTTCCATGGG - Intronic
1108783118 13:53860898-53860920 TCCTCCTTGCAAGTTTCCATAGG - Intergenic
1112978396 13:105349994-105350016 GTATCCTTGATAGCTTCCATTGG - Intergenic
1119446449 14:74668251-74668273 GGCTCCTTCAAAGTTCCCTTAGG - Intronic
1119654221 14:76405471-76405493 GTTTCCTTGTAAGTTGCCTTGGG + Intronic
1120445530 14:84590458-84590480 AGCTCCATGAAAATTTCCATAGG - Intergenic
1120809088 14:88784327-88784349 GTTTCCTTGAAATTTTGTATTGG - Intronic
1123859329 15:24447632-24447654 TGTTACTTGAAAGTTTGCAGCGG - Intergenic
1123979793 15:25590233-25590255 GGGTTCTTGAAAGTGACCATTGG - Intergenic
1125111095 15:36035302-36035324 GTTCCTTTAAAAGTTTCCATTGG - Intergenic
1125736478 15:41930044-41930066 AGGTCCTTGAATGTTTCTATAGG + Intronic
1126320009 15:47411727-47411749 GGTTTCTTGAGTGCTTCCATGGG + Intronic
1126986252 15:54312993-54313015 GTTTTCTTGGAAGTTTCCATGGG + Intronic
1127064824 15:55226128-55226150 GGCTACTTTAAAGTTTCCTTAGG + Intronic
1127389890 15:58497062-58497084 GGTTCCTTGGAGGTGTCCATTGG + Intronic
1129568131 15:76646706-76646728 GGTTGCTTGAAAGTTTTGATAGG - Intronic
1132386745 15:101406149-101406171 GCTTCCTAGAAAGTTTTCAGGGG - Intronic
1138235696 16:55380414-55380436 GTTCCCATGAAAGTTTCCATCGG - Intergenic
1140194081 16:72842662-72842684 TGTTTTTTGAAAGTTTTCATTGG - Intronic
1141552012 16:84812609-84812631 GATTCCTGTAAAGCTTCCATAGG + Intergenic
1144054050 17:11523118-11523140 GGTTCCTAAAAACTTACCATGGG - Intronic
1158964789 18:62612645-62612667 GTCTCCTTGAAACTTTCCTTGGG - Intergenic
1159489961 18:69119479-69119501 GGTCACTTGATAGTTTCCTTTGG + Intergenic
1162421328 19:10567661-10567683 GGTTCCTTGAAAGTTTCCATGGG - Intronic
1163892422 19:20028720-20028742 TGGTCCTTTAAAGTTTCCAGAGG + Intronic
1166594100 19:44029300-44029322 CCATGCTTGAAAGTTTCCATGGG - Intronic
928826063 2:35422533-35422555 GGTTTCTACAAAGTTTACATAGG - Intergenic
931189838 2:59989615-59989637 GGTTTCTTGGAAGGCTCCATTGG - Intergenic
931951270 2:67365297-67365319 GATTCCTTTAAATTTTCCAATGG + Intergenic
934253161 2:90381315-90381337 GGTCCATTCAAAGATTCCATTGG - Intergenic
936095689 2:109528847-109528869 GGGTCCTTGGAAGTGACCATGGG + Intergenic
938024319 2:127932485-127932507 CTTTTCTTAAAAGTTTCCATGGG - Intergenic
938785774 2:134627818-134627840 GGTTTCTTTGAAATTTCCATTGG - Intronic
939644501 2:144680360-144680382 GGATCCTTGAAAGTTTGCCATGG + Intergenic
942888037 2:180952536-180952558 GGATGCTAGAAATTTTCCATAGG - Intergenic
1170031775 20:11951555-11951577 GGGTCCTTGATATTTTACATTGG - Intergenic
1170093023 20:12613842-12613864 CCTTCCTAGTAAGTTTCCATAGG - Intergenic
1171008300 20:21490238-21490260 GCTTCCTGGAAAATTTTCATGGG + Intergenic
1173226985 20:41167912-41167934 TGTACCTTGAAAGTTGGCATAGG - Exonic
1175035444 20:55995853-55995875 AGTTCCTTGAAAGTTTCAAATGG + Intergenic
1184799967 22:46753165-46753187 AGTTCCTTGGAAGGTGCCATAGG + Intergenic
949679118 3:6492065-6492087 ACTTCCTTGATAGTTTTCATCGG + Intergenic
950868037 3:16205050-16205072 GGTTGCTGGAGAGTTTCCTTGGG - Intronic
951398575 3:22202456-22202478 GGTGCCTTGAAAATGTTCATTGG + Intronic
956236286 3:67075288-67075310 GTTTCCTTGAAAGACTCCATAGG - Intergenic
956908223 3:73789259-73789281 ATTTCCTTAAAAGTTTCCAGTGG + Intergenic
958092991 3:88901503-88901525 GGTTTCTTGAAAACATCCATAGG - Intergenic
959095452 3:101950668-101950690 GGTTCCTTGTAACTCTGCATGGG + Intergenic
961621887 3:128230884-128230906 GTTTCCTTCACAGTTTCCCTTGG + Intronic
963901354 3:150736249-150736271 TGCTCCTTGAAACTTTCCAGTGG + Intergenic
970619430 4:17802131-17802153 GGTTCCTGAAAAGTTTGCAATGG + Exonic
971469921 4:27012292-27012314 AATTCCATGAAAGGTTCCATTGG + Intronic
974331511 4:60485094-60485116 CTTTCCTTGTAAGTTTCCAGCGG + Intergenic
