ID: 1162431519

View in Genome Browser
Species Human (GRCh38)
Location 19:10631682-10631704
Sequence AATGAGACGACCTATGAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 98}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162431506_1162431519 29 Left 1162431506 19:10631630-10631652 CCGGAGATGCTTCCCCGCTATCC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1162431519 19:10631682-10631704 AATGAGACGACCTATGAGGATGG 0: 1
1: 0
2: 1
3: 10
4: 98
1162431512_1162431519 8 Left 1162431512 19:10631651-10631673 CCACGCCTACAAGGGTGTCCTGA 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1162431519 19:10631682-10631704 AATGAGACGACCTATGAGGATGG 0: 1
1: 0
2: 1
3: 10
4: 98
1162431511_1162431519 15 Left 1162431511 19:10631644-10631666 CCGCTATCCACGCCTACAAGGGT 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1162431519 19:10631682-10631704 AATGAGACGACCTATGAGGATGG 0: 1
1: 0
2: 1
3: 10
4: 98
1162431507_1162431519 17 Left 1162431507 19:10631642-10631664 CCCCGCTATCCACGCCTACAAGG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1162431519 19:10631682-10631704 AATGAGACGACCTATGAGGATGG 0: 1
1: 0
2: 1
3: 10
4: 98
1162431509_1162431519 16 Left 1162431509 19:10631643-10631665 CCCGCTATCCACGCCTACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1162431519 19:10631682-10631704 AATGAGACGACCTATGAGGATGG 0: 1
1: 0
2: 1
3: 10
4: 98
1162431505_1162431519 30 Left 1162431505 19:10631629-10631651 CCCGGAGATGCTTCCCCGCTATC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1162431519 19:10631682-10631704 AATGAGACGACCTATGAGGATGG 0: 1
1: 0
2: 1
3: 10
4: 98
1162431514_1162431519 3 Left 1162431514 19:10631656-10631678 CCTACAAGGGTGTCCTGATGGTG 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1162431519 19:10631682-10631704 AATGAGACGACCTATGAGGATGG 0: 1
1: 0
2: 1
3: 10
4: 98
1162431517_1162431519 -10 Left 1162431517 19:10631669-10631691 CCTGATGGTGGGCAATGAGACGA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1162431519 19:10631682-10631704 AATGAGACGACCTATGAGGATGG 0: 1
1: 0
2: 1
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162431519 Original CRISPR AATGAGACGACCTATGAGGA TGG Exonic
908378796 1:63574276-63574298 AATGAGAGGTTCTATGAGGCAGG + Intronic
911967302 1:104384953-104384975 AATGAGAGGTTCTAAGAGGAGGG - Intergenic
911984206 1:104600767-104600789 AATGAGACGTTCTAAGAGGCGGG - Intergenic
912574020 1:110647982-110648004 AATGAGAACACCTATGATTATGG - Intergenic
916197894 1:162241904-162241926 AATGAGATGATTTAGGAGGAAGG - Intronic
918184023 1:182111504-182111526 AATGATGGGACCGATGAGGAGGG + Intergenic
919894568 1:202001399-202001421 AATGAGACCCCCTACGAGAAAGG + Exonic
920864108 1:209737187-209737209 CCTGAGACGACCTCTTAGGAAGG - Intergenic
924717529 1:246591418-246591440 AATGAAACAACCTAAGAGAAGGG + Intronic
1062931062 10:1352996-1353018 AATGAGAGGTTCTAAGAGGAGGG - Intronic
1066237715 10:33502503-33502525 TACGAGATGAACTATGAGGAGGG - Intergenic
1067110044 10:43393966-43393988 AATGAGAAGACCTTTGAGAAAGG - Intronic
1070423182 10:76258252-76258274 ACTGAGACGAAGTATGAAGATGG - Intronic
1070843607 10:79504941-79504963 AAGGAGACTAACAATGAGGATGG - Intergenic
1070930059 10:80254659-80254681 AAGGAGACTAACAATGAGGATGG + Intergenic
1073286053 10:102389138-102389160 AATGCAAGGACCTAGGAGGAAGG - Intergenic
