ID: 1162432043

View in Genome Browser
Species Human (GRCh38)
Location 19:10634944-10634966
Sequence GGGCAAAGGCTGAGCCGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162432043 Original CRISPR GGGCAAAGGCTGAGCCGGCT GGG (reversed) Intronic
900389214 1:2426852-2426874 GGGCAGCGGCTGAGCTTGCTGGG + Intronic
900501654 1:3008626-3008648 GGGCAAAGGGGGAGCAGGCATGG - Intergenic
901638222 1:10680160-10680182 GGGCAAAGGCTGAGTAAGCAGGG + Intronic
902772257 1:18652098-18652120 GCGGAAAGGCTGGGCCGGCTGGG + Intronic
903017212 1:20368931-20368953 GGGCAAAGGCAGGGCAGCCTGGG + Intergenic
904746902 1:32716852-32716874 GAGAAAAGGCGGAGCCTGCTTGG + Intergenic
905873791 1:41419410-41419432 TGGCACAGGCTGAGCCGGCAAGG + Intergenic
906105502 1:43289496-43289518 GGGCAAGGGCTTAGCTAGCTTGG + Intergenic
906531131 1:46524699-46524721 GGGCAAAGGCACAGCAGCCTGGG + Intergenic
907314433 1:53559471-53559493 GGGCAGGGGCCGAGCAGGCTCGG - Intronic
915511545 1:156389484-156389506 GAGCAAAGCCTGTTCCGGCTGGG + Intergenic
919980542 1:202640268-202640290 TGGCAAAGGCAGAGCCAGCAGGG + Intronic
922527549 1:226317595-226317617 TGGCCAAGGCTGAGCAGGGTAGG - Intergenic
922888612 1:229042116-229042138 GGGGACAGGCTGAGGCGGCCGGG + Intergenic
923125755 1:231033190-231033212 GGGCAAAGGCCAAGGCGGCCAGG + Intronic
1063362142 10:5467722-5467744 GAGCAAAGGCACAGCCGGCCTGG - Intergenic
1066657946 10:37712534-37712556 AGGCCAAGGGTGAGCAGGCTGGG - Intergenic
1067708543 10:48629103-48629125 AGGCAAAGGCTGAAAGGGCTGGG - Intronic
1071908603 10:90204000-90204022 GTGCAAATGCAGAGCTGGCTGGG + Intergenic
1073053680 10:100685677-100685699 GGGCAAAGGCTGAACAGTCTTGG + Intergenic
1074169500 10:110919134-110919156 GGGCAACAGCTGAGCCGTCTGGG - Exonic
1075003315 10:118813587-118813609 GGGCCCAGGCTGTGCCAGCTCGG + Intergenic
1076631130 10:131853067-131853089 GGGCAGAGGCAGAGCAGGGTGGG - Intergenic
1077178621 11:1202596-1202618 GAGCCCAGGCTGAGCCGGGTGGG + Intergenic
1077491793 11:2864370-2864392 GGGCAAAGGTTGAGGCTCCTGGG - Intergenic
1078528736 11:12120309-12120331 GGGCATAGGATGAGTCAGCTGGG + Intronic
1079631147 11:22677191-22677213 GGGCAAAGGATCAGAGGGCTTGG + Intronic
1081575436 11:44316274-44316296 GGGCAGGGGCTGCGGCGGCTGGG - Intergenic
1084181687 11:67450097-67450119 GGGCAAAGGCAAAGACGGCCGGG - Intergenic
1084692022 11:70733034-70733056 GGGCACAGGCTGGGCGGGGTGGG + Intronic
1085203788 11:74718080-74718102 TGCCAAAGGCTGAGCCACCTGGG - Intronic
1089766610 11:120772093-120772115 GGGCAGAGGCTGAGCCCACAAGG - Intronic
1090883102 11:130851940-130851962 GTGCAAAGGCAGAGCCCGTTGGG + Intergenic
1091390801 12:125110-125132 GGGCACAGGCTCAGGTGGCTGGG - Intronic
1096021486 12:48329350-48329372 GGGCCATGGCTGAGGCGCCTGGG + Exonic
1096105444 12:48994897-48994919 GGGCAAGGGCTGAGTCAGCCGGG - Intergenic
1096106004 12:48997439-48997461 GGGCAAAAGCTGCACCTGCTGGG + Exonic
1097862612 12:64533197-64533219 GGTAACAGGCTGAGCCGGCCAGG - Intergenic
1102520738 12:113476425-113476447 GGGCAGAGGCTGGGCTCGCTGGG - Intergenic
1103579796 12:121906223-121906245 GGATAAAGGCTGAGCTGTCTTGG + Intronic
