ID: 1162421329

View in Genome Browser
Species Human (GRCh38)
Location 19:10567662-10567684
Sequence AGGTTCCTTGAAAGTTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162421329_1162421339 19 Left 1162421329 19:10567662-10567684 CCATGGAAACTTTCAAGGAACCT 0: 1
1: 1
2: 0
3: 12
4: 173
Right 1162421339 19:10567704-10567726 CCAAAGACGCCCCCAGATATGGG 0: 1
1: 0
2: 0
3: 3
4: 67
1162421329_1162421337 18 Left 1162421329 19:10567662-10567684 CCATGGAAACTTTCAAGGAACCT 0: 1
1: 1
2: 0
3: 12
4: 173
Right 1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG 0: 1
1: 0
2: 1
3: 1
4: 69
1162421329_1162421330 -6 Left 1162421329 19:10567662-10567684 CCATGGAAACTTTCAAGGAACCT 0: 1
1: 1
2: 0
3: 12
4: 173
Right 1162421330 19:10567679-10567701 GAACCTAAGACTCTCCCCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 137
1162421329_1162421343 30 Left 1162421329 19:10567662-10567684 CCATGGAAACTTTCAAGGAACCT 0: 1
1: 1
2: 0
3: 12
4: 173
Right 1162421343 19:10567715-10567737 CCCAGATATGGGCAATCACCAGG 0: 1
1: 0
2: 0
3: 5
4: 101
1162421329_1162421331 -5 Left 1162421329 19:10567662-10567684 CCATGGAAACTTTCAAGGAACCT 0: 1
1: 1
2: 0
3: 12
4: 173
Right 1162421331 19:10567680-10567702 AACCTAAGACTCTCCCCCAAGGG 0: 1
1: 0
2: 1
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162421329 Original CRISPR AGGTTCCTTGAAAGTTTCCA TGG (reversed) Intronic
902887964 1:19420171-19420193 AGGTTCCTTGAGAAGCTCCAAGG + Intronic
904767677 1:32862864-32862886 GGGTTCCATGAAAGTTACCCAGG - Exonic
906397462 1:45479350-45479372 AGATTCCATGAAATTGTCCAAGG + Intronic
910526698 1:88187063-88187085 AGTTTCCTTTGAGGTTTCCATGG + Intergenic
911498899 1:98661933-98661955 AGTTGCCTTGGAAGTTTCCCGGG - Intronic
914694321 1:150062145-150062167 AGCTTCCTTGGGAGTTTCCATGG + Intergenic
917254687 1:173101844-173101866 ATGTTCCTTAAGAATTTCCAAGG + Intergenic
917594765 1:176517915-176517937 AGTTGCCTTGAAAATATCCATGG + Intronic
917653667 1:177104229-177104251 GGGGTCCTTGAAAGCTTTCAAGG - Intronic
918245009 1:182651624-182651646 AGTTTCCTTGAGAGATTTCATGG - Intronic
918657679 1:187048397-187048419 AGATTTCTTGAAAGTTTTAATGG - Intergenic
920769716 1:208870501-208870523 AGATTCCTTGTAAGTTTGCTGGG + Intergenic
921783974 1:219204089-219204111 AGGATCCATGAATGTCTCCAAGG - Intronic
924617116 1:245621146-245621168 ATATTTCTTGAAAGATTCCAGGG + Intronic
1067549281 10:47222280-47222302 AGGTGCCAAGAAAGCTTCCAGGG + Intergenic
1071281997 10:84111665-84111687 TAGTTCCTTGACAGTCTCCATGG + Intergenic
1072569552 10:96646659-96646681 AGGAACCCTGACAGTTTCCAGGG + Intronic
1073831863 10:107393892-107393914 AAGATCTTTGAAGGTTTCCATGG - Intergenic
1074982914 10:118634062-118634084 AGGGTCCTTAACAGCTTCCAGGG - Intergenic
1084811284 11:71613229-71613251 TAGTTCCTTGTAAGTCTCCACGG + Intergenic
1085870017 11:80338507-80338529 TGGTTCCTAGACTGTTTCCACGG - Intergenic
1086938729 11:92772296-92772318 CCTTTCTTTGAAAGTTTCCATGG + Intronic
