ID: 1162422362

View in Genome Browser
Species Human (GRCh38)
Location 19:10573089-10573111
Sequence CTGCAGAGAAAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 777
Summary {0: 1, 1: 0, 2: 2, 3: 67, 4: 707}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162422351_1162422362 30 Left 1162422351 19:10573036-10573058 CCGTGTTCAAGCCCCCATCTCTT 0: 1
1: 0
2: 3
3: 30
4: 361
Right 1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG 0: 1
1: 0
2: 2
3: 67
4: 707
1162422352_1162422362 19 Left 1162422352 19:10573047-10573069 CCCCCATCTCTTCTCCCTTCTAG 0: 1
1: 1
2: 14
3: 121
4: 1374
Right 1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG 0: 1
1: 0
2: 2
3: 67
4: 707
1162422355_1162422362 16 Left 1162422355 19:10573050-10573072 CCATCTCTTCTCCCTTCTAGCTG 0: 1
1: 0
2: 7
3: 97
4: 858
Right 1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG 0: 1
1: 0
2: 2
3: 67
4: 707
1162422353_1162422362 18 Left 1162422353 19:10573048-10573070 CCCCATCTCTTCTCCCTTCTAGC 0: 1
1: 0
2: 2
3: 57
4: 649
Right 1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG 0: 1
1: 0
2: 2
3: 67
4: 707
1162422358_1162422362 4 Left 1162422358 19:10573062-10573084 CCTTCTAGCTGGTACGAAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG 0: 1
1: 0
2: 2
3: 67
4: 707
1162422354_1162422362 17 Left 1162422354 19:10573049-10573071 CCCATCTCTTCTCCCTTCTAGCT 0: 1
1: 0
2: 4
3: 56
4: 795
Right 1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG 0: 1
1: 0
2: 2
3: 67
4: 707
1162422357_1162422362 5 Left 1162422357 19:10573061-10573083 CCCTTCTAGCTGGTACGAAGTTG 0: 1
1: 0
2: 1
3: 12
4: 193
Right 1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG 0: 1
1: 0
2: 2
3: 67
4: 707

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162422362 Original CRISPR CTGCAGAGAAAGAATGAGGA GGG Intronic
900726189 1:4217892-4217914 CTGCAGACCAAGAGTGAGGGAGG + Intergenic
901059422 1:6465294-6465316 CTGGAGAGAAAGAGGGAGGGAGG - Intronic
901886654 1:12228308-12228330 CTCCACAGACAGAAGGAGGAAGG - Intergenic
903762271 1:25706997-25707019 CAGAAGAGACAGAATGGGGAGGG + Intronic
903818712 1:26084417-26084439 CAGAAGTGAGAGAATGAGGAAGG + Intergenic
904565804 1:31427685-31427707 CTGCAAAGTGAGGATGAGGATGG - Intronic
906485632 1:46232618-46232640 CTGAAGTGAAAGAATGAGGTGGG + Intergenic
906562023 1:46765314-46765336 ATGGAGAGAAGGAATGAAGAGGG - Intronic
906845668 1:49189048-49189070 CTGCCCAGAAGGAAAGAGGAGGG + Intronic
907466371 1:54640456-54640478 CTGGAGATAAAGAGTGAGGGAGG + Intergenic
907615271 1:55918174-55918196 CTGCACAGAAAGCATGATGTTGG + Intergenic
908298863 1:62741393-62741415 CTTCATAGAATGAATTAGGAAGG - Intergenic
909516053 1:76508497-76508519 CTGCACAGAAAGACCTAGGAAGG + Intronic
910015681 1:82520393-82520415 CTGGAGAGAAAGGCTGTGGAGGG + Intergenic
910053024 1:82998628-82998650 TTGCAAAGAAAGGAAGAGGAGGG + Intergenic
910102698 1:83595629-83595651 TGGAAGAGAAAGAATAAGGAAGG + Intergenic
910265089 1:85330144-85330166 ATGCAGAGAAAGATGCAGGAAGG + Intronic
910496985 1:87841054-87841076 TTGCACAGAATGAATGCGGATGG - Intergenic
910711808 1:90189892-90189914 CTGCAGAGAGGGAAAGAGGAGGG - Intergenic
910905288 1:92170922-92170944 TTGCAGATATATAATGAGGAAGG - Intronic
911143712 1:94532725-94532747 CTGCAGTAAAAGAAAAAGGAAGG + Intronic
911675294 1:100651907-100651929 CACCACAGAAAGAAAGAGGATGG - Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912423628 1:109566148-109566170 CTGTTCAGAAAGAATGAGGAGGG + Intronic
912632942 1:111263599-111263621 CTGTACAGAAAGCATGAGGCTGG - Intergenic
912647045 1:111403024-111403046 CTGCAGAGAAAAAAGGTGGCTGG + Intergenic
912714202 1:111970800-111970822 CTGCAAAGAGAGAAAGAGGTGGG - Intronic
913216987 1:116628881-116628903 CTCCCTAGAAAGAATGAGCAGGG - Intronic
914999727 1:152578390-152578412 CTTCAGAGAGAGAAGGTGGAGGG - Intronic
915581765 1:156816999-156817021 GGGCAGAGAAAGAATCTGGAGGG - Intronic
916040947 1:160960950-160960972 CAGGAGAGAAAGAGTGAGGCAGG + Intergenic
916585926 1:166150073-166150095 CTGCATAGGGACAATGAGGATGG + Intronic
916609355 1:166375477-166375499 TTCCAGAGAAAGAAGGAGGGGGG - Intergenic
916641531 1:166733587-166733609 CTTCATAGAATGAATTAGGAAGG - Intergenic
917358616 1:174152840-174152862 GTGCAGGGAAAGCATCAGGAAGG + Intergenic
917661606 1:177182025-177182047 GTGCGGAGAAGGAATGGGGAGGG + Intronic
918073003 1:181147523-181147545 CTGCAGAGGAAGATTTTGGAAGG - Intergenic
918093723 1:181317944-181317966 ATCCACAGAAAGAATGGGGAAGG - Intergenic
918323866 1:183391195-183391217 TTGCAGAGTGAGGATGAGGATGG - Intronic
918982111 1:191575794-191575816 CTGCAGAGAAAGATGAAGGGAGG + Intergenic
919016652 1:192046979-192047001 TGGCAGAGAAAAAATAAGGAGGG - Intergenic
919041816 1:192398549-192398571 CTACACAGAAAGATGGAGGAAGG + Intergenic
919523722 1:198621373-198621395 CTGCAGAGCAAGAGTGAGACAGG - Intergenic
919839425 1:201598296-201598318 TTGAAGATAAAGAATGAGGCAGG + Intergenic
919853791 1:201692049-201692071 CAGCAGAGAAGGAATGGGGCAGG - Intronic
920004884 1:202825858-202825880 CTTCAGAAAAAGAATGCCGATGG + Exonic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920528667 1:206685882-206685904 CCGCAGAGAGAGAAAAAGGAGGG - Intronic
920867588 1:209766086-209766108 GAGCAGAGAAAGAAAGATGATGG + Intronic
921027332 1:211298604-211298626 ATGCAGAGAAGGAATGAACATGG + Intronic
921892297 1:220365790-220365812 CTGCAGAGATAGAATATGGTGGG + Intergenic
921913260 1:220576012-220576034 CTGAAAAGAAAGGATGAGGGAGG - Intronic
922005096 1:221522313-221522335 CTGCACAGAAAGCATGATGCTGG + Intergenic
922658223 1:227404700-227404722 CTGCATAGAATGAATTAGGGAGG - Intergenic
922729495 1:227942345-227942367 GTGCAGAGCAGGAAGGAGGAAGG + Intronic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
924820088 1:247480895-247480917 CTGCAGAGTTAGAATGGGAATGG + Intergenic
1062919311 10:1267189-1267211 CTGCAGAGAAAATGTGAGGCAGG + Intronic
1063069344 10:2645144-2645166 CTGTAAAGAATGAATCAGGAAGG - Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063616820 10:7607477-7607499 CTCTACAGAAAGAAAGAGGAGGG + Intronic
1064259563 10:13774309-13774331 CTGCTGGGAAAGAGAGAGGAAGG + Intronic
1064294543 10:14066463-14066485 CTGGATAGAGAGAATGAGTAGGG + Intronic
1064680461 10:17806512-17806534 CAGCAGAGAAAGAGAGAAGAAGG - Intergenic
1064927277 10:20582694-20582716 AAGCAGAGAAAGTAGGAGGAGGG - Intergenic
1065355562 10:24837403-24837425 CTTCACAGAATGAATTAGGAAGG - Intergenic
1065643789 10:27813811-27813833 CTGTAGAGAAAAGAGGAGGAAGG + Intronic
1065928331 10:30456354-30456376 CTGCAGGGAAAGCTTGAGAACGG + Intronic
1066546655 10:36507466-36507488 TTGCAGAGGAAGAATGAGGTTGG - Intergenic
1067277651 10:44849403-44849425 CAGCAGAGAGTGAATGAGCAAGG - Intergenic
1068110174 10:52671086-52671108 CTTTACAGAAAGTATGAGGAAGG + Intergenic
1068974005 10:62988770-62988792 CTGAAGAGAATGAAAGAGAATGG - Intergenic
1069177915 10:65316963-65316985 CTGCACAAAGAAAATGAGGAAGG + Intergenic
1069255211 10:66323869-66323891 CAGCAGAGAAAGAGGGAAGAGGG + Intronic