1103951083 12:124551557-124551579 GGGCTAAGGCTCGGCCGGCCTGG + Intronic
1104930980 12:132339357-132339379 GGCCAGAGGCTGAGCCGAATGGG + Intergenic
1104998341 12:132673115-132673137 GGGCAAGGGCTGAGGAGGCCAGG + Intronic
1105401525 13:20100311-20100333 CGTCAAAGGGTGAGACGGCTTGG + Intergenic
1107789521 13:43987645-43987667 TGGAAAAGGCTGAGCAGGGTGGG + Intergenic
1108277106 13:48821999-48822021 GGGAAGAGGCTGAGCCGGTGAGG + Intergenic
1110103600 13:71641318-71641340 GGTCAAAGTCTGAGTGGGCTAGG + Intronic
1111097964 13:83539101-83539123 GGGCAAAGGCATTGCCAGCTAGG + Intergenic
1113680350 13:112239125-112239147 GGGCACAGGCAAAGCCAGCTGGG + Intergenic
1114225707 14:20736514-20736536 GGGTAAAGGCAGAGCTGACTGGG + Intronic
1115641250 14:35336982-35337004 GGGCAGAGGCGGAGGCTGCTTGG - Intergenic
1119386642 14:74261483-74261505 GGGCAGAGGCTGGGCCTGCCTGG - Exonic
1119756961 14:77126134-77126156 GGGCAAGGACTGAGGTGGCTGGG - Intronic
1122746446 14:103899808-103899830 GGGGAGAGCCTGAGCCGGCCAGG + Intergenic
1122769638 14:104092268-104092290 AGGCAAAGGCTGAGCCCCGTGGG + Intronic
1122895022 14:104752619-104752641 GGGCAAAGTCTGGGGCGGCTGGG - Intergenic
1123018536 14:105386872-105386894 GGGCAAGGGCGGAGGCTGCTGGG - Intronic
1123113396 14:105883192-105883214 GGCCAAAGGCTGGGCCTGCCAGG - Intergenic
1123473980 15:20575768-20575790 GTGCAAATGCTGAGCATGCTTGG + Intergenic
1123644028 15:22424585-22424607 GTGCAAATGCTGAGCATGCTTGG - Intergenic
1123734280 15:23170780-23170802 GTGCAAATGCTGAGCATGCTTGG + Intergenic
1124284785 15:28392090-28392112 GTGCAAATGCTGAGCATGCTTGG + Intergenic
1124297912 15:28519524-28519546 GTGCAAATGCTGAGCATGCTTGG - Intergenic
1124577611 15:30923630-30923652 GGGCAGAGGTGGAGCCAGCTGGG + Intronic
1124640636 15:31393932-31393954 GGGCAAAGGCAGTCCAGGCTTGG - Intronic
1128700207 15:69798493-69798515 GTGGAGAGGCTGAGCAGGCTCGG + Intergenic
1129273894 15:74433294-74433316 GGGCGCAGGCTGGGCCGGCAAGG - Intronic
1129607367 15:77031409-77031431 GGGCAAAGGCTGAGCTGCTGAGG - Intronic
1130096408 15:80859491-80859513 GGGCAAAGGCATAGTCTGCTGGG - Intronic
1130655266 15:85788226-85788248 GTGCAAAGGCTGGGCCTGCGTGG - Intronic
1136373925 16:29853880-29853902 GGGGAAAGGCTGAGCTGACCTGG - Intergenic
1136938543 16:34499432-34499454 GGGAAAAGGCTGCTGCGGCTGGG + Intergenic
1136961275 16:34849125-34849147 GGGAAAAGGCTGCTGCGGCTGGG - Intergenic
1139470362 16:67174955-67174977 GCCCAAACCCTGAGCCGGCTTGG + Intronic
1139493801 16:67301592-67301614 GTGGGAAGGCTGAGCCGGCAGGG + Intronic
1139955555 16:70691422-70691444 AGGCAAAGGCTGGGCCAGCAAGG + Intronic
1141838003 16:86555272-86555294 GGGCGGAGGCTGAGCGGGCGAGG + Intergenic
1142595670 17:1028755-1028777 GGACTCAGGCTGAGCCGGCAGGG - Intronic
1142850900 17:2704315-2704337 GGGCCAGGCCTGAGCCTGCTGGG - Intronic
1144948965 17:18983874-18983896 GTGCAGAGGCTGAGCAGCCTTGG - Intronic
1145005233 17:19333915-19333937 GGGCAGAGGCTGAGCCGTCAGGG - Intronic
1146912388 17:36657137-36657159 TGGAAAAGGGGGAGCCGGCTGGG - Intergenic
1147166078 17:38594123-38594145 GGGCCAAGGCTCAGCCTGCAGGG - Intronic
1147424459 17:40339377-40339399 GGGATAAGGCTGAGCAGGATGGG + Intronic
