ID: 1162423499

View in Genome Browser
Species Human (GRCh38)
Location 19:10579803-10579825
Sequence TAAAATTCCACCAGTGCGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162423499_1162423502 26 Left 1162423499 19:10579803-10579825 CCGCACGCACTGGTGGAATTTTA 0: 1
1: 0
2: 2
3: 10
4: 82
Right 1162423502 19:10579852-10579874 TTGCTGCCTGAAACTCAGAGTGG 0: 1
1: 0
2: 0
3: 20
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162423499 Original CRISPR TAAAATTCCACCAGTGCGTG CGG (reversed) Exonic
901568445 1:10138797-10138819 TAAAATTCAACCAGTGCTAAGGG - Intronic
901963267 1:12844427-12844449 TAAAATTCCATCAGTGTTTGTGG - Intergenic
901963800 1:12849354-12849376 TAAAATTCCATCAGTGTTTGTGG - Intronic
901968372 1:12886809-12886831 TAAAATACCATCAGTGTTTGTGG - Intronic
901976455 1:12948187-12948209 TAAAATACCATCAGTGTTTGTGG - Intronic
901984095 1:13060227-13060249 TAAAATTCCATCAGTGCTTGTGG + Intergenic
901984958 1:13068061-13068083 TAAAGTTCCATCAGTGTTTGTGG + Intronic
901990465 1:13108760-13108782 TAAAATTCCATCAGTGTTTGCGG - Intergenic
901991436 1:13117450-13117472 TAAAATTCCATCAGTGTTTGTGG - Intergenic
901996851 1:13158709-13158731 TAAAGTTCCATCAGTGTTTGTGG - Intergenic
901997716 1:13166543-13166565 TAAAATTCCATCAGTGCTTGTGG - Intergenic
902008717 1:13253583-13253605 TAAAATACCATCAGTGTTTGTGG + Intergenic
902016802 1:13314974-13314996 TAAAATACCATCAGTGTTTGTGG + Intronic
902029253 1:13409693-13409715 TAAAATTCCATCAGTGTTTGTGG + Intergenic
902669469 1:17962715-17962737 TAAAAGTCCATCTGTGGGTGAGG - Intergenic
904398456 1:30239598-30239620 TAAGCTTTCACCAGTGCCTGAGG + Intergenic
907249033 1:53125743-53125765 CAGACTTCCACCAGAGCGTGCGG + Intronic
909873957 1:80779493-80779515 GAAAGTTCCACCAGGGGGTGTGG - Intergenic
918270274 1:182891652-182891674 TAAAATTCAACCATCCCGTGGGG + Intergenic
918322442 1:183377093-183377115 TGAATTTCCACCAGTGCCTTCGG - Intronic
919097300 1:193053374-193053396 TGAAATTCTACCAGTGCAGGAGG - Intronic
920235564 1:204501440-204501462 TATAATTCCAACAGTTTGTGAGG + Intergenic
921243182 1:213208130-213208152 TAAAATTCCATCAGAGGGTTGGG - Intronic
921624458 1:217362857-217362879 TAAATTTCCACAACTGGGTGGGG + Intergenic
921636395 1:217499593-217499615 TCAAATTCCACCAGTGATGGGGG + Intronic
1063889218 10:10612279-10612301 TATAATTTCACCGGTGCCTGGGG - Intergenic
1064333196 10:14413817-14413839 TAAAATTCCACATGTAAGTGAGG - Intronic
1065997408 10:31071695-31071717 TTAAATTCCAACATTGCTTGTGG + Intergenic
1066444066 10:35465751-35465773 TAAAAATCCAGCTCTGCGTGAGG + Intronic
1072953738 10:99870794-99870816 TATAATCCCAGCACTGCGTGAGG - Intergenic
1080876484 11:36279489-36279511 TAACCTTCCACCAGTGAGAGTGG + Intronic
1083976749 11:66128580-66128602 TAAAATTTAACAAGTGAGTGAGG + Intronic
1092353484 12:7775207-7775229 TATAATTCCAACAGTTTGTGAGG - Intergenic
1092578256 12:9813456-9813478 TAAAATTCCAGCTGGGCGTGGGG - Intergenic
1095127236 12:38494500-38494522 TAATATGACTCCAGTGCGTGTGG + Intergenic
1106656108 13:31748334-31748356 TAACACTCCACCAGTGTATGAGG + Intronic
1107959764 13:45547544-45547566 TAAATCTCCACCCCTGCGTGTGG - Intronic
1117589561 14:57253056-57253078 TAAAATTCCACATATGAGTGAGG - Intronic
1121991935 14:98566604-98566626 AAAAATGCCTCCAGTGCCTGTGG + Intergenic
1125403902 15:39333144-39333166 TAAAATACATCCAGTGCCTGAGG - Intergenic
1127255046 15:57283172-57283194 TAAAATTCCACCAGAGAGAAGGG - Intronic
1129585915 15:76864518-76864540 TAAAAATTAACCAGTGGGTGGGG - Intronic
1130379877 15:83362422-83362444 TAATATTCCCCCAATGCATGAGG - Intergenic
1131363692 15:91818806-91818828 CAACACTCCACCAGTGGGTGAGG + Intergenic