1069571489 10:69497039-69497061 CTGTAAAGCAAGAATAAGGATGG - Intronic
1069781256 10:70957120-70957142 CTGCAGAGAGAGTCTGAGAAGGG - Intergenic
1069947340 10:71997137-71997159 CTGCAGTGGAAGAGTGGGGAGGG - Intronic
1070105586 10:73427769-73427791 CTGCAGAGACAGCATGGAGAAGG + Intronic
1070167031 10:73906694-73906716 AGGCAGAAAAAGAGTGAGGAAGG + Intergenic
1070543737 10:77436469-77436491 TTGCAGAGAAAGGAAGGGGAGGG + Intronic
1071018750 10:81028129-81028151 ATGCAGAGGAAGAGTGGGGAGGG - Intergenic
1071068531 10:81665847-81665869 CTGGAGAGAGAAAATGAAGAAGG + Intergenic
1071265176 10:83958284-83958306 CTACTGGGAAAGAATGAGTAGGG + Intergenic
1072268207 10:93750995-93751017 CTGCAGGGAAGGAAGCAGGAGGG - Intergenic
1072335127 10:94391118-94391140 CTGTATAGCAAGAGTGAGGAAGG + Intergenic
1072669514 10:97419124-97419146 CTGCCGGAAAAGAAAGAGGAGGG - Intronic
1072677199 10:97476751-97476773 CAACAGAGAAAAAATGAGGTTGG + Intronic
1072753595 10:98001989-98002011 GAGCAGGGCAAGAATGAGGAAGG + Intronic
1072946799 10:99817525-99817547 TTGAAGAGAAAAAGTGAGGATGG + Intronic
1073407337 10:103309425-103309447 CAGAAGAGAGAGAATAAGGAGGG - Intronic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073473437 10:103738089-103738111 CTTCAGAGAAAAGATGATGAAGG - Intronic
1074146464 10:110721151-110721173 GTGCTGAGGAAGACTGAGGAAGG - Intronic
1074225870 10:111483801-111483823 CAGCACAGAAAGGAAGAGGAAGG - Intergenic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074496021 10:113980791-113980813 CTGGAGAGAAAGGATCTGGAGGG - Intergenic
1074992301 10:118719862-118719884 CTGCATAGCAAGAATGAGAATGG - Intronic
1075218017 10:120555626-120555648 GTGCAGAGACAGAAAGAGCACGG + Intronic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1076476446 10:130756997-130757019 CTGCAGGAAAGGAAAGAGGAAGG + Intergenic
1077262697 11:1631263-1631285 CTTCAGCGGAAGGATGAGGAAGG + Intergenic
1077916554 11:6615397-6615419 ATGCAGGGTAAGAGTGAGGATGG - Intronic
1078010479 11:7569639-7569661 CTGCAGAGGAAGCATCAGGGAGG + Intronic
1078024228 11:7679546-7679568 CAGGAGAGAGAGAATGAGGGAGG - Intergenic
1078551743 11:12285948-12285970 CTGGAGAGAAAGGATGGGGACGG - Intronic
1078809167 11:14740982-14741004 CTGCAGAAAATGAATAAGAATGG - Intronic
1078927593 11:15888519-15888541 TACCAGGGAAAGAATGAGGAGGG - Intergenic
1079252043 11:18793521-18793543 CTGCATGGAGAAAATGAGGAGGG - Intergenic
1079405991 11:20146186-20146208 TTGTAGAGAAAGAAGGAGCAAGG + Intergenic
1079698835 11:23518946-23518968 CTGCTGAGAGAGAAGGAGAAAGG + Intergenic
1080400036 11:31925818-31925840 CCGCCAAGAGAGAATGAGGAAGG + Intronic
1080697371 11:34614350-34614372 TTGCATACTAAGAATGAGGATGG + Intergenic
1080849308 11:36054644-36054666 CTGCTTAAAAAGAATGAAGATGG + Intronic
1082025847 11:47571426-47571448 CAGCAGAGAAAGAAAGAAGCAGG - Intronic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1083143476 11:60740265-60740287 CTCCAGAGAAAGAGTGTGTAGGG + Intronic
1083225167 11:61280571-61280593 GTGCAGAGAAAGGAAGAGGCAGG + Intronic
1084234161 11:67775601-67775623 CTCCAGAGTAGAAATGAGGAAGG + Intergenic
1084305921 11:68283227-68283249 CTGCTGAAAGAGAATGAGGTGGG - Intergenic
1084765551 11:71305905-71305927 CTTCAATGAAAGAATGAGGAGGG + Intergenic
1085787908 11:79471219-79471241 CAGCAAAGAAACAAAGAGGAAGG + Intergenic
1086023395 11:82260259-82260281 CTGTAGAGCAAGAATAAGAAAGG - Intergenic
1087217603 11:95510938-95510960 CCCCAGGGAATGAATGAGGAGGG + Intergenic
1087288876 11:96298311-96298333 TTGCAGAGAAACAGTGAGGATGG + Intronic
1087600871 11:100313780-100313802 CTGAAGAGGAAGAATCAGCAAGG + Intronic
1088408297 11:109505108-109505130 ATGCAGAGACAGTATGAGTAGGG + Intergenic
1088548127 11:110982159-110982181 CTGGACAGAAAGAATGTGAAAGG + Intergenic
1088572129 11:111232629-111232651 CTGCAGGGATCAAATGAGGAAGG + Intergenic
1089026411 11:115275042-115275064 CTCAAGAGAAAAAATGAGCATGG + Intronic
1089051046 11:115546261-115546283 TGGGAGAGAAAGAAAGAGGATGG - Intergenic
1089278322 11:117354959-117354981 CTGCAGAGAAAGGATGAAGGAGG - Intronic
1089615342 11:119691869-119691891 CTGCTGAGAAAGAGGGAGGAAGG - Intronic
1089890052 11:121871749-121871771 CTGAAGGGAAAGAATGAGCAAGG + Intergenic
1089984712 11:122802600-122802622 CTGAACAGAAAAAATGAGTATGG - Intronic
1090057100 11:123432718-123432740 CAGCAGGAAAAGAATGAGGTTGG + Intronic
1090750048 11:129738669-129738691 CTGTAGACAAAGAGTCAGGAAGG + Intergenic
1091131089 11:133147861-133147883 CTGCAAAGACGGAATGATGATGG + Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091654244 12:2333661-2333683 CTGCAGAGAGAGATGGAGGTTGG + Intronic
1092427712 12:8387690-8387712 CTGCTATTAAAGAATGAGGATGG + Intergenic
1092428982 12:8394671-8394693 CTGCTATTAAAGAATGAGGATGG + Intergenic
1092484041 12:8886298-8886320 CTGCTGAGAGAAATTGAGGATGG - Intronic
1092527593 12:9318623-9318645 CTGCAGAGAAAAACAGAGGCTGG + Intergenic
1093692278 12:22121874-22121896 CAGCAGAGAAAGAAGGAAGATGG - Intronic
1093757986 12:22874195-22874217 GTGTAGAGAAAGAAGGAGGAGGG - Intergenic
1093909395 12:24728591-24728613 CTGTAGAGAGATATTGAGGATGG - Intergenic
1094686963 12:32727157-32727179 CTACAGAGGAAGAATGTGAATGG - Intronic
1094715326 12:33008210-33008232 AAGAAGAGAAAGAAGGAGGAAGG - Intergenic
1094820801 12:34222753-34222775 GGGCAGAGAAAGAAGGAGAATGG - Intergenic
1095915942 12:47478673-47478695 CTTCAAAGAATGAATTAGGAAGG - Intergenic
1096077093 12:48812716-48812738 CTGCAGAGCAAGATGGAGAAGGG + Intergenic
1096348179 12:50869631-50869653 CTTCATAGAAAGAATTAGGGAGG - Intronic
1096718729 12:53505968-53505990 CTGGAGAGCAAGAGAGAGGAGGG - Intronic
1096828922 12:54299825-54299847 GTGCAGTGAAAGGATGAGGAGGG + Intronic
1097295803 12:57961404-57961426 CTTCATAGAATGAATTAGGAAGG - Intergenic
1097318693 12:58201704-58201726 CTGCAGAGACAGCATCAAGAGGG + Intergenic
1097647452 12:62253314-62253336 CTGATGAGAAAGTATGTGGATGG - Intronic
1098237513 12:68431718-68431740 CTGCAGAGAAGGAGAGAGGGAGG - Intergenic
1098437390 12:70482263-70482285 ATGAAGAGCAAGAATAAGGATGG - Intergenic
1098725376 12:73958210-73958232 CTACAGAGAAAAAGTGAAGAAGG - Intergenic
1098834493 12:75405608-75405630 CTGCCCAGAAAGAATGCTGAGGG - Intronic
1099055312 12:77833114-77833136 CTACAGAAAAAGAATTGGGAAGG - Intronic
1099149171 12:79087585-79087607 TTGCAGGCAAAGAATGAGTAAGG + Intronic
1099736829 12:86578248-86578270 CTTCTGAGAAAGGAAGAGGAGGG - Intronic
1100176428 12:92036188-92036210 CTGCACAGAAACAAGGATGAGGG - Intronic
1100195203 12:92237476-92237498 CTGCAGAGAAAAAAAAATGAAGG + Intergenic
1100315718 12:93442404-93442426 CTGCAGTGAACGACTGAGGTGGG + Intergenic
1100391979 12:94151262-94151284 TTGCAGAGAAAGAAGGGGGTGGG - Intronic
1100850705 12:98707763-98707785 AGGCAGAGAAAGACTGAGAAAGG + Intronic
1102393294 12:112567077-112567099 CAGGAGAGAAAGAGCGAGGAGGG - Intergenic
1102872726 12:116426624-116426646 CTGGAGAGAAAGATTGGAGAAGG + Intergenic
1104732657 12:131116570-131116592 CTCCAGAGGAAGGAGGAGGAGGG - Intronic
1104751169 12:131240079-131240101 CTGGAGAGAAAGATCTAGGAAGG + Intergenic
1104926749 12:132317778-132317800 GGGCAGGGAAAGAAGGAGGAGGG + Intronic
