ID: 1162435107

View in Genome Browser
Species Human (GRCh38)
Location 19:10653630-10653652
Sequence ACCCGGGCGCGCATTGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 29}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162435096_1162435107 25 Left 1162435096 19:10653582-10653604 CCAGGGACGCCACACCAAGGCAG 0: 1
1: 0
2: 2
3: 8
4: 161
Right 1162435107 19:10653630-10653652 ACCCGGGCGCGCATTGGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 29
1162435099_1162435107 16 Left 1162435099 19:10653591-10653613 CCACACCAAGGCAGGTCTGCGGG 0: 1
1: 0
2: 2
3: 14
4: 186
Right 1162435107 19:10653630-10653652 ACCCGGGCGCGCATTGGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 29
1162435101_1162435107 11 Left 1162435101 19:10653596-10653618 CCAAGGCAGGTCTGCGGGACGAA 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1162435107 19:10653630-10653652 ACCCGGGCGCGCATTGGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 29
1162435095_1162435107 26 Left 1162435095 19:10653581-10653603 CCCAGGGACGCCACACCAAGGCA 0: 1
1: 0
2: 0
3: 4
4: 127
Right 1162435107 19:10653630-10653652 ACCCGGGCGCGCATTGGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162435107 Original CRISPR ACCCGGGCGCGCATTGGCGC CGG Intergenic