1133469184 16:6057786-6057808 TAAAATTTCAACAGTGCCAGGGG - Intronic
1139035947 16:62946815-62946837 TCAAATTCCTTCAGTGCTTGAGG + Intergenic
1139342361 16:66276162-66276184 TAAAAGTCTCCCCGTGCGTGAGG + Intergenic
1139900304 16:70322950-70322972 TAAAATTCCACCTGTGGCCGGGG + Intronic
1140106292 16:71963523-71963545 TACAATCCCAGCACTGCGTGAGG + Intronic
1141843846 16:86593608-86593630 TAAAATTTCACCACTGCCAGGGG - Intergenic
1143736636 17:8916022-8916044 CAGAATTCCACCAGTGCCTGAGG - Intronic
1156751591 18:40463974-40463996 TATAATTCCAGCAGTGTGGGGGG + Intergenic
1162423499 19:10579803-10579825 TAAAATTCCACCAGTGCGTGCGG - Exonic
1163267006 19:16227581-16227603 TGAAGTTCCACCAGTGTGTGCGG + Exonic
937166195 2:119820115-119820137 TATAATTCCAGCAGTGTGGGAGG - Intronic
941901066 2:170678717-170678739 TAAAATAACACAAGTGCGTTAGG + Intergenic
947585319 2:231352612-231352634 TAAAATCCTAGCAGTGGGTGCGG - Intronic
948508271 2:238445975-238445997 TGAAGCTCCACCAGTGCCTGGGG - Intronic
948764262 2:240211519-240211541 TAAAACTCCAGCAGGGGGTGTGG + Intergenic
1180841536 22:18961284-18961306 GAAAATCCCCCGAGTGCGTGGGG - Intergenic
952683371 3:36121798-36121820 TAGAATTCCACCAGTGCCCGTGG + Intergenic
954882023 3:53843020-53843042 GAAAATTCCACCTGTGTGGGTGG + Intronic
956277755 3:67521395-67521417 TTCAATTCCACAAGTGAGTGGGG + Intronic
959945291 3:112119490-112119512 TCAAATCCCACCAGTGCTTCAGG - Intronic
960655859 3:120003643-120003665 TAATATTCCACTAGTGCATTTGG - Intronic
966411113 3:179646934-179646956 TATAATTCCAGCAGTTTGTGAGG + Intergenic
970384553 4:15543054-15543076 TAGAATTCCTTCAGTGCCTGTGG + Intronic
977333140 4:95663027-95663049 TACAATTCCAGCAGTGGGTCAGG + Intergenic
981580022 4:146241718-146241740 TAAAAACCCAGCAGTGTGTGTGG + Intergenic
987531398 5:19125735-19125757 TAGAATTCCACCAGTGGGGAAGG + Intergenic
992709911 5:79441738-79441760 AAAAATTCCAACAGTACATGAGG + Intronic
998659261 5:144218062-144218084 TAAAAGCCCACCACTGCATGTGG - Intronic
1002002089 5:176201985-176202007 TATAATTCCAGCAGTTTGTGGGG + Intergenic
1003236648 6:4301120-4301142 TCAAATTCCACCACAGCCTGTGG + Intergenic
1005025529 6:21459501-21459523 TAAAATTCCACCTTTGCATCAGG - Intergenic
1007151992 6:39702656-39702678 TACAATTCCACCACTTCGGGAGG - Intronic
1007450280 6:41936812-41936834 GAAAACTCCAGCAGTGGGTGGGG + Intronic
1008066003 6:47049351-47049373 TAAAAGTCCATCAGTAGGTGCGG + Intergenic
1015213453 6:130722686-130722708 TAGAATTCCTCCAGTTCGTCGGG + Intergenic
1015895940 6:138016896-138016918 TAAAAATCAACCAGTGGGAGTGG - Intergenic
1019156341 6:170041464-170041486 AAAAATTTCACCCGTGCATGTGG + Intergenic
1026079831 7:67207975-67207997 TAAAATTCCAGCACTTTGTGAGG - Intronic
1034920333 7:155074442-155074464 CAAAAATCCACCAATCCGTGAGG - Intronic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1037041036 8:14234248-14234270 TAAAATTCTATCAGTGAGTCAGG + Intronic
1037820909 8:22134112-22134134 AAAAATACAGCCAGTGCGTGCGG + Intergenic
1039751043 8:40479006-40479028 TAAAAATACAACAGTGCCTGTGG + Intergenic
1040609591 8:48969827-48969849 TAGAATGCCTCCAGTGTGTGTGG + Intergenic
1041715143 8:60925456-60925478 TCCACTTCCACCAGTGCCTGGGG + Intergenic
1048185142 8:132233446-132233468 TGATATTCCACCAGGGTGTGTGG + Intronic
1048433052 8:134388576-134388598 TATTATTCCACCAGTCCCTGAGG - Intergenic
1059961396 9:119568467-119568489 TAAAATTCCAGCACTTCGGGAGG - Intergenic
1186040806 X:5476048-5476070 TAAAATTGCACCCATGCTTGTGG - Intergenic
1198460129 X:136855244-136855266 TAAAATGCCACCATTGACTGAGG + Intronic
1201464446 Y:14265020-14265042 TCAAACTCCACCAGTGTGTCAGG + Intergenic