1105340963 13:19525247-19525269 CTGCACAAAAAGAATGAAGCTGG + Intronic
1105895831 13:24716838-24716860 CTGCACAGCAAGTCTGAGGAGGG - Intergenic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106168292 13:27268546-27268568 CTGCAGATAAGAAATGAGGCCGG + Intergenic
1106231728 13:27825941-27825963 CAGGAGAGAAAGGAGGAGGAAGG + Intergenic
1106455151 13:29920434-29920456 CTGGACAGAAACAATCAGGATGG + Intergenic
1106541486 13:30694633-30694655 CTGCAGAGCAGGCTTGAGGAGGG - Intergenic
1106600302 13:31181666-31181688 CAGCACAGAAAGGATGGGGAGGG - Intergenic
1106631961 13:31483569-31483591 CTGCAGAGATAGAAGTAGAAGGG + Intergenic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1107063028 13:36181835-36181857 CTGCAGAGTAAGAAAGCTGAAGG - Intronic
1107425733 13:40291037-40291059 ATGCACAGAAAGGATGTGGAAGG + Intergenic
1108036596 13:46296643-46296665 CAGGAGAGAAAGAATCAGAAAGG - Intergenic
1108141337 13:47425309-47425331 CTGTGGAGAAAGAAAGAGGTGGG + Intergenic
1108224806 13:48277554-48277576 CTGGAAAGAAAGAAGGAGGGAGG + Intergenic
1108287233 13:48920526-48920548 CTACAGAGAAGGACTGAGAAAGG + Intergenic
1108556266 13:51595870-51595892 CTCCAGAGAGGGAATCAGGAAGG - Intronic
1108573750 13:51773618-51773640 CTGCTCAGAGGGAATGAGGACGG - Intronic
1109321172 13:60811672-60811694 TTGCAGAGAAAGAAAGAGTCAGG - Intergenic
1109496540 13:63178955-63178977 AGGCAAAGAGAGAATGAGGAAGG - Intergenic
1110150318 13:72244200-72244222 ATACAGAGAGAGAATGAGAAAGG + Intergenic
1110333053 13:74294807-74294829 TTGCAGGGGAAAAATGAGGAAGG - Intergenic
1110496896 13:76178469-76178491 GTGGAGAGAAAGAGTGAAGACGG + Intergenic
1110952629 13:81515762-81515784 ATACAGAGAAAGAGGGAGGAGGG + Intergenic
1110966812 13:81710085-81710107 CTTCATAGAATGAATTAGGAAGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1112119140 13:96390738-96390760 CTGCCCAGAAAGAGTAAGGAAGG - Intronic
1112177965 13:97047294-97047316 ATGAGGAGAAGGAATGAGGAGGG - Intergenic
1112259163 13:97862895-97862917 ACGCAAAGAGAGAATGAGGAAGG + Intergenic
1113127147 13:106991907-106991929 CTGCAGATAAAGGCTGAGGTGGG + Intergenic
1113481507 13:110625374-110625396 CTGCTGAGAAACTCTGAGGATGG - Intronic
1113634626 13:111911097-111911119 CTACAGAGTAAGAATCAGGCCGG - Intergenic
1113942464 13:114025428-114025450 CTGCAGAGAGGGCATGAGGCAGG - Intronic
1114368584 14:22058686-22058708 CTGCAGAGAGAGAAAGAGAGGGG - Intergenic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1114558940 14:23577625-23577647 CTGCGGAGAAAGAGGGAGGGGGG + Intronic
1114805200 14:25827467-25827489 CTGCAGAGAATAAATGAGAATGG + Intergenic
1115352490 14:32410146-32410168 CTGCAAAGAAAAAAAAAGGAGGG - Intronic
1115904178 14:38188766-38188788 TTGCAGAGAAAGTAAAAGGAAGG + Intergenic
1116240744 14:42339227-42339249 CTGTATAGCAAGAATGGGGAAGG - Intergenic
1116399351 14:44486363-44486385 CTGCAGAGAAAGAAGCAGGCTGG - Intergenic
1116408724 14:44598306-44598328 CAAGAGAGAAAGAATGAGGAGGG + Intergenic
1116737414 14:48709677-48709699 CTGGAGGGATAGAATAAGGATGG + Intergenic
1116849392 14:49893233-49893255 CTGCAGAGAAACAGAGAGGGAGG - Intronic
1116881940 14:50179223-50179245 CTGCAAAGAAAAAATGAGAGAGG + Intronic
1117194858 14:53329647-53329669 CAGCAGAGGGGGAATGAGGATGG - Intergenic
1117277918 14:54208291-54208313 CTGCAGAGGAAGCCTGCGGAGGG - Intergenic
1117500856 14:56349994-56350016 CTCCAGAGAAAGAAAAAGAAAGG - Intergenic
1117813935 14:59577820-59577842 CTGTAGAGAAAAGAAGAGGAGGG - Intergenic
1118336235 14:64855724-64855746 CAGCAGAGAAAGAAACTGGAGGG + Intronic
1118454447 14:65931887-65931909 CAGCTGAGAGAGACTGAGGAAGG + Intergenic
1118662836 14:68033641-68033663 CTACATAGAAAGCATGAGGAGGG + Intronic
1119036209 14:71231946-71231968 CAGCAGAGGAAGAAAGATGATGG + Intergenic
1119632977 14:76250129-76250151 TTGCGGAGAAAGAAGGAGGGAGG - Intronic
1120216763 14:81688844-81688866 ATGCAGAGAAAATATTAGGATGG - Intergenic
1120266160 14:82253256-82253278 CTGCAGAGAAGTCATTAGGAAGG + Intergenic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1120497040 14:85250574-85250596 TTGCAAAGAAACAATGAGCAGGG + Intergenic
1120613600 14:86674147-86674169 CTGCACAGAAAAAATTAGCATGG - Intergenic
1121941746 14:98077340-98077362 CAGCAGAGAAGGAATGAGATGGG - Intergenic
1122157716 14:99760292-99760314 TTGCACAGAAAGAAAGAGAAGGG - Intronic
1122250177 14:100433189-100433211 CTAAAGAGATAGAATGATGAAGG - Intronic
1122667207 14:103339166-103339188 TTGCAGAAAAAGAAAGAAGAGGG + Exonic
1122865012 14:104599765-104599787 CTCCAGAGAGAGAATGGAGAAGG + Intronic
1202895485 14_GL000194v1_random:5265-5287 CTGCAGAGACAGAATTAAAAGGG + Intergenic
1124172357 15:27387790-27387812 GTGCTGAGAAAGAAGGAGGGAGG + Intronic
1125063885 15:35458611-35458633 CAGCAGAGAAAAAAAGAGAATGG + Intronic
1125130482 15:36278873-36278895 CTGAACAGAAAGAATGGGGCAGG + Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1127278516 15:57468892-57468914 AGGCAAAGAGAGAATGAGGAAGG - Intronic
1128423077 15:67513170-67513192 TAGCAGAGAAAGAATGAGATGGG + Intergenic
1129273061 15:74429437-74429459 CTGCAGAGATGGAAGGAGCATGG - Intronic
1129894827 15:79095331-79095353 CTGTAGATAAAGAATCAAGAAGG + Intergenic
1130769350 15:86908728-86908750 CTGCGAAGAAAGGATGAGAAGGG + Intronic
1131208235 15:90470241-90470263 CTCCAGAGAGAAAATGAAGAAGG - Intronic
1132209997 15:100013893-100013915 CTTCATAGAATGAATGAGGGAGG + Intronic
1132345543 15:101106386-101106408 AGGGAGAGAAAGAATGAGGCCGG + Intergenic
1132490072 16:223515-223537 CTTCAGAGTAAGAATGATAAAGG - Intronic
1133366816 16:5216754-5216776 GAGCAGAGAAGAAATGAGGAGGG - Intergenic
1133608723 16:7413327-7413349 CTACAGAGGAAGACTGGGGAAGG - Intronic
1133723788 16:8519021-8519043 CTGCAGAAATAGCTTGAGGAAGG - Intergenic
1133772994 16:8878480-8878502 CTGCTGAGCCAGAGTGAGGAAGG + Intergenic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1135075234 16:19387473-19387495 CTCAAGAGAGAGAAAGAGGAAGG + Intergenic
1135117877 16:19738993-19739015 CTGCAGAGGGAGCATGGGGAGGG - Intronic
1135180724 16:20271973-20271995 CTGCAGAGACATAATGAGTCAGG - Intergenic
1136318713 16:29468721-29468743 GTGAAGACAAAGAATGAGGAGGG + Intergenic
1136433285 16:30208065-30208087 GTGAAGACAAAGAATGAGGAGGG + Intronic
1137483595 16:48873150-48873172 CTGCAGAGAAAACATCAGAAAGG + Intergenic
1137593027 16:49705424-49705446 TTGCAGAACAAGAATGTGGATGG + Intronic
1138020856 16:53479863-53479885 CTTTAGAGAAACAATGAGAAGGG - Intronic
1138088764 16:54157037-54157059 ACCCAGGGAAAGAATGAGGATGG - Intergenic
1139264865 16:65629200-65629222 CTGCAAACAAAAAATGAGGAAGG - Intergenic
1139766903 16:69238170-69238192 TTGGAGGGAAAGAAGGAGGAGGG + Intronic
1139801017 16:69522840-69522862 GTTCAGAGAGTGAATGAGGAAGG - Intergenic
1139968844 16:70761290-70761312 CTGCAGAGAGTGGATGAGGCTGG - Intronic
1140783930 16:78321964-78321986 CTGCAGAGACAGGTTGTGGATGG + Intronic
1141298222 16:82789891-82789913 CTGCGGAGGAAGAATCAGGGTGG + Intronic
1141481042 16:84307097-84307119 CTGGAGAGAATGAGTAAGGAGGG + Intronic
1141878349 16:86841753-86841775 CCCCAGGGAAAGAAAGAGGATGG - Intergenic
