ID: 1162421337

View in Genome Browser
Species Human (GRCh38)
Location 19:10567703-10567725
Sequence ACCAAAGACGCCCCCAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 69}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162421328_1162421337 19 Left 1162421328 19:10567661-10567683 CCCATGGAAACTTTCAAGGAACC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG 0: 1
1: 0
2: 1
3: 1
4: 69
1162421325_1162421337 22 Left 1162421325 19:10567658-10567680 CCCCCCATGGAAACTTTCAAGGA 0: 1
1: 1
2: 1
3: 11
4: 142
Right 1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG 0: 1
1: 0
2: 1
3: 1
4: 69
1162421327_1162421337 20 Left 1162421327 19:10567660-10567682 CCCCATGGAAACTTTCAAGGAAC 0: 1
1: 0
2: 1
3: 14
4: 216
Right 1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG 0: 1
1: 0
2: 1
3: 1
4: 69
1162421332_1162421337 -2 Left 1162421332 19:10567682-10567704 CCTAAGACTCTCCCCCAAGGGAC 0: 1
1: 0
2: 2
3: 11
4: 164
Right 1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG 0: 1
1: 0
2: 1
3: 1
4: 69
1162421326_1162421337 21 Left 1162421326 19:10567659-10567681 CCCCCATGGAAACTTTCAAGGAA 0: 1
1: 0
2: 3
3: 24
4: 229
Right 1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG 0: 1
1: 0
2: 1
3: 1
4: 69
1162421329_1162421337 18 Left 1162421329 19:10567662-10567684 CCATGGAAACTTTCAAGGAACCT 0: 1
1: 1
2: 0
3: 12
4: 173
Right 1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG 0: 1
1: 0
2: 1
3: 1
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162421337 Original CRISPR ACCAAAGACGCCCCCAGATA TGG Intronic
900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG + Intronic
905886093 1:41493032-41493054 ACCAAAGAGTCCCCCAGAACAGG + Intergenic
910813578 1:91264244-91264266 ACCAAAGTCGCCCCTAGCTCTGG + Intronic
913121021 1:115740837-115740859 AACAAAGAGGCCCACAGAGAAGG + Intronic
915011100 1:152686992-152687014 ACCACAGCAGCCCCCAGAGATGG - Exonic
916551625 1:165855331-165855353 AGCAAAGATGTCCCCAAATAAGG + Intronic
916691779 1:167196855-167196877 ACCACAGAGCCCCCCAGAAAGGG + Intergenic
922568384 1:226616990-226617012 ACCAAAGATGCTTCCAGAAATGG + Intergenic
1070549053 10:77476284-77476306 AACAAAGATGGCCCCAGAAAGGG + Intronic
1075792428 10:125094612-125094634 ACCAGAGATGTCGCCAGATAGGG - Intronic
1077131137 11:973259-973281 ACCAAAAATGCCCCAAGACACGG - Intronic
1077639824 11:3871373-3871395 ACCAAAGAGACGACCAGATAAGG - Intronic
1085279343 11:75320037-75320059 ACCAAAGTCCCCCCCAGAGCAGG + Intronic
1088907023 11:114162704-114162726 ACCAAAGGCGCCCCCACATAAGG - Intronic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1101910421 12:108857182-108857204 TGCAAAGTCGCCCCCCGATAGGG + Intronic
1108123069 13:47210647-47210669 ACTAAAGGAGCCCCCAGCTAAGG - Intergenic
1118324747 14:64773437-64773459 ACCAAAAAGGCCCTCAGAGACGG + Intronic
1121019767 14:90572878-90572900 ACCTAAGACCCCTCCAGATGAGG + Intronic
1121662594 14:95646544-95646566 ACCAAAATCGCCCCCAGGAAGGG - Intergenic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1123053371 14:105558616-105558638 CTCAAAGACGCGCCCAGATCAGG - Intergenic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1132321776 15:100930586-100930608 AGCACAGAGGCCACCAGATAGGG - Intronic
