ID: 1162421332

View in Genome Browser
Species Human (GRCh38)
Location 19:10567682-10567704
Sequence GTCCCTTGGGGGAGAGTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162421332_1162421337 -2 Left 1162421332 19:10567682-10567704 CCTAAGACTCTCCCCCAAGGGAC No data
Right 1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG No data
1162421332_1162421343 10 Left 1162421332 19:10567682-10567704 CCTAAGACTCTCCCCCAAGGGAC No data
Right 1162421343 19:10567715-10567737 CCCAGATATGGGCAATCACCAGG No data
1162421332_1162421339 -1 Left 1162421332 19:10567682-10567704 CCTAAGACTCTCCCCCAAGGGAC No data
Right 1162421339 19:10567704-10567726 CCAAAGACGCCCCCAGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162421332 Original CRISPR GTCCCTTGGGGGAGAGTCTT AGG (reversed) Intronic