1142255937 16:89013996-89014018 AGGCAGAGAAAGAGTGAGGAAGG + Intergenic
1143079123 17:4368375-4368397 CTGCAGAGAATTGATGAGGGAGG + Intergenic
1143955172 17:10662441-10662463 CTACAGAGAAAGAAAGAGAAGGG - Intergenic
1144196757 17:12902017-12902039 TTGCAGAGAAGGGAAGAGGAAGG - Intronic
1144423688 17:15121117-15121139 CTGGAGAGAAGGAATGACAAGGG + Intergenic
1145280711 17:21464905-21464927 CTCCTGAGGAAGAATGAGGTGGG + Intergenic
1145397186 17:22505614-22505636 CTCCTGAGGAAGAATGAGGTGGG - Intergenic
1146784698 17:35709106-35709128 CTGCACTGAGAGAAAGAGGAAGG + Intronic
1146849889 17:36212782-36212804 CAGCAGAGAAAGAGTGAGAGTGG - Exonic
1146924772 17:36736552-36736574 CTGCAGGGTGAGAATGAGAAAGG + Intergenic
1147424080 17:40337423-40337445 CTGGAGAGAAAGAAAGATAAGGG + Intronic
1147445233 17:40471292-40471314 CCAGAGAGGAAGAATGAGGAGGG - Intergenic
1147563752 17:41524269-41524291 CTGCAGAGAGAGGAAGAAGAGGG + Intronic
1147873488 17:43604225-43604247 ATACAGAGAAAGGATGGGGAAGG + Intergenic
1148073975 17:44925049-44925071 CAGTAGAGGAGGAATGAGGATGG - Intronic
1148191289 17:45680540-45680562 CTACAGAGCAGGAATCAGGACGG - Intergenic
1149247188 17:54723623-54723645 CTGCAGCTAAACCATGAGGAAGG + Intergenic
1149515283 17:57276539-57276561 ATGCAGAGAAAGATAGAGGAGGG + Intronic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1149578022 17:57727668-57727690 CTGCAGGGAAGGAAGGAGGGAGG + Intergenic
1149595918 17:57864635-57864657 CTGCAGTGGATGAAGGAGGATGG + Intronic
1150236844 17:63600305-63600327 CAGCAGAGAGAAAATGAAGAGGG + Intergenic
1150333862 17:64316019-64316041 AAGCAGAGAAAGAATGAGAGAGG + Intergenic
1150466879 17:65401013-65401035 ATGCAAAGAAAGAAGGAAGAAGG - Intergenic
1150633596 17:66897606-66897628 TTGCAGAGAAGGAAGGAGGAAGG - Intergenic
1151016182 17:70555853-70555875 CTGGAGAGAGGGAATGAGGGAGG + Intergenic
1151305660 17:73261356-73261378 CTGTAGAGAAGGAAGGGGGAGGG + Intronic
1152984042 18:306078-306100 CTGCAGATGAAGGATGAGAAGGG + Intergenic
1153112263 18:1605962-1605984 TTTCACAGAAAAAATGAGGAAGG - Intergenic
1155525521 18:26712711-26712733 CTGCAGAGAAAAGATGAGAATGG - Intergenic
1155756709 18:29507366-29507388 CTGGAGAGAAACAATGTGGCCGG - Intergenic
1156957267 18:42982296-42982318 CCGCAGAGAACAAATGCGGAAGG - Intronic
1157298385 18:46462163-46462185 CTGTAGAGGAATAATGAGGGAGG + Exonic
1157805536 18:50655076-50655098 CTGCTGAGAAAGAAACAGGAGGG - Intronic
1158304587 18:56090773-56090795 CTTCAGATAAGAAATGAGGAAGG + Intergenic
1158406091 18:57160947-57160969 CTGCAGAGAAAGCAGGATGTGGG + Intergenic
1159478744 18:68959861-68959883 CTGAAGAGAGAGACTCAGGATGG - Intronic
1161715777 19:5875496-5875518 CAGAAGAGAAAGGATGTGGAAGG + Intronic
1161890543 19:7032933-7032955 ATTCAGAGTAGGAATGAGGATGG - Exonic
1161890908 19:7037800-7037822 ATTCAGAGTAGGAATGAGGATGG + Exonic
1161892628 19:7051661-7051683 ATTCAGAGTAGGAATGAGGATGG - Exonic
1161892991 19:7056261-7056283 ATTCAGAGTAGGAATGAGGATGG + Exonic
1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG + Intronic
1163564343 19:18041080-18041102 CTGCAGTGAAGGAAGGTGGATGG + Intergenic
1164174812 19:22762619-22762641 CTTCATAGAATGAATTAGGAAGG - Intronic
1165547448 19:36552919-36552941 CTCCAGACAAAGAATTAGTATGG - Intronic
1166006821 19:39913890-39913912 CTGCAGAGCAAGAATGAGTGTGG - Exonic
1166581808 19:43907310-43907332 CTGCAAAGAAAGAATGAAGTTGG + Intergenic
1166907963 19:46127348-46127370 TTGCAAAGAAAGAAGAAGGAAGG + Intergenic
1167646518 19:50708590-50708612 GTGCATGGAAAGGATGAGGATGG + Intronic
1167742429 19:51332039-51332061 GGGCAGAGAAAGAATTGGGAGGG + Exonic
1168291952 19:55361435-55361457 CTGCAGAGATAGAGGGAGGCAGG + Intronic
1168365123 19:55780211-55780233 CTACAGTGAAGGAGTGAGGAAGG + Intergenic
1168382533 19:55936198-55936220 CTGAAAAGGAGGAATGAGGAGGG + Intergenic
1202647343 1_KI270706v1_random:154496-154518 CTTCATAGAATGAATAAGGAGGG - Intergenic
925100258 2:1238285-1238307 GTGGAGAGAAAGAGAGAGGAAGG - Intronic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925693360 2:6548396-6548418 CTGGAGAGAAAGAAAGAAAAAGG + Intergenic
926198411 2:10777094-10777116 TTGCAGAGACAGAATGGGAAAGG + Intronic
926386152 2:12337746-12337768 CTGAAGAGCAAGCATGAAGATGG + Intergenic
927001174 2:18795412-18795434 CTTAAGTGAAAGAAAGAGGAGGG - Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927464015 2:23323690-23323712 CTGCAGAGGAACAGGGAGGAAGG + Intergenic
927502491 2:23591893-23591915 CTGGAGATAAAGGAAGAGGAAGG - Intronic
928228445 2:29475592-29475614 CTTCAGGGGAACAATGAGGATGG - Intronic
928405930 2:31014858-31014880 CCCCAGAGAAAGGAAGAGGAAGG + Intronic
928450557 2:31374711-31374733 CTGCAGAGATGGAGTGTGGAGGG - Intronic
928457318 2:31434266-31434288 CAGAAGAGAAAGAATGATGAAGG + Intergenic
928898863 2:36296361-36296383 CAGGAGAGAAAGAGTGAAGAGGG + Intergenic
929133875 2:38603756-38603778 CAGAAGAGAAAGAATTGGGATGG - Intergenic
929384965 2:41395662-41395684 CAGGAGAGAAAGAAAGAGCAAGG + Intergenic
929448952 2:42023914-42023936 CAGAAAAGAAAGAATGAGGAAGG + Intergenic
929569855 2:43015608-43015630 CTGTGGAGAGACAATGAGGAAGG + Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930471816 2:51825819-51825841 CTAAAGAGAAAGGAAGAGGAAGG + Intergenic
930488122 2:52034458-52034480 GGGCACAGAAAGAATGAAGAAGG + Intergenic
930692814 2:54381685-54381707 CAGGAGTGAAAGGATGAGGAAGG - Intronic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
931322808 2:61188317-61188339 CTGCAGAGATAGAAGTAGAAGGG + Exonic
931655053 2:64503144-64503166 CTTGGAAGAAAGAATGAGGAAGG + Intergenic
932219232 2:69987215-69987237 CTGTAGTGAAAGAACCAGGAGGG - Intergenic
933309042 2:80637748-80637770 GAGAAGTGAAAGAATGAGGAAGG + Intronic
933592113 2:84244573-84244595 CTGATGAGAATGAATGAGGTGGG - Intergenic
933757250 2:85649525-85649547 CTGCAGTGCAGGAATGAGTAAGG + Intergenic
934156694 2:89207603-89207625 GGGCAGAGAAAAAAGGAGGAGGG + Intergenic
934210622 2:89975148-89975170 GGGCAGAGAAAAAAGGAGGAGGG - Intergenic
935244897 2:101210161-101210183 CTGCAGAGAAAGAACATAGAGGG + Intronic
936182070 2:110275632-110275654 GTTCAGATAAAGAATGAGGGTGG + Intergenic
936230499 2:110696041-110696063 GTTCAGATAAAGAATGAGGGTGG - Intergenic
936616462 2:114052884-114052906 CTGCAGAGAAAGAGAGAGAATGG - Intergenic
936940556 2:117879701-117879723 CAGCACAGAAAGAAAGATGAAGG - Intergenic
936989741 2:118349978-118350000 ATGCAGGGATAGAATGAAGAAGG + Intergenic
937079531 2:119130462-119130484 CAGGAGAGCAAGACTGAGGATGG - Intergenic
937529613 2:122812143-122812165 CTTCATAGAAAGAATTAGGGAGG - Intergenic
937594570 2:123658235-123658257 CTGCGTAGAAATAATGAAGAGGG - Intergenic
937669966 2:124528046-124528068 CTGCAGAAAACCAAAGAGGATGG + Intronic
937672885 2:124557715-124557737 TTCCAGGGAAACAATGAGGAAGG + Intronic
938982830 2:136542787-136542809 CTCAAGAGGAAGAATGAGAATGG - Intergenic
939041710 2:137197270-137197292 CAGCAGAGAGAGATGGAGGAAGG + Intronic
939145060 2:138403691-138403713 CTGCCCAGAAGGAATGTGGAAGG + Intergenic
939647475 2:144718280-144718302 GAACAGAGAAGGAATGAGGAAGG + Intergenic