974602476 4:64103184-64103206 GATTTATTGAAATTTTCCATCGG + Intergenic
976529349 4:86134292-86134314 GTTTCCTTGAAAATATACATAGG - Intronic
978839571 4:113194348-113194370 GGTTCCATGAAAATTTTTATTGG + Intronic
980192178 4:129538779-129538801 AGTTCCTTGAAATCTTCCAGTGG - Intergenic
983974299 4:173914262-173914284 GGTTCCTTAGAAATTTTCATGGG - Intergenic
984895013 4:184530675-184530697 GGGCCCTAGAAAGTTTCCAAGGG - Intergenic
990823557 5:59871452-59871474 TGTTACTTTACAGTTTCCATGGG - Intronic
991372361 5:65932532-65932554 GGTTCCTTGAAAGTGTCTCAGGG + Intronic
993104421 5:83582935-83582957 GGTTCTATGATAATTTCCATGGG - Intergenic
998141052 5:139699772-139699794 GGTGCCTTGGATGTCTCCATGGG - Intergenic
999885088 5:155913443-155913465 GGTTCCCTAAAAGGTTCCAAAGG - Intronic
1001585580 5:172831946-172831968 GGTACCTTGTAGGTTTCCTTGGG - Intergenic
1001955702 5:175846899-175846921 GGGGCCCTGAAAGTTTCCAGGGG + Intronic
1002876826 6:1217962-1217984 GGGTCCTTGGAAGTTTCTAAAGG + Intergenic
1003919857 6:10822952-10822974 GTTTCTTTGAATGTTTCCTTTGG - Intronic
1004294634 6:14399444-14399466 TGTCCTTTGGAAGTTTCCATTGG + Intergenic
1006916037 6:37594472-37594494 GGATCCTTGGAGCTTTCCATTGG - Intergenic
1012260356 6:97081252-97081274 GCTAGTTTGAAAGTTTCCATGGG + Intronic
1018505077 6:164458047-164458069 GCTTCCTTGAGGGTCTCCATTGG - Intergenic
1021590908 7:22260731-22260753 AGTTCCATGAAAGTCTCTATAGG - Intronic
1023362058 7:39426933-39426955 GCTACATTGGAAGTTTCCATGGG - Intronic
1024958862 7:54954426-54954448 GGTGCCTTTAGAGATTCCATGGG - Intergenic
1028646467 7:93102867-93102889 TATTGCTTGAAAGTATCCATCGG - Exonic
1030765302 7:113401726-113401748 CGTTTCTTTTAAGTTTCCATAGG - Intergenic
1031736293 7:125366291-125366313 AGTTTTTTGAAAGTTTCAATAGG + Intergenic
1033474374 7:141676849-141676871 GGCTCTTGGACAGTTTCCATAGG - Intronic
1034055683 7:148032578-148032600 GGGACCTTGAACGTTTCCCTTGG - Intronic
1037368765 8:18150582-18150604 TGTTCCTTGTAACTTTGCATTGG - Intergenic
1038743196 8:30233573-30233595 GTGTCCTTGAAATTTTCCAATGG + Intergenic
1040765519 8:50905313-50905335 GTTTCCTTCACAGTTTCCACAGG + Intergenic
1043038403 8:75228193-75228215 ATTTACTTGAAATTTTCCATGGG + Intergenic
1043178884 8:77058377-77058399 GTTACATTGAAATTTTCCATTGG - Intergenic
1045380909 8:101624732-101624754 GTTTCCATGACAGTTTCCAGAGG + Intronic
1045972386 8:108093495-108093517 GTTTCCTTAAAATTTTGCATAGG + Intergenic
1049073450 8:140374827-140374849 GGTTCCATGAAAGAATCAATGGG - Intronic
1051167667 9:14281987-14282009 TTTTCCTTTAAAGTTTACATTGG - Intronic
1052411502 9:28127580-28127602 GGTTCCTTGTCCGATTCCATGGG - Intronic
1056168610 9:83961465-83961487 ACTTCCTTGAAATTGTCCATTGG + Intergenic
1056554443 9:87677035-87677057 GGTTCCTTGGAGGTTTTCATAGG + Intronic
1058209970 9:102155016-102155038 TATTTCTTGAAAATTTCCATTGG + Intergenic
1060439119 9:123621783-123621805 GGTGCCATGAAATTTTGCATAGG - Intronic
1060980663 9:127789761-127789783 GGTTCCCAGAGGGTTTCCATGGG + Exonic
1186637869 X:11426137-11426159 GGTTCCTGGAACGTTTGCCTGGG + Intronic
1186756279 X:12674626-12674648 GCTTCCTAGTAAGTTTACATTGG - Intronic
1187118186 X:16375129-16375151 GGTTCCTTGTAAGGCTCCAGGGG + Intergenic
1189525747 X:41819189-41819211 TGCTCTTTGAAAGATTCCATTGG + Intronic
1193357756 X:80541923-80541945 ATTTCTTTGAAAATTTCCATTGG + Intergenic
1193549523 X:82872805-82872827 GCTTCCTTCAAAGAGTCCATAGG + Intergenic
1195427592 X:104752113-104752135 GCTTCCTGGAAAATTTCTATGGG + Intronic
1195529980 X:105942992-105943014 ACTTCCTTGATAGTTTCCCTTGG + Intronic
1200299464 X:154958126-154958148 GGTTTCTTTAGAGTTACCATGGG + Intronic
1200394313 X:155974454-155974476 AGTTCCTTGCCAGTCTCCATGGG - Intergenic