ID: 1162421337

View in Genome Browser
Species Human (GRCh38)
Location 19:10567703-10567725
Sequence ACCAAAGACGCCCCCAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162421327_1162421337 20 Left 1162421327 19:10567660-10567682 CCCCATGGAAACTTTCAAGGAAC No data
Right 1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG No data
1162421332_1162421337 -2 Left 1162421332 19:10567682-10567704 CCTAAGACTCTCCCCCAAGGGAC No data
Right 1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG No data
1162421328_1162421337 19 Left 1162421328 19:10567661-10567683 CCCATGGAAACTTTCAAGGAACC No data
Right 1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG No data
1162421325_1162421337 22 Left 1162421325 19:10567658-10567680 CCCCCCATGGAAACTTTCAAGGA No data
Right 1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG No data
1162421326_1162421337 21 Left 1162421326 19:10567659-10567681 CCCCCATGGAAACTTTCAAGGAA No data
Right 1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG No data
1162421329_1162421337 18 Left 1162421329 19:10567662-10567684 CCATGGAAACTTTCAAGGAACCT No data
Right 1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162421337 Original CRISPR ACCAAAGACGCCCCCAGATA TGG Intronic