941984541 2:171497351-171497373 CTCCTGAGAAAGAATGTGCAAGG - Intergenic
942128578 2:172853173-172853195 CTTCAGAAAATGAAGGAGGATGG - Intronic
942342147 2:174959963-174959985 ATGCTGAGAAAAAATGATGATGG + Intronic
942353107 2:175075789-175075811 CTGCAGAGAAAAAACGAGAATGG - Intronic
942375482 2:175332120-175332142 CTGAAAAGAATGAATGATGATGG + Intergenic
942622059 2:177855561-177855583 TTGCAGAGGAAGAATGAGTTTGG + Intronic
943174998 2:184460881-184460903 TTTCAGAGAGAGAAAGAGGAAGG + Intergenic
943547413 2:189298120-189298142 TTGAAGAGAAAGAGTGATGAAGG - Intergenic
943784232 2:191859467-191859489 AGGGAGAGAAAGACTGAGGATGG - Intergenic
943979745 2:194533042-194533064 CAACAGATAAATAATGAGGAAGG + Intergenic
943990601 2:194686169-194686191 ATGCAAAGAAGCAATGAGGAGGG - Intergenic
944566643 2:200998183-200998205 CTGGAGAGGAAGGATGAGGGTGG - Intronic
944745129 2:202648046-202648068 CTGCAAAGAAAGAATGGAGTAGG - Intronic
945296863 2:208179371-208179393 CTGCAGTAAAAGAATAAGGGAGG + Intronic
945516251 2:210766495-210766517 ATGCAGAGAAACAGTGAAGAAGG - Intergenic
945656472 2:212630384-212630406 TTTTAGAGAAAGAAAGAGGAGGG - Intergenic
946121360 2:217517919-217517941 CTGCTGAGAAGAAATGAGGATGG + Intronic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
947148728 2:227092384-227092406 CCCCAGAGAAAGAGAGAGGATGG + Intronic
947250759 2:228100855-228100877 CTACATAGAAAGAGTTAGGAAGG + Intronic
947301998 2:228698033-228698055 CTGAAGACAAAGCAGGAGGAAGG + Intergenic
948044521 2:234933283-234933305 CTGAAGAGAAACAATGTTGATGG - Intergenic
948353592 2:237360197-237360219 CGGCAGAGAAAGGGTGATGAAGG - Intronic
948384869 2:237575095-237575117 CTGCAGAGAAGCGACGAGGAGGG - Exonic
948670467 2:239565188-239565210 GTGCAGAGAAGGGATGAAGAAGG + Intergenic
948816987 2:240516039-240516061 CTGCAGGGAAAAAAAAAGGAGGG + Intronic
948922320 2:241071553-241071575 CTGCAGAGCAGGCAGGAGGAAGG - Intronic
1168838247 20:892054-892076 ATGCAGGGAAAGAAGGAGGGGGG - Intronic
1169193400 20:3671346-3671368 CTGCAGAGAAGAGAAGAGGAGGG + Intronic
1169402589 20:5295624-5295646 CTGTGGAGAAACAAAGAGGATGG - Intergenic
1169460268 20:5788620-5788642 CTGCAAAGAACAAATGAGAAAGG - Intronic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1169926109 20:10786058-10786080 CTGTAGAGCAAGAATGGGCAAGG + Intergenic
1170069861 20:12354695-12354717 CCGCTGAGAAAAAATGCGGAAGG + Intergenic
1170099287 20:12680977-12680999 CCTCAGAGACAGAATGAAGATGG + Intergenic
1170412914 20:16109673-16109695 TTGGAAAGAAAGAAAGAGGAGGG - Intergenic
1170587045 20:17742676-17742698 CTGCAGATAGAGAAGAAGGAGGG + Intergenic
1170725136 20:18919390-18919412 CTGCACAGAAAGAATGATGCTGG - Intergenic
1170781502 20:19429933-19429955 CAGCTGAGAAAAAAAGAGGAGGG + Intronic
1171130907 20:22652275-22652297 CTGCAGAAAAAAGAGGAGGATGG - Intergenic
1171328000 20:24312680-24312702 CTGCTGAGGAAGAACAAGGATGG + Intergenic
1171413061 20:24959410-24959432 CTGCAGAGAGAGCAAGAGAACGG + Intronic
1172021084 20:31914592-31914614 CTGGTGAGAAAAAATGGGGAGGG + Intronic
1172451772 20:35030452-35030474 CAGCACAAAAAGAATGAAGATGG - Intronic
1172606036 20:36214700-36214722 CAGCAGAGAGAGAGAGAGGATGG + Intronic
1173878760 20:46394533-46394555 CTGGGGAGAAAGAATCAGAAAGG + Intronic
1174030473 20:47620562-47620584 AGGCAGAGCAAGGATGAGGAAGG - Intronic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1174797693 20:53536157-53536179 CTGCAGAGAAGGACGGAAGAAGG - Intergenic
1174853693 20:54022147-54022169 CAGTAGAGAAAGACTGAGGCGGG + Intronic
1175062786 20:56258927-56258949 GTGGAGAGAAGAAATGAGGAGGG + Intergenic
1175152600 20:56946839-56946861 CTCCAGAGGAAGAATGCTGAAGG + Intergenic
1175898040 20:62348204-62348226 TTGCAGAGAAACAATGTGGCAGG + Intronic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1176155612 20:63618673-63618695 CTGGGGAGGAAGAATAAGGATGG + Intronic
1176199346 20:63853561-63853583 ATGCAGAGAATGACTGAGGTAGG + Intergenic
1176604521 21:8818276-8818298 CTTCATAGAATGAATAAGGAGGG + Intergenic
1177332720 21:19683136-19683158 CTACAGAGACCGAAGGAGGAGGG - Intergenic
1177449561 21:21247910-21247932 TTGAAGAGAAAGAAGGAAGAAGG - Intronic
1178187418 21:30239340-30239362 CTTCAGAGAAATTATGATGATGG + Intergenic
1179051962 21:37896020-37896042 CTGCACAGGAAGAATGATGCTGG + Intronic
1179145084 21:38760994-38761016 CTGGAGTGAAAGAAGGAGAAAGG - Intergenic
1179281022 21:39934410-39934432 CTGCAGAGAGGGGATGATGATGG + Intergenic
1179797299 21:43792664-43792686 CTACACAGGAAGAATTAGGAAGG + Exonic
1179913009 21:44460162-44460184 CGGCAGAGAAAGGAAGTGGAGGG - Exonic
1179952130 21:44714305-44714327 CGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1180346812 22:11709884-11709906 CTTCATAGAATGAATAAGGAGGG + Intergenic
1180855394 22:19041874-19041896 CAGCAGTGACAGGATGAGGAAGG + Exonic
1181272938 22:21670987-21671009 CTGCAGAGAGAGACTGAAAAAGG - Exonic
1181362923 22:22352762-22352784 CTGCAGACTAAGCAGGAGGAAGG - Intergenic
1181992420 22:26847489-26847511 ATGCAGAGAAGGAATGAGCAAGG - Intergenic
1182031668 22:27163824-27163846 ATGCAGAGAAACAATGGGGTAGG - Intergenic
1182354198 22:29714945-29714967 CTGCTGGGAGAGAAGGAGGAGGG + Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182834269 22:33328971-33328993 CTACAGGGAAAGAAAGAGAAAGG - Intronic
1182877669 22:33706385-33706407 CTGCAGAGGAGGAAACAGGAAGG + Intronic
1182928815 22:34153650-34153672 TTGCTGAGCAAGAATGAAGAAGG + Intergenic
1183048061 22:35237236-35237258 CTGCATAGAATGAATTAGGGAGG + Intergenic
1183113230 22:35668646-35668668 TTACAGCGAAGGAATGAGGATGG - Intergenic
1183283283 22:36945610-36945632 AGGCAAAGAGAGAATGAGGAAGG + Intergenic
1183336994 22:37255071-37255093 CTGCAGACAAAGAATACAGACGG + Intergenic
1183848951 22:40566874-40566896 GTGTAGAGAAAGAATGACAAGGG + Intronic
1184218620 22:43084458-43084480 CTGCAAAGAAAGAAGGAAAAAGG - Intronic
949107201 3:214069-214091 CTTCACAGAAAGATTGAGGAAGG + Intronic
949178190 3:1092698-1092720 CTCCAGTCAAAGAAAGAGGAGGG + Exonic
949482367 3:4505604-4505626 ATGCCAAGAAAGAATGGGGAAGG + Intronic
950526688 3:13528599-13528621 TTGCAGAGAAAGGATGAAGGAGG - Intergenic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951840145 3:27025613-27025635 GAGAAGAGAAAGCATGAGGAGGG - Intergenic
952320618 3:32274456-32274478 TTACAGTGAAAGTATGAGGAAGG - Intronic
952482708 3:33778021-33778043 CTCCAGAAAAAGAATGAGCGGGG - Intergenic
953203902 3:40803724-40803746 AAGGAGAGAAAGAAAGAGGAAGG + Intergenic
953614837 3:44480584-44480606 CTGCAGAAAAAGATGGAGGGTGG - Intergenic
953788713 3:45930264-45930286 CTGCAGAGAAAGGGTGTAGAGGG - Intronic
953880941 3:46691000-46691022 CTGCAGAGAGAGAGGCAGGAAGG + Intronic
954440019 3:50516680-50516702 CTGGAGAGAAGGAATGCAGAGGG - Intergenic
955318603 3:57958847-57958869 GGACAGAAAAAGAATGAGGAAGG - Intergenic
955506935 3:59641828-59641850 CTGCAGAGAAAGTAGGAGGAAGG - Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956244022 3:67160862-67160884 CTGCAAACAATGAATGAGGTTGG - Intergenic