1074255705 10:111800267-111800289 AAAGAGGCGGCCTCTGAGGATGG + Intergenic
1075186964 10:120271018-120271040 AATGAAAAGACCCATGAGGTTGG + Intergenic
1081600409 11:44488673-44488695 AAGCAGACGACCTGGGAGGAAGG + Intergenic
1082108488 11:48245654-48245676 AATCAGCAGACCAATGAGGAAGG - Exonic
1083534687 11:63456965-63456987 AATGAGACGTTCTAAGAGGCGGG - Intergenic
1090598460 11:128344546-128344568 AAAGAGAAGAATTATGAGGATGG + Intergenic
1091637431 12:2208034-2208056 AATTAGTGGACCTTTGAGGACGG + Intronic
1092049670 12:5459220-5459242 AATGAGATGACGTCAGAGGATGG + Intronic
1092414736 12:8281707-8281729 AATGAGAGGTTCTAAGAGGAGGG + Intergenic
1096392914 12:51243175-51243197 GCAGAGACAACCTATGAGGAGGG - Intronic
1100708647 12:97229357-97229379 AATGAGATGAGCAATGAGGGGGG - Intergenic
1102116405 12:110406393-110406415 AATGAGAGGTTCTAAGAGGAGGG + Intergenic
1104602182 12:130161771-130161793 AAAGAGACGAGCTAAGGGGAGGG - Intergenic
1107726531 13:43305083-43305105 AATGAGGCTACCAATGATGAAGG - Intronic
1108598756 13:51972606-51972628 AATGAGACCACGTAGGAGGCCGG - Intronic
1115606197 14:35004765-35004787 ACTGAAAGGATCTATGAGGAAGG + Intronic
1122041266 14:98989251-98989273 AATGAGAGGTTCTAAGAGGAGGG - Intergenic
1125930323 15:43595153-43595175 GATGAGGAGACCTATGAGGTAGG + Exonic
1125943491 15:43694985-43695007 GATGAGGAGACCTATGAGGTAGG + Exonic
1127265251 15:57355694-57355716 AATGAGACTACATATCAAGATGG + Intergenic
1130941863 15:88516977-88516999 AATGAAAGGACCGGTGAGGAAGG + Intronic
1131252062 15:90837493-90837515 AATGAGACGAGCTTACAGGAAGG + Intergenic
1133765451 16:8834686-8834708 AATGAGACGTTCTAAGAGGCGGG + Intronic
1133939093 16:10293621-10293643 AATGAGAGGTCCTATGAGGCGGG - Intergenic
1136999596 16:35217166-35217188 AATGGGAGGGCCCATGAGGAAGG - Intergenic
1138486294 16:57346435-57346457 AATAAGAAGACCTAGGAGGAGGG + Intergenic
1139230312 16:65276912-65276934 AATGAGAGGTCCTAAGAGGCGGG + Intergenic
1140093269 16:71854106-71854128 GATGAGCCTTCCTATGAGGAAGG - Exonic
1142525794 17:539787-539809 AATGAGACGACGTATGTTTAGGG - Intronic
1143145893 17:4775150-4775172 AATGAGATGAGGTCTGAGGAGGG + Intronic
1144052749 17:11511042-11511064 AATGAGATGACATATGAACAGGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1162431519 19:10631682-10631704 AATGAGACGACCTATGAGGATGG + Exonic
1164471259 19:28535613-28535635 AATGAGACCACCAATGAGAAAGG - Intergenic
1164931015 19:32176039-32176061 AATGAGATGACATTTGAGAAAGG + Intergenic
1167204779 19:48093655-48093677 AATGAGAAGACCAGTGAGGCTGG - Intronic
929230436 2:39554558-39554580 AAAGGGAGGACCTTTGAGGAAGG - Intergenic
936891415 2:117374121-117374143 AATGATAAGACCCCTGAGGATGG + Intergenic
937776212 2:125779024-125779046 ACAGAGAAGACCTATGAGGTAGG + Intergenic
939902784 2:147870061-147870083 TATGGGAGGACGTATGAGGAGGG + Intronic
941132281 2:161667419-161667441 TATGATAAGACCTATGAAGAAGG + Intronic
943562431 2:189479815-189479837 AATGAAATGAACAATGAGGAAGG - Intergenic
944542357 2:200766099-200766121 AATGAGACGACTCATGAGGAGGG - Intergenic
946777350 2:223157244-223157266 AATAAGACAACCTACAAGGAAGG - Intronic
1169733387 20:8811027-8811049 AAAGGGACCACCTATGAGGTAGG + Intronic
1172314609 20:33944008-33944030 AAAGAGACTTCCTTTGAGGAAGG - Intergenic
1177455897 21:21338415-21338437 AATGAAACTACATATGAGAATGG + Exonic