1087335736 11:96842001-96842023 AAGTTCTTGGAAACTTTCCAGGG + Intergenic
1088644866 11:111910016-111910038 AGGTTTTTTGAAAGTTCCCCTGG + Intronic
1089170192 11:116506450-116506472 AGGGTCCCTGGCAGTTTCCATGG + Intergenic
1090398372 11:126433781-126433803 AGATTCCTAGTAAGTTTCCTTGG + Intronic
1091663976 12:2405169-2405191 AGGTTCATAGGAAGTTTCAAAGG + Intronic
1093025786 12:14244151-14244173 TGGTAGCTTGAAATTTTCCATGG - Intergenic
1095813508 12:46396887-46396909 ATGTTACTTAAAAGTTTCTATGG + Intergenic
1096531813 12:52247358-52247380 AGGTTTGCTGAAAGCTTCCAGGG - Intronic
1097754004 12:63389081-63389103 AGCTTCCTTGGAATTGTCCACGG + Intergenic
1098431902 12:70428647-70428669 AAGTTTCTTGAAAATTTGCATGG + Intronic
1101711232 12:107268676-107268698 AGCTTTCATGAAAGTTTCAAAGG + Intergenic
1107471673 13:40696929-40696951 AGGTTCCTGGGAAGTTTCTCAGG - Intergenic
1108457743 13:50633651-50633673 AGGTTCCATGGAAGTGACCAGGG - Intronic
1109713506 13:66189421-66189443 AGATTCTTTGAAAGTTGTCATGG + Intergenic
1110329696 13:74257284-74257306 AAGTTCCCTGAATTTTTCCATGG + Intergenic
1113113380 13:106848567-106848589 TGGTTGCTTGAAATTGTCCAAGG + Intergenic
1115386682 14:32806060-32806082 TGGTTCGTTGTATGTTTCCATGG + Intronic
1119961848 14:78867535-78867557 AGATTCCTTTCAAGTTTCTACGG - Intronic
1120067627 14:80062098-80062120 AGGTCCCTTGAAAGTTCCTCAGG + Intergenic
1120916908 14:89718504-89718526 AGCTTCCTTGATCTTTTCCAAGG + Intergenic
1123982530 15:25616786-25616808 AGCTACCTTCAAAGATTCCAAGG - Intergenic
1124131311 15:26989183-26989205 TGGTTTCTTGAATGTTTTCAAGG + Intronic
1125419011 15:39485229-39485251 AGTTTCCTTGAACCTTTTCAAGG - Intergenic
1126249187 15:46546586-46546608 ACATTCCTTTAAAGTTTACATGG - Intergenic
1126986251 15:54312992-54313014 GGTTTTCTTGGAAGTTTCCATGG + Intronic
1131453330 15:92563976-92563998 AGGTTCCTTGCTAGTTTTAACGG + Intergenic
1131588891 15:93726958-93726980 AGGGTCCTTGATTGTGTCCAAGG - Intergenic
1132386746 15:101406150-101406172 AGCTTCCTAGAAAGTTTTCAGGG - Intronic
1133763422 16:8818401-8818423 AGGTTGTTTGAAGGTTTACATGG - Intronic
1134315181 16:13112474-13112496 ATGTTCCTTGAGAGATTCCAAGG - Intronic
1138377797 16:56578091-56578113 AGCTTACTTGAACGTTTTCATGG - Intergenic
1140482839 16:75271786-75271808 AGTGTCCTAGAAAGTTCCCATGG + Intergenic
1140846510 16:78893668-78893690 AGGTTCCCTGGTATTTTCCAGGG + Intronic
1141555885 16:84836572-84836594 AGGACCCTGGAGAGTTTCCAGGG + Intronic
1142219434 16:88846417-88846439 AGGTCCCTTGCAGGTTTCCGAGG + Intronic
1142923484 17:3211859-3211881 AGATTCCTTAAAATTTTCTATGG + Intergenic
1145865089 17:28236043-28236065 AAGTTCCTTGTCAGTCTCCACGG - Intergenic
1146773340 17:35588759-35588781 TGCTTCCTTGAAAGTTTCAACGG - Intronic
1149611494 17:57960600-57960622 CAGTTCCTTAAAAGTTTCCTAGG - Intergenic
1151415392 17:73958938-73958960 AGGTTCTTTGACAGTTTTCCAGG - Intergenic
1156121527 18:33848518-33848540 AGGTTCCTTGTAAGTATACTGGG - Intergenic