956381809 3:68672274-68672296 CTCAAGAGAAAGACTGAGGGAGG - Intergenic
956619205 3:71203872-71203894 GTGCAGAGAAAAAAGGAAGATGG + Intronic
957157074 3:76557843-76557865 CTGAAAAGCAAGAATGAGGAAGG - Intronic
957748040 3:84370953-84370975 CCTCACAGAAAGAATTAGGAAGG - Intergenic
958745601 3:98129857-98129879 ATGCAAAGAGAGAATCAGGAAGG - Intergenic
959027873 3:101262033-101262055 CTGAGGAGAAAGAATAAGAAAGG - Intronic
959422016 3:106140435-106140457 CTGCAGAGAATGCATGGAGATGG + Intergenic
959948175 3:112149375-112149397 CTGCACAGAAAGGATGGGGTGGG + Intronic
961205348 3:125077022-125077044 CTGGAGAGAAGGAAGGATGATGG + Intergenic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961557764 3:127708321-127708343 CTGCTGAGAAGACATGAGGAAGG - Intronic
963204015 3:142614376-142614398 AGGCAGTGAAAGAATGAGGATGG + Intronic
963299357 3:143581547-143581569 ATGCAAAGAAAGAAAGAGAAAGG - Intronic
963731120 3:148973622-148973644 AGGCAGAGAAAGAGTGAGGGTGG + Intergenic
964626922 3:158768521-158768543 CGGCAGAGAAGGAAAGAGAATGG + Intronic
965099398 3:164277427-164277449 ATACAGAGACAGAAGGAGGAGGG + Intergenic
965294647 3:166928137-166928159 CTGCTTAGAAAAATTGAGGAAGG + Intergenic
965663808 3:171070051-171070073 CTTCAGAGCAAGAATGGGAATGG + Intronic
965673811 3:171174026-171174048 CTGCAGAGGAAGGAGGAGCAGGG + Intronic
966691045 3:182741920-182741942 GTACAGAGAAAGAATTAAGAGGG - Intergenic
967446955 3:189578043-189578065 CTGAAGGGAAAGTAGGAGGAAGG - Intergenic
967616146 3:191569128-191569150 GTACAGGGAAAGAAGGAGGAAGG - Intergenic
968426394 4:526333-526355 CTGCAGTGAAAGAAACAGAAGGG + Intronic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968676604 4:1884686-1884708 TTGCAGATAAAGAACGAGGCTGG - Intronic
968835337 4:2959808-2959830 CTGCGGATAAAGAATGGTGAAGG - Intronic
968969565 4:3786556-3786578 AAGCAGAGAGAGAAAGAGGAGGG + Intergenic
970323265 4:14896779-14896801 GTGCTGAGAGAGAAGGAGGAGGG + Intergenic
971146757 4:23985306-23985328 CTGATGAGAAAGAGTGAGAAGGG + Intergenic
971685505 4:29760959-29760981 CCTCAGAGAAAGAAAGGGGAAGG - Intergenic
972064559 4:34924527-34924549 CTGAAGAGAAAGACAGAGGTAGG - Intergenic
972266446 4:37464580-37464602 ATGGAAAGAAAGAATGAGGGAGG + Intronic
972794808 4:42404904-42404926 GGGCAGAGAAAGAAAGAGAAGGG + Intergenic
973171825 4:47154839-47154861 CTGTAGAGAAAGAAAGAAAATGG - Intronic
973787356 4:54345090-54345112 CTTCACAGAATGAATTAGGAAGG - Intergenic
974881083 4:67757875-67757897 CTGAAGGGAAAGAGTGATGATGG + Intergenic
975032962 4:69645920-69645942 CTGCAAGGTAAGAATGGGGAAGG - Intronic
975737001 4:77390677-77390699 GCTCAGAGAAAGAATAAGGAGGG - Intronic
976377986 4:84366642-84366664 TTCCAGAGAAACAATGGGGAAGG - Intergenic
976422251 4:84859290-84859312 CTATAGGGAAAGGATGAGGAGGG + Intronic
976521236 4:86029997-86030019 TTGCAAAGCAAGAATGAGTAGGG - Intronic
976549913 4:86381972-86381994 CTGTAGAGAAACCCTGAGGAGGG - Intronic
976721935 4:88177706-88177728 CTGCCGAGAGAGATTGGGGAGGG - Intronic
976988717 4:91336052-91336074 CTGCTGAGAAGAAAGGAGGAGGG + Intronic
978273340 4:106917967-106917989 CTGTAGTGAAAGAATGAAGGTGG - Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978881374 4:113707267-113707289 ATGCAGAGAAATAAAAAGGAAGG + Intronic
978890483 4:113820659-113820681 CTGCAGAGACAGAAGAATGAAGG + Intergenic
979280836 4:118865924-118865946 CTGCTGAGAATGAATGTGGCTGG + Intronic
979429557 4:120612220-120612242 CTGCAGAGAAATTATCTGGAAGG - Intergenic
979826652 4:125244120-125244142 CAGCAGAGAAACATTGAGGTTGG - Intergenic
980273860 4:130622639-130622661 CAGGAGAGAGAGATTGAGGAGGG - Intergenic
980806406 4:137820295-137820317 CTAGAGACAAAGAATGGGGATGG - Intergenic
981715109 4:147744916-147744938 CTGCCGAGAGAGAATGTAGAGGG + Intronic
981903355 4:149891849-149891871 CTGTAGAGAACAAATGAGAAGGG - Intergenic
983053287 4:163073604-163073626 ATTCTGAGAACGAATGAGGAAGG + Intergenic
984008455 4:174342302-174342324 CTGTATAGAAAAAATAAGGAAGG + Intergenic
985263823 4:188139814-188139836 CTGCAGAGCGAGGATGAGCAGGG + Exonic
985271856 4:188200889-188200911 AGGCAGAGAAGGACTGAGGAAGG - Intergenic
985278015 4:188257703-188257725 CCACAGTGAAAGCATGAGGATGG - Intergenic
985286017 4:188336971-188336993 CTTCAGAGCAGGAATGAGGATGG - Intergenic
986516235 5:8566853-8566875 GAGCAGATAAAGAATGACGAGGG - Intergenic
987172274 5:15271121-15271143 CTGCAGAGCTAGAGTGAGAAAGG - Intergenic
987705690 5:21459943-21459965 CTGGAGAGAAAGGAAGAGAAAGG + Intergenic
987984527 5:25128791-25128813 CTCATGAGAAAGAATGAGGTTGG - Intergenic
988038338 5:25857263-25857285 CAGCAGAGAAAGAGAGAGGAGGG + Intergenic
988537790 5:32084384-32084406 CTGCATTGGAAGGATGAGGACGG - Intronic
988736639 5:34028633-34028655 AGGGAGAGAAAGAAGGAGGAAGG - Intronic
989028765 5:37095064-37095086 CTTCATAGAAAGACTTAGGAGGG - Intergenic
989138834 5:38182141-38182163 CCCAAGAGAAAGAAGGAGGATGG - Intergenic
989494080 5:42090856-42090878 CTACTGAGGAAGAATGAAGATGG - Intergenic
989757965 5:44979032-44979054 CTTCAGAGAATGAATTAGGGAGG - Intergenic
989985420 5:50691287-50691309 CTGAAGAGAAAACCTGAGGATGG - Intronic
990210246 5:53475577-53475599 CTGCATAGAAGGTGTGAGGAGGG - Intergenic
990868321 5:60403754-60403776 CTGGAGAGACAGCATCAGGAAGG - Intronic
990993119 5:61704409-61704431 CTACAGAGACAAAATTAGGAAGG + Exonic
991092689 5:62708319-62708341 CAGCAGAGAAAGAGTGAGTGAGG + Intergenic
991139069 5:63217764-63217786 CTTCAGAGTAGGAAGGAGGAGGG - Intergenic
991509511 5:67361230-67361252 CTCAAGAGAAGGAGTGAGGATGG - Intergenic
995104211 5:108355086-108355108 CATCAGAGAAAGAATAATGAAGG + Intronic
995276648 5:110285054-110285076 CTCCAGAAAAAGAATAAGGCAGG - Intergenic
995306688 5:110659304-110659326 CAGCAGAAAAAGAATGAGAATGG + Intronic
995351385 5:111179817-111179839 CTGCAGAGAATGATTTAGGGAGG + Intergenic
995623358 5:114052304-114052326 CACCAGAGAAACAACGAGGAGGG - Intergenic
995763514 5:115589506-115589528 TTGCAGAGAATCAATAAGGATGG + Intronic
996486961 5:124047092-124047114 GTGAAGAGAAAGAGAGAGGAGGG + Intergenic
996543062 5:124649561-124649583 CTGCAAAGAGAGGATGGGGAAGG + Intronic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
998179494 5:139926563-139926585 CTGCTGAGTAAGAATGAGCAGGG + Intronic
998584010 5:143406326-143406348 CTGCAGAGAAAAAAAAATGAAGG - Intronic
998703953 5:144737688-144737710 CTGCACAGAAAGGATGGGGTGGG + Intergenic
998987527 5:147777131-147777153 CAGCAGACAAAGAATGACCAAGG + Intronic
999082155 5:148854956-148854978 CTGCAGATAGAGTGTGAGGAAGG + Intergenic
999505141 5:152186676-152186698 CTGCAGAGGAAGAAGGAAGTTGG - Intergenic
1000302114 5:159965658-159965680 TGGCAGAGGAAGAAGGAGGAAGG + Intronic
1000444177 5:161299617-161299639 AGGGAGAGAAAGAAAGAGGAAGG - Intronic
1000538013 5:162503905-162503927 AGGCAGAGAAAGCATAAGGAAGG + Intergenic
1000757533 5:165180328-165180350 CTGCATAGAATGAATTAGGGAGG + Intergenic
1000839020 5:166193129-166193151 ATGCAGATTAAGAATGGGGAAGG + Intergenic
1000844175 5:166258314-166258336 CTGCAGTTAAAGGAGGAGGAAGG + Intergenic
1001026343 5:168227354-168227376 CGGCAGTAAAAGCATGAGGATGG + Intronic