1148201169 17:45750947-45750969 TGGCAAGGGCCCAGCCGGCTTGG - Intergenic
1152223448 17:79081812-79081834 GGGGAAAGGCTGAGACTGCAGGG + Intronic
1152610318 17:81312062-81312084 GGACGGAGGCTGAGCTGGCTAGG + Exonic
1152932485 17:83116949-83116971 TGGAAAAGGCTGAGCCTGGTGGG + Intergenic
1157273915 18:46296826-46296848 AGCCAGAGGCTGAGCAGGCTGGG + Intergenic
1160492782 18:79351894-79351916 GGGCAAGGGCAGAGTGGGCTTGG - Intronic
1160584071 18:79903191-79903213 GGGCAATGGCTGAGGGGGCCGGG - Exonic
1161647995 19:5466188-5466210 GGGCAATGTCAGAGCAGGCTTGG + Intergenic
1162432043 19:10634944-10634966 GGGCAAAGGCTGAGCCGGCTGGG - Intronic
1166072557 19:40395496-40395518 AGGCAGAGGCTGAGGGGGCTGGG - Exonic
1166316819 19:41994050-41994072 GGGTAGGTGCTGAGCCGGCTGGG - Exonic
1167038282 19:47007234-47007256 GGGCAAAGGCTGAGCCATCTGGG + Intergenic
1167129384 19:47573989-47574011 GGGGAAAGGCTGAGCCATCTGGG + Intergenic
1167454493 19:49591353-49591375 GGGCAAAGGCGGAGACAGCGGGG + Intergenic
925055446 2:853605-853627 GGCCAGAGGCTGAGGCGGGTGGG - Intergenic
926077393 2:9951991-9952013 GGGCAAAGGCCGTGGCGGCGTGG - Intronic
927154672 2:20214576-20214598 GTGCAGAGGCTGAGAGGGCTAGG - Intronic
927486738 2:23493146-23493168 GGGCAAACACTGAGCTGGCCAGG - Intronic
928082109 2:28320693-28320715 GGGCTAAGGCTGAGCAGGAAGGG - Intronic
928168535 2:28988447-28988469 GGGCACAGGCTGGGCCAGATGGG - Intronic
929615713 2:43305768-43305790 GGGCAAAGGCTGAGATGGGATGG - Intronic
930189232 2:48440901-48440923 GGAGACAGGCTGAGCCGCCTGGG + Exonic
934239003 2:90251857-90251879 GGGCACAAGCAGAGCAGGCTAGG - Intergenic
935638208 2:105266813-105266835 GGGCAAAGGCAGAGCCCACGAGG + Exonic
938240919 2:129741767-129741789 GGGCAAAGACTGTGGTGGCTGGG - Intergenic
945251726 2:207770032-207770054 GGGGAAAGGCCGAGCCCGCGGGG - Intergenic
946187475 2:217989175-217989197 GGGCAAAGGCTGAGCCCACCAGG + Intronic
946483470 2:220078476-220078498 GGGAAATGGCTGGGCCAGCTGGG + Intergenic
947615600 2:231555026-231555048 GGGCAGAGGCGGAGACAGCTGGG - Intergenic
948806749 2:240456359-240456381 GGGCACAGGAGGAGCCGGCGGGG + Intronic
948854518 2:240723919-240723941 GGGCAGAGGTTGAGCAGGCCAGG + Intronic
1173523786 20:43717138-43717160 GGGCAGAGGTTGAGCAGACTTGG + Intergenic
1173845111 20:46183243-46183265 GGGAAAAGGCTGAGGCAGCAGGG - Intronic
1175246087 20:57582958-57582980 GGGCACAGGCTGAGGGGTCTGGG + Intergenic
1175901490 20:62361585-62361607 GGGCAGCGGCGGAGCCGGCTGGG + Intronic
1180695638 22:17749996-17750018 GGGCTGAGGCTGAGCCCGCCTGG - Intronic
1181339719 22:22168234-22168256 GGGCAAAGACTGAACAGGATGGG - Intergenic
1181354806 22:22291557-22291579 GGGCACAAGCAGAGCAGGCTAGG + Intergenic
1181463913 22:23100656-23100678 GAGCACAGGCTGTGCCGGGTGGG - Intronic
1181678207 22:24471735-24471757 GGCCTAAGGCTGAGCCTGCTGGG + Intergenic
1182025054 22:27111357-27111379 GGTCACAGGCTGAGCAGGATGGG - Intergenic
1182430419 22:30295723-30295745 GGGCCACGGGTGAGCAGGCTGGG - Exonic
1183225678 22:36548511-36548533 GGACAAAGGGTGGGCGGGCTTGG + Intergenic
1183301061 22:37059444-37059466 GGACACAGGCTGAGGCGGGTGGG - Intronic