1158705078 18:59785204-59785226 AGCTTCCCTGAAACTTGCCAAGG - Intergenic
1160217770 18:76948193-76948215 TCTTTCCTTAAAAGTTTCCAGGG + Intronic
1162421329 19:10567662-10567684 AGGTTCCTTGAAAGTTTCCATGG - Intronic
1164736899 19:30548364-30548386 AGGGTCCTTGCAAGCTTTCATGG + Exonic
1166594102 19:44029301-44029323 ACCATGCTTGAAAGTTTCCATGG - Intronic
1167044743 19:47042929-47042951 AGGTTCCTTGGAGCTTCCCAGGG - Intronic
1168451194 19:56467833-56467855 AGGTTCCTGGAGGGTTCCCAAGG - Intronic
926468845 2:13227652-13227674 AAGTTCCTTGAGGGTGTCCAAGG - Intergenic
926989900 2:18667646-18667668 AAGTTCCTTGAATGTTTCTTGGG - Intergenic
928035885 2:27822521-27822543 AGGTTACTTGCAGGTTTCCCAGG - Intronic
930827889 2:55712656-55712678 AGGGTCCTTGAATGGTTCCTGGG + Intergenic
933654271 2:84874844-84874866 TGGTTCCTTGAAGGCTTCGAGGG - Intronic
934815864 2:97325997-97326019 AGGTACCTGTATAGTTTCCATGG + Intergenic
934821831 2:97382486-97382508 AGGTACCTGTATAGTTTCCATGG - Intergenic
936020375 2:108989957-108989979 AGTTACCTTGTAGGTTTCCAAGG - Intergenic
936095688 2:109528846-109528868 AGGGTCCTTGGAAGTGACCATGG + Intergenic
936635266 2:114249007-114249029 ATTTTCCTGGAGAGTTTCCAAGG + Intergenic
940624337 2:156153479-156153501 CAGTTCCTTGAAATTTTTCAAGG - Intergenic
941251921 2:163176007-163176029 ATGTACCTTGAAAGTTTACCAGG + Intergenic
942674164 2:178410164-178410186 AGGTTCCTTGAAAACTTCTATGG + Intergenic
943205974 2:184896382-184896404 AGTTTACCTGAAATTTTCCAGGG + Intronic
945508224 2:210667632-210667654 AGGTTCCTTTGAGGTTTTCATGG + Intronic
946316841 2:218921754-218921776 ATTTTCCCTGAAAGTTTACAGGG + Intergenic
948926750 2:241103774-241103796 AGGTTCCTTGATTCTTTCCAGGG - Intergenic
1170327296 20:15171002-15171024 AGGGTCTCTGAAATTTTCCATGG - Intronic
1173161065 20:40652988-40653010 AGGTTCCTTGAAAGGGACCCAGG + Intergenic
1173354738 20:42276711-42276733 AGCTTCCTTGAGAGGTTGCATGG - Intronic
1174933119 20:54837326-54837348 AGGATCCTTGTAAGTTTAGATGG + Intergenic
1178195256 21:30337509-30337531 AGGTTTCTTGAAAGTTGTCCAGG + Exonic
1182794102 22:32977777-32977799 AGGCTGCTTGTCAGTTTCCAGGG - Intronic
953197546 3:40748553-40748575 AAGTTCCTGGAAAGTCTGCATGG + Intergenic
956213255 3:66823739-66823761 AGGTCCTGGGAAAGTTTCCACGG + Intergenic
957217370 3:77337984-77338006 AGCATCCTTGAAACATTCCATGG + Intronic
958809680 3:98846335-98846357 AGGTTCCTTGAAAATATTTATGG + Intronic
958899194 3:99865666-99865688 AGGTTCCTTGAAATGTTCTATGG - Intronic
961423086 3:126822548-126822570 GGATTCCTTGAAATTTTCTATGG + Intronic
961836982 3:129670383-129670405 ATGTTCCTTGAGAGTCTCAAAGG + Exonic
961902752 3:130229493-130229515 AGGTTCATTGAAAGTTTCCATGG + Intergenic
962927264 3:140006481-140006503 AGGTGCCTGGAGAGGTTCCAAGG - Intronic
964727651 3:159831397-159831419 AGGGTCCTGGAAAGTATCCCTGG - Intronic
965851793 3:173035745-173035767 AGGTTCCTTGACATTTTCAGGGG + Intronic