1001044121 5:168358302-168358324 GTTCAGAGAATGAATGAGGATGG + Intronic
1001822425 5:174720742-174720764 TTGCAGAGTGAGAATGGGGAAGG - Intergenic
1002307723 5:178293645-178293667 TTGCTGAGTAAGAATGAGGGAGG + Intronic
1002523686 5:179804649-179804671 CTGCAGGGAAGGAAGGAGGTGGG - Intronic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003320755 6:5049058-5049080 CTGCAGAGGAAGATTGGGAAAGG + Intergenic
1003597903 6:7490840-7490862 CTGCAGAAAAAAAAGGCGGATGG - Intergenic
1003774460 6:9344418-9344440 CTGCAGAAAAAGAAAAAGTAAGG + Intergenic
1004545426 6:16593573-16593595 CTGGAGAGAAGGCAGGAGGATGG - Intronic
1004573505 6:16870622-16870644 ATGCAAATAAAGAATGAGGGAGG - Intergenic
1004679009 6:17874223-17874245 CTGCAGAGACAGAAGGGGAAAGG - Intronic
1004721825 6:18274383-18274405 AGGCAGAGAACTAATGAGGATGG - Intergenic
1004945787 6:20611074-20611096 CTGCAGAGAAAGAAAACAGATGG - Intronic
1007276668 6:40679230-40679252 CTGTGGAGAAAGACTGTGGATGG - Intergenic
1007601338 6:43083544-43083566 ATGCAGAGAAGAAAAGAGGATGG - Intronic
1007769498 6:44181211-44181233 CAGCAGAGAAGGAGTGAAGAAGG - Intronic
1007949741 6:45860654-45860676 CTAATGAGGAAGAATGAGGATGG + Intergenic
1008200392 6:48580769-48580791 ATTTAGAGAAAAAATGAGGAAGG + Intergenic
1008636863 6:53419459-53419481 TTTCAGAGAAAGAATGAGACTGG + Intergenic
1008743982 6:54646508-54646530 TTGCAGGGATAGAATGTGGAGGG - Intergenic
1008770327 6:54970905-54970927 CTTCCGAGAAAGAGTGAAGATGG - Intergenic
1009527569 6:64765697-64765719 CAGGAGAGAAAGAAAGAGCAAGG + Intronic
1009702915 6:67206305-67206327 CTTCATAGAATGAGTGAGGAAGG - Intergenic
1010022416 6:71175963-71175985 CTGCAGTGGAAGCATGAGAAGGG - Intergenic
1010076074 6:71800205-71800227 CTGCACAGAATGAATTAGGGAGG + Intergenic
1010715222 6:79221362-79221384 GTGTAAAGAAAGAATGGGGATGG - Intronic
1011071868 6:83393514-83393536 CTGCATGGAAACTATGAGGAGGG - Intronic
1011266802 6:85529527-85529549 TTTCAGAGAAAGAACGAGGATGG + Intronic
1011674234 6:89715770-89715792 CTGCAGAGACAGAATTCAGATGG + Intronic
1012519394 6:100102968-100102990 CTACAGAGAAAGAAGAAGGTGGG - Intergenic
1012649233 6:101732894-101732916 CTGGAGAGAAAGAGAGAGCAAGG + Intronic
1012912368 6:105132581-105132603 GTCCAGACAAAGACTGAGGAAGG - Intronic
1012956803 6:105579810-105579832 CAGGAGAGAAAGAGTGAAGAGGG + Intergenic
1013006374 6:106078154-106078176 CTGTAGAGAAAAAGTGAGTACGG + Intergenic
1013207825 6:107960060-107960082 GTGCAGAAAAAAAGTGAGGAGGG - Intergenic
1014950881 6:127554205-127554227 ATGCATAGAAAGAATACGGAAGG + Intronic
1015112468 6:129609085-129609107 ATGGAGGGAAAGAATGAGGGGGG + Intronic
1015112473 6:129609115-129609137 GAGCAGGGAAAGAATGAGGGAGG + Intronic
1015311184 6:131768721-131768743 CTGTAGAGAAAGCATGATGCTGG - Intergenic
1015710141 6:136130327-136130349 CAGTAGAAAAGGAATGAGGAAGG - Intronic
1015778723 6:136841502-136841524 CAGAAGAGAAAGACTGAGGCAGG - Intronic
1015901447 6:138072209-138072231 CAGAAGAGAAAGAATGGGAAAGG + Intergenic
1016045901 6:139480150-139480172 TTGAAGAGAAAGAATGGGGTTGG - Intergenic
1016695750 6:146992942-146992964 CTGCTGATGAAGAGTGAGGAAGG - Intergenic
1016811466 6:148265303-148265325 CTGCCAAGAAAGAAAAAGGAGGG + Intergenic
1017422580 6:154288118-154288140 CTACAGAAAAAGAAAGAGAAGGG + Intronic
1017481804 6:154864876-154864898 CTGCAGAAGAAGAATTAGGCTGG - Intronic
1018102943 6:160457365-160457387 CTGTTGAGAAAGAATAAGAAAGG - Intergenic
1018516305 6:164583427-164583449 TAGAAGAGAAAGAATGAAGATGG - Intergenic
1018721224 6:166574043-166574065 CTGTAGAGAGAGAATGACCACGG - Intronic
1018779140 6:167046293-167046315 CTAGAAAGAAAGAAAGAGGAAGG + Exonic
1019464713 7:1181366-1181388 CTGAAAAGAAAGGGTGAGGAGGG - Intergenic
1020207688 7:6131583-6131605 CTCCAGCCAAAGGATGAGGAAGG - Intronic
1020628124 7:10608072-10608094 CTGCTGAGAAGGAATTAGGGAGG - Intergenic
1021383164 7:19993424-19993446 CATCAGAGAAACAATGAAGAAGG + Intergenic
1021403647 7:20238495-20238517 CAGCAGAGAAAGAATGAGATTGG + Intergenic
1021491338 7:21222389-21222411 CTTCAGAGAATGAAAGTGGAAGG - Intergenic
1022071653 7:26922078-26922100 CAGCTGAGAAAGAATGAAAAAGG + Intronic
1022797509 7:33743976-33743998 ATGAAGGGAAAGATTGAGGAAGG - Intergenic
1022966840 7:35482097-35482119 CTGAACAGAAAGAATGAGGGAGG - Intergenic
1023297810 7:38734545-38734567 CTGCAGAGAAATAAGGAGAAAGG - Intronic
1023540999 7:41265697-41265719 CTGCAGTAAAAGAATGAGAGTGG - Intergenic
1024039348 7:45538478-45538500 ATGCAGAGCAAGAAGAAGGAAGG + Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024596421 7:50941302-50941324 CTGCAGAGCAAGGATGTCGATGG + Intergenic
1024832032 7:53472321-53472343 CTGGTGAGAAAGGATGTGGACGG - Intergenic
1025840067 7:65138199-65138221 TTGCAGAGAGAGAAATAGGAAGG + Intergenic
1025882996 7:65557765-65557787 TTGCAGAGAGAGAAATAGGAAGG - Intergenic
1025890448 7:65644840-65644862 TTGCAGAGAGAGAAATAGGAAGG + Intergenic
1026110546 7:67455695-67455717 GAGAAGAGAAAGAAAGAGGAAGG - Intergenic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026941176 7:74289022-74289044 CTGGACAGAAAGGATGAGGAGGG - Intergenic
1027221736 7:76218432-76218454 CTGCTGAGCAAGAATGGAGATGG - Intronic
1027234022 7:76287222-76287244 CTGCGGAGAAAGAGGGAGGGGGG - Exonic
1027604710 7:80286516-80286538 CTGCATAGAAAGCATGACGCTGG - Intergenic
1027766882 7:82355089-82355111 CTGCAGAGACTAAATGAGGAGGG + Intronic
1027935380 7:84595313-84595335 CTTCACAGAATGAATTAGGAAGG - Intergenic
1028227677 7:88267844-88267866 ATGCCAAGAAAGAATTAGGAGGG - Intergenic
1028443913 7:90896319-90896341 TTGAAGAGAGAGAATGAGAAAGG - Intronic
1028833533 7:95349995-95350017 CTGAAGAGAAAGGATGTTGAGGG - Intergenic
1029074678 7:97926341-97926363 CTGCTATTAAAGAATGAGGATGG + Intergenic
1029805509 7:102991972-102991994 CTGGAGTGAAAGAATGAGTGAGG - Intronic
1030122389 7:106122744-106122766 CTGCAGGGTTAGAATTAGGAGGG - Intergenic
1030318640 7:108141728-108141750 CTGGAGAGCAAAAATGAGGGTGG + Intergenic
1030638251 7:111974556-111974578 TTGCAGAGAGAGGAGGAGGAAGG + Intronic
1030949719 7:115774911-115774933 CTGCACATAAAGTGTGAGGATGG - Intergenic
1031014906 7:116562925-116562947 AGGAAGAGAAAGAAAGAGGAAGG + Intergenic
1031056223 7:116995636-116995658 CTGAATAGCAGGAATGAGGAAGG - Intronic
1031852037 7:126877165-126877187 TTGCAGAGAGAGAAAGAGGAAGG - Intronic
1032727282 7:134602436-134602458 CTTAAGAGAAAGAATGAGCTGGG - Intergenic
1033982813 7:147187118-147187140 CTGGGGAGAAAGAATGAACATGG + Intronic
1034060662 7:148084726-148084748 GTCCAGAGAAATCATGAGGAAGG + Intronic
1034227673 7:149496484-149496506 CTGCAGAGAGAGACTAAGAAGGG - Intronic
1034860292 7:154589170-154589192 ATGCTGAGAAAGGTTGAGGAGGG - Intronic
1035060639 7:156066797-156066819 CTGCGGAGGGAGAATCAGGAAGG + Intergenic
1035407760 7:158610850-158610872 CTGCAGAGAAACCAGTAGGAAGG - Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1038216549 8:25566981-25567003 AAGCAGAGAAAGAAAGACGAAGG - Intergenic
1038356025 8:26830192-26830214 CTGCAGAGAAAGCCGAAGGATGG + Intronic
1039123881 8:34178834-34178856 CTTCATAGAATGAATTAGGAAGG - Intergenic