1184255461 22:43284286-43284308 GGGAACAGCCTGAGTCGGCTTGG - Intronic
950355995 3:12409837-12409859 AGGCAAATGCTGAGCGGGCAGGG - Intronic
953719576 3:45343667-45343689 TGGCAAAGGGTGAGCTGGATTGG + Intergenic
954553337 3:51499876-51499898 GGGCAGCGGCGGAGCCGCCTCGG - Exonic
960871476 3:122254149-122254171 GGGCAAGGGATGAGACAGCTAGG - Exonic
961589934 3:127971419-127971441 GGGAGAAGGCTGAGCCCTCTGGG - Intronic
961809730 3:129514844-129514866 GGGTAAAGGCAGAGCCACCTGGG - Intronic
967943576 3:194784828-194784850 GGGAAAATGCTGAGCCTCCTGGG - Intergenic
968289582 3:197528178-197528200 GGGCAAAGCCTGATCCAGGTGGG + Intronic
968505993 4:971760-971782 GGGCAAAGGCTGCGGGGGCTGGG + Intronic
969229057 4:5817006-5817028 GGGCAAAGGCAGGGCAGGTTGGG + Intronic
999085451 5:148884753-148884775 GAGCAAAGACTGAGTGGGCTGGG - Intergenic
1002108096 5:176890136-176890158 GGACAAAGGCTGATCCGTCTGGG - Intronic
1003823327 6:9924855-9924877 GAGCAAAGGCAGAGCAGGCCAGG + Intronic
1004980438 6:21017371-21017393 CAGCAAAGGCTGTGCTGGCTTGG + Intronic
1008534834 6:52499875-52499897 GGGAGCAGGCTGAGCCGGCGGGG - Exonic
1011193988 6:84763921-84763943 GGGCGACGTCTGGGCCGGCTCGG - Exonic
1015810534 6:137158094-137158116 AGGCAAAGGCTGAGCCTGTGAGG + Intronic
1019144704 6:169969231-169969253 GGGAGAAGGCTGAGCATGCTGGG + Intergenic
1019428247 7:987321-987343 GGGCAAAGGGTGGGCCGCTTGGG - Intronic
1019518897 7:1451854-1451876 TGGCAAGGGCTGTGCAGGCTGGG - Intronic
1022235813 7:28459247-28459269 GGACAAAGGCTGAGACAGGTGGG - Intronic
1022494766 7:30845928-30845950 GAGAAGAGGCTGTGCCGGCTTGG + Intronic
1022510603 7:30932844-30932866 GGGCAAAGGTGGTGCAGGCTGGG + Intergenic
1026631236 7:72039849-72039871 GGGCAATGGAGGAGCCTGCTTGG - Intronic
1027228088 7:76257348-76257370 GGGCACTGTCTGAGCCAGCTTGG + Intronic
1038632778 8:29262485-29262507 GGGCCAAGGCGGTGCAGGCTTGG + Intronic
1039839126 8:41281023-41281045 GGGCCAAGGCTGAGCCCTGTGGG + Intronic
1040520941 8:48175617-48175639 GGGGCAGGGCTGAGCCCGCTGGG + Intergenic
1041256619 8:55984328-55984350 GGGCAGATGCTGAGCCAGCAGGG - Intronic
1042837310 8:73090497-73090519 GGTCCAGGGCTGAGCAGGCTGGG + Intronic
1043804374 8:84652805-84652827 GGACAAATGCTAAGCCGGATAGG - Intronic
1046643226 8:116755704-116755726 AGGCAAAGGCAAAGGCGGCTCGG - Exonic
1047438617 8:124856989-124857011 GGGTACAGGCTGAACAGGCTTGG - Intergenic
1048797288 8:138162726-138162748 GGGCAAAGGCCCAGAAGGCTGGG + Intronic
1049004827 8:139847926-139847948 GGGCACAGGCAGAGGCGGCAGGG - Intronic
1049617105 8:143580432-143580454 GGTCACAGGCTGAGCCGGCTAGG + Intronic
1052640929 9:31165281-31165303 GGGCAATGGCTGAGTATGCTTGG - Intergenic
1053375781 9:37605215-37605237 GGGCACAGGCTGAGTCTGCTGGG - Intronic
1061399380 9:130360085-130360107 GGGCAGAGGCTGAGGCAGCCAGG - Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1186486404 X:9937373-9937395 GGGCTGGGGCTCAGCCGGCTGGG - Exonic
1195964967 X:110421803-110421825 TGGCAAAGGCAGAGCTGGTTTGG - Intronic
1200056523 X:153464211-153464233 GGGCTAAGGCTGGGCTGGGTCGG + Intronic
1201190548 Y:11439397-11439419 GGGCACAAGCTGGGCAGGCTAGG - Intergenic