950532586 3:13561070-13561092 AATCAGAGGACCTATGGGGGCGG - Intronic
953834090 3:46328215-46328237 AATGAGAGGTTCTAAGAGGAGGG + Intergenic
961129966 3:124456960-124456982 AATGTGATGATCTATGAGGAAGG - Intronic
963704217 3:148665620-148665642 AATGAGAAGACCAAGGAGGGAGG - Intergenic
964940585 3:162155033-162155055 AATGAGACGTTCTAAGAGGTGGG + Intergenic
968993649 4:3931426-3931448 AATGAGAGGTTCTAAGAGGAGGG - Intergenic
969943226 4:10756100-10756122 AATGAAATGAATTATGAGGATGG - Intergenic
970693329 4:18644860-18644882 AAGAAGAAGACCTATGTGGATGG - Intergenic
970870070 4:20806218-20806240 AATTAGAAGACATATAAGGAAGG - Intronic
976702146 4:87982307-87982329 AATGAGATGACATATGTGAAAGG + Intronic
978584289 4:110261081-110261103 AATGAGACGTGGGATGAGGAAGG + Intergenic
982037424 4:151359913-151359935 AAAGAGACCAGCTATGAGGATGG + Intergenic
982691926 4:158558216-158558238 AATGAGGACACCAATGAGGAAGG - Intronic
984763338 4:183381002-183381024 AATGAGACCATACATGAGGATGG - Intergenic
988691255 5:33574761-33574783 AATGAGACTACCTATGAAAGTGG + Intronic
990938479 5:61175939-61175961 ATTGACAGGACCTTTGAGGAAGG + Intergenic
1001759169 5:174193323-174193345 AATGAGACCTCCTATGTGCAAGG - Intronic
1005439844 6:25855184-25855206 AATGAAGCCACCTATGAGGATGG + Exonic
1005690502 6:28300384-28300406 ATTGAGAAGACCTATGCAGAGGG - Intronic
1009630768 6:66197553-66197575 ATAGAGTAGACCTATGAGGATGG - Intergenic
1010955502 6:82086694-82086716 AAAGAGATGACATATGAGAAAGG - Intergenic
1011492494 6:87906789-87906811 AATGAGATGACATCTGTGGAAGG - Intergenic
1012148254 6:95713534-95713556 AATGAGAAGAGTTATGAGGATGG + Intergenic
1016535486 6:145104811-145104833 AATGAGAGGTCCTAAGAGGTGGG + Intergenic
1016689651 6:146922294-146922316 AATGAGATGAGAGATGAGGAGGG + Intergenic
1017270186 6:152495085-152495107 AATGAGAGGTTCTAAGAGGAGGG - Intronic
1017291631 6:152744678-152744700 AATGAAAGGACCAAAGAGGAGGG - Intergenic
1017833882 6:158158789-158158811 AATGAGAAGCTCTATGTGGACGG + Intronic
1021698323 7:23294490-23294512 AATGAGCTGTCCTATGATGATGG + Intergenic
1030636317 7:111953336-111953358 AATGAGAAGAGCTAAGAGGATGG + Intronic
1031704302 7:124962077-124962099 AATGAGACGTTCTAAGAGGCAGG + Intergenic
1038346435 8:26736538-26736560 AATGAGACCACATATGAGAAGGG - Intergenic
1038598312 8:28911237-28911259 AATGAGAAGACCTGGGGGGAGGG + Intronic
1046303480 8:112329599-112329621 AGTGAGACAACATATGATGAGGG - Intronic
1047238195 8:123060979-123061001 AATCATACGACCAATGAGGGTGG + Intronic
1047694566 8:127390654-127390676 AATGAGATGATCTATGTTGAAGG - Intergenic
1047801341 8:128313824-128313846 AATGAGACAGCCTATGAGAGAGG - Intergenic
1058167717 9:101638990-101639012 AATGAGATGACGAATGTGGAGGG - Intronic
1060226477 9:121794383-121794405 AATGAGAGGTTCTATGAGGCAGG - Intergenic
1060737566 9:126076070-126076092 AATGAGAGGTCCTAAGAGGCGGG + Intergenic
1060920218 9:127415120-127415142 AATGAGAGGTTCTATGAGGCTGG + Intergenic
1188406760 X:29820653-29820675 AATCAGATGTCCTAGGAGGATGG - Intronic
1189520796 X:41765381-41765403 AATGACACAACATTTGAGGAAGG + Intronic
1192285447 X:69730196-69730218 AATGAGAGGGTCTTTGAGGATGG + Intronic
1196350897 X:114727677-114727699 AAGGAGACTACCTAGGAGCAAGG - Intronic
1196497159 X:116335180-116335202 AATGAGAGGATCTAAGAGGCAGG - Intergenic
1198841671 X:140864511-140864533 AATAAGACCACATATTAGGAGGG + Intergenic