1039326876 8:36495359-36495381 CTGCAGAAAAAGGAAGATGATGG - Intergenic
1041512401 8:58666434-58666456 CTGAGGAGAAATAAGGAGGAAGG + Intergenic
1043101672 8:76055037-76055059 CTGCAAAGAGATAATGTGGAAGG - Intergenic
1043179213 8:77063733-77063755 CTGCATAGAAACTATGAGGGTGG + Intergenic
1043332696 8:79137273-79137295 CTGCAGAGAAAGCATAAAGCTGG - Intergenic
1043714967 8:83470677-83470699 CAGTAGAAAAAGAATGAGCAAGG - Intergenic
1043917593 8:85940538-85940560 CAACAGAGAGAGAATGAGGAAGG + Intergenic
1045330880 8:101154839-101154861 CTGCAGGGAAGGAGTGAGGGAGG + Intergenic
1046269537 8:111875763-111875785 GTGCAGAGAAGCAATGACGATGG + Intergenic
1046676146 8:117110856-117110878 CTGTAAAGCAAGAAAGAGGATGG - Intronic
1046689178 8:117263496-117263518 AGGCAAAGAGAGAATGAGGAAGG - Intergenic
1047255334 8:123209590-123209612 CTGCTGAGAAAGTTTAAGGAAGG + Exonic
1047861652 8:128973492-128973514 CTGCCTCCAAAGAATGAGGAAGG - Intergenic
1048482905 8:134817444-134817466 CTGCAGAGAAACAATCAATAAGG - Intergenic
1048808703 8:138265131-138265153 CACCAGAGAAAGAAAGAGGAAGG - Intronic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049825874 8:144667410-144667432 CTGCAGAGACAGGATGAGGGAGG - Intergenic
1050019888 9:1271774-1271796 GTCCAGAGAAAGAATGAAGTCGG - Intergenic
1050290801 9:4152301-4152323 TTGCAGAGAATGTAGGAGGAGGG + Intronic
1050502438 9:6313270-6313292 AGGCAAAGAGAGAATGAGGAAGG + Intergenic
1050752091 9:8951290-8951312 CAGCAGAGAAATAATTAAGAAGG - Intronic
1050798931 9:9584423-9584445 CTGTAGAGAAAGAATAGTGATGG - Intronic
1051881443 9:21844361-21844383 CTTCACAGAATGAATTAGGAAGG - Intronic
1053067354 9:35078078-35078100 CTGGAGAGAAAGGAGGAGGAAGG + Intronic
1054999010 9:71427224-71427246 CTTTAGAGTAAGACTGAGGAGGG - Intronic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055485789 9:76755361-76755383 ATGGAGAGAGAGAATGAGGGAGG + Intronic
1055596756 9:77873542-77873564 CTCCTGAGAAATAATAAGGAAGG + Intronic
1056069745 9:82973789-82973811 ATGAAGAGAAAGAAAGAGAAAGG - Intergenic
1056459369 9:86794776-86794798 GTGGGGAGAAAGAATGAGGAGGG + Intergenic
1058284420 9:103158033-103158055 CTTCACAGAATGAGTGAGGAAGG + Intergenic
1058593614 9:106591395-106591417 CTTCAGAGAGAGAAAGAGAAAGG + Intergenic
1058774250 9:108268294-108268316 GTGAAGAGAAAGGCTGAGGATGG + Intergenic
1058858641 9:109092111-109092133 CTGAAGAGAAAGAATGAGAAAGG - Intronic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059099521 9:111456369-111456391 CAGCAGAGTAAGAATAAGAATGG + Intronic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059354102 9:113686525-113686547 CTGCAGAGAAGGGATGTGGCAGG + Intergenic
1059599890 9:115765578-115765600 TTACAGAAAAAGAAAGAGGATGG - Intergenic
1060395936 9:123316583-123316605 GTGCAGAGAAAGAGGAAGGAAGG + Intergenic
1061290147 9:129646108-129646130 CGACAGAGAAGGAGTGAGGAGGG + Intergenic
1061599567 9:131658650-131658672 CTACCGAGAGAGAAAGAGGATGG + Intronic
1062229485 9:135473752-135473774 GTGCAGAGTAAAAATGAGAAAGG - Intergenic
1062453000 9:136623348-136623370 CTGGAGAGAAGGAAGGAGAAAGG - Intergenic
1062455420 9:136634921-136634943 CTGTAGGGAAAGGAAGAGGAGGG + Intergenic
1185727639 X:2435157-2435179 ATGCAGAGAGAGAAACAGGAGGG + Intronic
1185827033 X:3261343-3261365 CTGCAGACCAGGAAGGAGGAAGG + Intergenic
1185889562 X:3812407-3812429 CTGCAGAGAGAGAGGGAGGGAGG - Intergenic
1186086463 X:5995839-5995861 CAGAAAAGAAAGAGTGAGGATGG - Intronic
1186129069 X:6446778-6446800 CTGCATAGAAATAAAGATGAAGG - Intergenic
1186461579 X:9752598-9752620 CTGCAGAGAACCAGAGAGGAGGG + Intronic
1186508383 X:10111741-10111763 GTGCAGAGAGAGAGTGAGGTTGG + Intronic
1186544149 X:10431636-10431658 AGGCAGAGAGAGAAAGAGGAGGG - Intergenic
1187207278 X:17195145-17195167 CTGAAGAGAGAGCATGAAGAAGG - Intergenic
1187226306 X:17377195-17377217 CTGCAGGGAAACGACGAGGAAGG + Intronic
1187829380 X:23365494-23365516 GGGGAGAGAAAGAAAGAGGAAGG + Intronic
1188079722 X:25822241-25822263 AGGCAAAGAGAGAATGAGGAAGG + Intergenic
1188519288 X:31020108-31020130 CTGAAGAGGAGGAATAAGGAGGG + Intergenic
1188856481 X:35202292-35202314 CTACAGAGACATGATGAGGAAGG - Intergenic
1189302109 X:39959662-39959684 CAGCAGGGAAAGATGGAGGAGGG + Intergenic
1189332602 X:40152867-40152889 CTCCCGAGACAGAATGAGGAAGG + Intronic
1189932053 X:46023017-46023039 CTTCATAGAATGAATTAGGAAGG - Intergenic
1190346550 X:49342487-49342509 CTGCTCATAAAAAATGAGGATGG + Intronic
1190347796 X:49533515-49533537 CTGCTCATAAAAAATGAGGATGG + Intronic
1190348897 X:49543071-49543093 CTGCTCATAAAAAATGAGGATGG + Intronic
1190349999 X:49552627-49552649 CTGCTCATAAAAAATGAGGATGG + Intronic
1190351102 X:49562180-49562202 CTGCTCATAAAAAATGAGGATGG + Intronic
1190352203 X:49571738-49571760 CTGCTCATAAAAAATGAGGATGG + Intronic
1190353304 X:49581287-49581309 CTGCTCATAAAAAATGAGGATGG + Intronic
1190354410 X:49590831-49590853 CTGCTCATAAAAAATGAGGATGG + Intronic
1190355509 X:49600358-49600380 CTGCTCATAAAAAATGAGGATGG + Intronic
1190884280 X:54517706-54517728 CTGAAAAGAAAGAACGATGATGG + Intergenic
1191150666 X:57218708-57218730 CTTCAGAGAATGAATTAGGGAGG + Intergenic
1193578803 X:83236041-83236063 CTTCATAGAATGAATTAGGAAGG - Intergenic
1193889085 X:87020801-87020823 CTTCATAGAATGAATTAGGAAGG - Intergenic
1193977144 X:88135175-88135197 TACCAGAGAAAGAATAAGGAAGG + Intergenic
1194329484 X:92563147-92563169 CTGCACAGAAAGCATGATGCTGG + Intronic
1194790689 X:98145770-98145792 GGTCAGAGAAATAATGAGGAGGG - Intergenic
1195708083 X:107752544-107752566 CTGGAGACAAAGAACAAGGAAGG + Intronic
1196575461 X:117312934-117312956 CTTCATAGAATGAATTAGGAAGG + Intergenic
1196693640 X:118587484-118587506 CTGCAGAGCAGTAATGATGAAGG - Intronic
1196748476 X:119093286-119093308 CTGCTGAGGAAGAATGCTGAAGG + Intronic
1197033806 X:121850919-121850941 TTGCAGGGAAGGAAGGAGGAAGG - Intergenic
1197102777 X:122676137-122676159 CTTCATAGAATGAATGAGGGAGG - Intergenic
1197867639 X:131035966-131035988 CTACAGAGAAAGAGTAAAGAGGG + Intergenic
1198012826 X:132576262-132576284 ATGCAGAGAAAGTATTGGGAGGG + Intergenic
1198026443 X:132712316-132712338 CTTCAGAGATCAAATGAGGAAGG - Intronic
1198028686 X:132734168-132734190 CGGCAGAGAAAGGATGGTGACGG + Intronic
1198173950 X:134136082-134136104 CAGGAGAGAAAGAGTGAGGGGGG - Intergenic
1198910052 X:141603176-141603198 CTGCAGAGAATGTCTGATGAGGG + Intronic
1199028292 X:142965552-142965574 GTGCAGAAAATGAATTAGGAGGG - Intergenic
1199583085 X:149380261-149380283 CTGCTAAGTAAGAATGAAGAGGG + Intergenic
1199608064 X:149592479-149592501 CTGCAAAGAAAGAAAAAGGATGG + Intergenic
1199631056 X:149776881-149776903 CTGCAAAGAAAGAAAAAGGATGG - Intergenic
1199668847 X:150124445-150124467 CTTCATAGAATGAATTAGGAAGG - Intergenic
1199684597 X:150255017-150255039 CTCCAGCTGAAGAATGAGGATGG + Intergenic
1200638184 Y:5682344-5682366 CTGCACAGAAAGCATGATGCTGG + Intronic
1201235666 Y:11908470-11908492 CTGCAGAGAAGGAAGGTGGCAGG + Intergenic
1201509591 Y:14744245-14744267 CAGAAGATAAAGAGTGAGGATGG + Intronic
1201516497 Y:14824082-14824104 GTGGAGAGAGAGAATGAAGAAGG + Intronic