967044808 3:185726852-185726874 AGGTTCTCTGAAACTTACCAAGG + Intronic
971580104 4:28326318-28326340 AGGTCCCTTAAATGTGTCCATGG - Intergenic
972174317 4:36384932-36384954 TGGTTGCTTGAAATTGTCCATGG + Intergenic
972620135 4:40739724-40739746 AGTTTCCTTGAAACTTTCACAGG + Intergenic
972822017 4:42712940-42712962 AGGATGCTTGTAGGTTTCCAGGG - Intergenic
974221421 4:58977436-58977458 TGCTTCCTTAAAAATTTCCAAGG + Intergenic
974248299 4:59351610-59351632 TGGTACCTTGAAATTGTCCATGG + Intergenic
976406762 4:84668165-84668187 CGGTTCCTTGAAAATTTTTAAGG + Intergenic
977828427 4:101560956-101560978 AGGTTATTTGTGAGTTTCCATGG + Intronic
980519416 4:133910869-133910891 AGCTTCCTTCAAAGTGTCTACGG + Intergenic
981256215 4:142662682-142662704 GGGTTCCCTGAATGATTCCATGG + Intronic
981590675 4:146356928-146356950 ACCTTTATTGAAAGTTTCCAAGG + Intronic
982341211 4:154300940-154300962 AGGTTACTTGAAGTTTTCTAAGG + Intronic
983796086 4:171865210-171865232 AGGTTTCTTGAAATTTATCAAGG - Intronic
984895014 4:184530676-184530698 GGGGCCCTAGAAAGTTTCCAAGG - Intergenic
985149865 4:186935835-186935857 AGGCTGCTTCAGAGTTTCCAAGG - Intergenic
987948304 5:24644070-24644092 AGATTCCTTGAAACTGTCAATGG - Intronic
988998727 5:36739590-36739612 AGGATACTAGAAAGTTTTCAAGG + Intergenic
989986007 5:50698762-50698784 GAGTTCCTTGAAAGTGTTCAGGG + Intronic
990453883 5:55964801-55964823 ATATTACTTGAAACTTTCCATGG - Intronic
991085312 5:62643743-62643765 ATGTTCCTGGACAGTTGCCACGG + Intergenic
991351749 5:65726537-65726559 AGATTCCTTGAAAGTGTCTCAGG + Intronic
991372360 5:65932531-65932553 AGGTTCCTTGAAAGTGTCTCAGG + Intronic
992216965 5:74535719-74535741 AGCTTCCTTGGAAGAGTCCAAGG - Intergenic
995242753 5:109903420-109903442 TTCCTCCTTGAAAGTTTCCATGG - Intergenic
996152845 5:120061271-120061293 AGGTTTCAGGCAAGTTTCCAAGG + Intergenic
996530744 5:124524477-124524499 ATGTTCCTTGAAGTTTTACATGG - Intergenic
998622289 5:143808213-143808235 AGGAAGCTTGAAAGTTTCAACGG - Intergenic
999512388 5:152266217-152266239 TGGTTCCTAGAAAGTTCCTATGG + Intergenic
1001955701 5:175846898-175846920 AGGGGCCCTGAAAGTTTCCAGGG + Intronic
1003833241 6:10038124-10038146 AAGTACCTTGAAATTTTCCCTGG + Intronic
1005446672 6:25931164-25931186 AGCTTCCTGGGAAGTTGCCAGGG - Intergenic
1007053020 6:38852278-38852300 AGTTTCCTTGTTGGTTTCCAGGG + Intronic
1007062520 6:38954904-38954926 AGAGTCCTTGAAAGTTTTAAAGG - Intronic
1007169233 6:39850757-39850779 AGGTACCTTGGAAGTGACCAGGG + Intronic
1009302395 6:62041683-62041705 TAGGTCCCTGAAAGTTTCCAAGG + Intronic
1009713332 6:67353558-67353580 AAGTTCTTTGAAGGTTTCCTGGG + Intergenic
1013268810 6:108527006-108527028 ATGTTCCTTGTAAGATTCTAAGG + Intergenic
1015573110 6:134642401-134642423 GGGTGTCTTGGAAGTTTCCAAGG + Intergenic
1015847614 6:137537189-137537211 AGGTTCTTTGAAATTTTAGAGGG - Intergenic
1015970480 6:138738511-138738533 AGGTTTCTGCAAAGCTTCCAGGG - Intergenic
1016702935 6:147074030-147074052 AGATTCCTTGAAAGAATCTATGG + Intergenic