1142978311 17:3657926-3657948 AGCAAGGACGGCCCCGGATAGGG - Intronic
1152232148 17:79119222-79119244 ACCACAGATGCCCTCAGATCTGG - Intronic
1158912934 18:62085917-62085939 ACCATAGACACCCACAGAAATGG + Intronic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160896036 19:1402338-1402360 CCCAAAGACGCCTCCAGTTCTGG + Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161330515 19:3684710-3684732 ACCACAGACGCACCCAGAGCGGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
1164286459 19:23821638-23821660 AACAAAGAGGCCCCCAGCCAAGG - Intronic
1167663088 19:50807863-50807885 CCCAAAGATGGCCCCAGAGAGGG + Intergenic
929245567 2:39698615-39698637 ACCAAAGACACCACAAGAAAAGG - Intronic
1173042575 20:39478272-39478294 ATCAGACACTCCCCCAGATATGG - Intergenic
1175786271 20:61713597-61713619 GCCAAAGACTCCCCCAGAAAAGG + Intronic
1178366074 21:31989833-31989855 AGCAAAGACACCCACAGAAATGG - Intronic
1181430130 22:22875060-22875082 ACAAAAGACACCCCTAGACAGGG + Intronic
950350842 3:12350498-12350520 TTCAAAGACGCCCCCACACAGGG - Intronic
953381782 3:42477683-42477705 GCCAAAAAAGCCCTCAGATAGGG - Intergenic
953909596 3:46884953-46884975 ACCAAAGACAGCCCCATACAAGG + Intronic
969501343 4:7555352-7555374 TCCAAAGACACCCCCAGCCATGG + Intronic
970178175 4:13360099-13360121 ACCAAAGATGTCCCCAGTAAAGG - Intergenic
971810358 4:31417274-31417296 ACTAAAGAGGCCCCAAGAAAGGG - Intergenic
975237802 4:72020786-72020808 AGCAAAGACCCCCCCAGAAGAGG - Intergenic
975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG + Intergenic
976116377 4:81732647-81732669 ACCAAAGAGAACTCCAGATATGG - Intronic
1001577366 5:172772766-172772788 AGCAAAGAGGTCCTCAGATAAGG + Intergenic
1004976596 6:20974030-20974052 AACAAAGAGGCCCCAAAATATGG + Intronic
1006441760 6:34057649-34057671 GGCAAAATCGCCCCCAGATAAGG + Intronic
1007096887 6:39218772-39218794 GCCAAAGGTGCCCCCAGCTAGGG + Intronic
1008078860 6:47173960-47173982 ACTGAAGACTCCCCCAGAGATGG - Intergenic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1029851626 7:103467076-103467098 ACCTAAGACACACCCTGATATGG - Intergenic
1033226542 7:139567504-139567526 CTCAAAGACGCCTCCAGAAATGG - Exonic
1035465733 7:159075514-159075536 ACCAAAGAAGACCCCTGATGAGG + Intronic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1038434525 8:27525907-27525929 TTCAAAGATGCCCCCAGATGTGG + Intronic
1042429979 8:68694707-68694729 AACTAAGAAGCCCCCAGATGTGG - Intronic
1052353475 9:27481230-27481252 ACAAAAGACTCCAGCAGATATGG + Intronic
1059177874 9:112183797-112183819 ACAAAAGAGGCTCCCAGAGAAGG - Intergenic
1060192775 9:121603614-121603636 ACCAAAGCCACAACCAGATAGGG - Intronic
1190282765 X:48941868-48941890 ACCAAGGAAACCTCCAGATAAGG + Intronic
1191005224 X:55703906-55703928 AACAAAGACCCCCCAAAATATGG + Intergenic
1199229718 X:145423101-145423123 TTGAAAGACGCCCCCAGATGGGG + Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1200859867 Y:7979326-7979348 ACCAAAAACGCCCACATATTGGG + Intergenic