ID: 1162426855

View in Genome Browser
Species Human (GRCh38)
Location 19:10602386-10602408
Sequence CCCCGCGCGCCTCCTCCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162426855_1162426876 14 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426876 19:10602423-10602445 AGGGGCGGGGCCGGGGCCCGGGG No data
1162426855_1162426870 5 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426870 19:10602414-10602436 CCCGGCGGGAGGGGCGGGGCCGG No data
1162426855_1162426872 6 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426872 19:10602415-10602437 CCGGCGGGAGGGGCGGGGCCGGG 0: 2
1: 4
2: 23
3: 223
4: 1518
1162426855_1162426863 -6 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426863 19:10602403-10602425 GCGGGGGCTGGCCCGGCGGGAGG No data
1162426855_1162426867 0 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426867 19:10602409-10602431 GCTGGCCCGGCGGGAGGGGCGGG No data
1162426855_1162426873 7 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426873 19:10602416-10602438 CGGCGGGAGGGGCGGGGCCGGGG No data
1162426855_1162426865 -4 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426865 19:10602405-10602427 GGGGGCTGGCCCGGCGGGAGGGG No data
1162426855_1162426862 -9 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426862 19:10602400-10602422 CGCGCGGGGGCTGGCCCGGCGGG No data
1162426855_1162426878 18 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426878 19:10602427-10602449 GCGGGGCCGGGGCCCGGGGCGGG No data
1162426855_1162426879 19 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426879 19:10602428-10602450 CGGGGCCGGGGCCCGGGGCGGGG No data
1162426855_1162426861 -10 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426861 19:10602399-10602421 GCGCGCGGGGGCTGGCCCGGCGG No data
1162426855_1162426864 -5 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426864 19:10602404-10602426 CGGGGGCTGGCCCGGCGGGAGGG No data
1162426855_1162426877 17 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426877 19:10602426-10602448 GGCGGGGCCGGGGCCCGGGGCGG 0: 3
1: 5
2: 85
3: 735
4: 3029
1162426855_1162426875 13 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426875 19:10602422-10602444 GAGGGGCGGGGCCGGGGCCCGGG No data
1162426855_1162426874 12 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426874 19:10602421-10602443 GGAGGGGCGGGGCCGGGGCCCGG No data
1162426855_1162426868 1 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426868 19:10602410-10602432 CTGGCCCGGCGGGAGGGGCGGGG No data
1162426855_1162426866 -1 Left 1162426855 19:10602386-10602408 CCCATTGGAGGAGGCGCGCGGGG No data
Right 1162426866 19:10602408-10602430 GGCTGGCCCGGCGGGAGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162426855 Original CRISPR CCCCGCGCGCCTCCTCCAAT GGG (reversed) Intergenic
No off target data available for this crispr