1018681234 6:166267463-166267485 AGATTCCTTTAATGATTCCAAGG + Intergenic
1020605395 7:10331072-10331094 ATGTTCCTTCAAATTTTCCTGGG + Intergenic
1021955344 7:25818911-25818933 ATGTTCCCTGAATGTTTACAAGG + Intergenic
1021955360 7:25819072-25819094 ACATTCCTTGAAATTTTACAGGG + Intergenic
1022311532 7:29200764-29200786 AGGTTCATTTAAAGTCTCCATGG + Intronic
1028478743 7:91280933-91280955 GGGCTGCTTGAAACTTTCCAAGG - Intergenic
1031001033 7:116415080-116415102 AGGATTCTTGAAAGATACCAAGG + Intronic
1031044209 7:116869247-116869269 AGGTTCCATGAAAATACCCATGG + Intronic
1032333383 7:131001256-131001278 ATGTTCCTTAAATATTTCCAAGG + Intergenic
1034076989 7:148241608-148241630 CTGTTCCTTCAAGGTTTCCATGG + Intronic
1034120652 7:148624226-148624248 AGTTTCTTAGAAAGTCTCCAGGG - Intergenic
1036219116 8:6906086-6906108 AGGTGCCATGAAAGGATCCATGG + Intergenic
1036456529 8:8913781-8913803 AAATTCCATGAAAGTTCCCAAGG - Intergenic
1037448151 8:18988751-18988773 CTGTTCCTTAAAAGTTTCTAAGG - Intronic
1038612031 8:29066954-29066976 AGGGCCCCAGAAAGTTTCCATGG + Intergenic
1039232330 8:35461998-35462020 AGATACCATGAAACTTTCCAGGG - Intronic
1043596188 8:81888521-81888543 AGCTACCTTGAAGGTTTTCAAGG - Intergenic
1044631199 8:94280228-94280250 GGTTTCTTTGAATGTTTCCATGG - Intergenic
1044914376 8:97096846-97096868 AGGTTAGTTTAAAGTTTCCTGGG - Intronic
1045727740 8:105195529-105195551 ATGTTCCTTGAGAGTGTCAAAGG + Intronic
1047170614 8:122489091-122489113 AGTTTCCTTGAAAGCTTCCTTGG - Intergenic
1047807025 8:128371479-128371501 AAGTTCTTGGCAAGTTTCCAAGG - Intergenic
1049073451 8:140374828-140374850 AGGTTCCATGAAAGAATCAATGG - Intronic
1051753329 9:20367506-20367528 AGTTTTTTTGAAAGATTCCATGG + Intronic
1052028103 9:23597130-23597152 AACTTCCTTCAAAGTTCCCATGG + Intergenic
1052411503 9:28127581-28127603 AGGTTCCTTGTCCGATTCCATGG - Intronic
1052774615 9:32720964-32720986 AGGTTCCTGAGAAGTTCCCAGGG + Intergenic
1054955923 9:70909684-70909706 AGGTTCTTTGAAGATTTTCAAGG + Intronic
1059865895 9:118513640-118513662 AGGTTTCTTGAAAGTTAATATGG - Intergenic
1060104391 9:120864372-120864394 AGATTCCATGATAGATTCCATGG - Intronic
1186637868 X:11426136-11426158 AGGTTCCTGGAACGTTTGCCTGG + Intronic
1187118185 X:16375128-16375150 TGGTTCCTTGTAAGGCTCCAGGG + Intergenic
1189300791 X:39950886-39950908 ATGTCATTTGAAAGTTTCCAGGG - Intergenic
1189621425 X:42844391-42844413 AGCTTCCTTGCAACTTTCCAAGG - Intergenic
1192103370 X:68289289-68289311 AATTTCTTTGAAATTTTCCAAGG - Intronic
1195464338 X:105163490-105163512 AGTTTTCTTGAAAGTTTGGAAGG + Intronic
1195551859 X:106180553-106180575 AGCTTCCTTGTGAGTTTTCAGGG + Intronic
1197541561 X:127769591-127769613 AAGTTCCTTGACAGTAGCCAGGG + Intergenic
1198295548 X:135283226-135283248 ATGGTCCTTGAGAGTTTCCCTGG + Intronic
1198719509 X:139600745-139600767 AAGCTCATTGGAAGTTTCCAGGG - Intronic
1201934490 Y:19393319-19393341 AGGTTCCTTGGAACCTTCAAAGG + Intergenic