ID: 1162432332

View in Genome Browser
Species Human (GRCh38)
Location 19:10636522-10636544
Sequence CAGGTCGTCCGGCTTGCGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162432332_1162432339 6 Left 1162432332 19:10636522-10636544 CCCTGCGCAAGCCGGACGACCTG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1162432339 19:10636551-10636573 TTCCCGCTCTTCTCTGCCTTTGG 0: 1
1: 0
2: 1
3: 29
4: 302
1162432332_1162432344 19 Left 1162432332 19:10636522-10636544 CCCTGCGCAAGCCGGACGACCTG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1162432344 19:10636564-10636586 CTGCCTTTGGCCGGGCGCTCAGG 0: 1
1: 0
2: 1
3: 36
4: 407
1162432332_1162432346 22 Left 1162432332 19:10636522-10636544 CCCTGCGCAAGCCGGACGACCTG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1162432346 19:10636567-10636589 CCTTTGGCCGGGCGCTCAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 105
1162432332_1162432343 11 Left 1162432332 19:10636522-10636544 CCCTGCGCAAGCCGGACGACCTG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1162432343 19:10636556-10636578 GCTCTTCTCTGCCTTTGGCCGGG 0: 1
1: 0
2: 4
3: 32
4: 336
1162432332_1162432342 10 Left 1162432332 19:10636522-10636544 CCCTGCGCAAGCCGGACGACCTG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1162432342 19:10636555-10636577 CGCTCTTCTCTGCCTTTGGCCGG 0: 1
1: 0
2: 1
3: 22
4: 250
1162432332_1162432347 23 Left 1162432332 19:10636522-10636544 CCCTGCGCAAGCCGGACGACCTG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1162432347 19:10636568-10636590 CTTTGGCCGGGCGCTCAGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 69
1162432332_1162432348 27 Left 1162432332 19:10636522-10636544 CCCTGCGCAAGCCGGACGACCTG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1162432348 19:10636572-10636594 GGCCGGGCGCTCAGGTGGGCTGG 0: 1
1: 0
2: 1
3: 34
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162432332 Original CRISPR CAGGTCGTCCGGCTTGCGCA GGG (reversed) Exonic
902950962 1:19882572-19882594 CCGCTCGTCCCGCTTGCGCTCGG - Exonic
906116420 1:43360013-43360035 CAGGTCTTCCGGCTGGAGCCAGG - Exonic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
915146689 1:153799856-153799878 CAGGGCGTCCTGCTCGTGCAGGG + Intergenic
915912892 1:159925204-159925226 CAGGGCGTCCGTCTGGAGCAGGG - Intronic
922699647 1:227751291-227751313 CAGGTGGTGGGGCTGGCGCAGGG - Intronic
924787428 1:247211039-247211061 CAGGGCTTCCTGCTTGCGCTGGG + Intergenic
1073888838 10:108072972-108072994 CAGGTAGTCAGGCATGAGCAGGG - Intergenic
1081060030 11:38462402-38462424 CAGGTCTTCGGGCTTGAGGATGG + Intergenic
1083906066 11:65671623-65671645 CAGGTCTTCCAGCTTGCAGATGG + Intergenic
1083950639 11:65953713-65953735 CAGCTCCTCCAGCTTGCGCTGGG - Exonic
1084783081 11:71424114-71424136 CAGGTCGTCTGGCTGGGACAAGG + Intergenic
1086414463 11:86574983-86575005 CAGGTTGTCCAGCCTGGGCAGGG + Intronic
1103703108 12:122858199-122858221 GGGGTCGTCCAGCTTGCTCACGG - Exonic
1106160779 13:27199510-27199532 CAGGGTGTCCAGCTTGCACATGG + Intergenic
1121282850 14:92711707-92711729 CAGGTGGTACTGCTTGTGCAGGG + Exonic
1123048385 14:105529250-105529272 CAGGTCCTCGCGCTTGCGGAAGG - Exonic
1129471662 15:75758837-75758859 CAGGCCGGCCGGCTTGTGGAGGG + Intergenic
1136393941 16:29982801-29982823 CAGGTTGTCCAGCTCCCGCACGG - Exonic
1152099014 17:78290282-78290304 CAGGTGGCCCGGCTTGCCAAAGG + Intergenic
1159872550 18:73775004-73775026 CAGGTCGCCCTGCTTGCTCCTGG + Intergenic
1162432332 19:10636522-10636544 CAGGTCGTCCGGCTTGCGCAGGG - Exonic
1167153862 19:47726178-47726200 CAGGTCGTTGAGCTTGCGCAAGG - Exonic
928436942 2:31260876-31260898 GAGGTCGTTGAGCTTGCGCAGGG - Exonic
948541436 2:238693868-238693890 CAGGTTGTCTGACTTGGGCATGG + Intergenic
1176185336 20:63775361-63775383 GAGCTCGTCCGGGTCGCGCAGGG - Intronic
1002896207 6:1381992-1382014 CAGTTCCTCCGGCTTCCGCGGGG - Intergenic
1006089853 6:31621811-31621833 CCTGTCGTCCGGCTTGCTTAGGG + Intronic
1009930020 6:70165955-70165977 CAGGTGGTCCGGGTTTCCCAGGG - Exonic
1023087494 7:36586036-36586058 CAGATGGTCCGTCTTGCCCAAGG + Intronic
1028753150 7:94405204-94405226 CAGGTCGTCCGGGTTTTCCAGGG - Exonic
1049633395 8:143672094-143672116 CAGGTCCCCCGCCCTGCGCAAGG - Intergenic
1191669228 X:63733796-63733818 CAGGTGGTCTGTCTTGCTCAAGG - Intronic
1197492877 X:127140260-127140282 CAGGTAGTCAGGCATGAGCAGGG + Intergenic