ID: 1162435107

View in Genome Browser
Species Human (GRCh38)
Location 19:10653630-10653652
Sequence ACCCGGGCGCGCATTGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 29}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162435095_1162435107 26 Left 1162435095 19:10653581-10653603 CCCAGGGACGCCACACCAAGGCA 0: 1
1: 0
2: 0
3: 4
4: 127
Right 1162435107 19:10653630-10653652 ACCCGGGCGCGCATTGGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 29
1162435099_1162435107 16 Left 1162435099 19:10653591-10653613 CCACACCAAGGCAGGTCTGCGGG 0: 1
1: 0
2: 2
3: 14
4: 186
Right 1162435107 19:10653630-10653652 ACCCGGGCGCGCATTGGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 29
1162435101_1162435107 11 Left 1162435101 19:10653596-10653618 CCAAGGCAGGTCTGCGGGACGAA 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1162435107 19:10653630-10653652 ACCCGGGCGCGCATTGGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 29
1162435096_1162435107 25 Left 1162435096 19:10653582-10653604 CCAGGGACGCCACACCAAGGCAG 0: 1
1: 0
2: 2
3: 8
4: 161
Right 1162435107 19:10653630-10653652 ACCCGGGCGCGCATTGGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162435107 Original CRISPR ACCCGGGCGCGCATTGGCGC CGG Intergenic
900163017 1:1233304-1233326 ACCCGGCGGCGCCTTGGGGCAGG + Exonic
907489700 1:54801030-54801052 TCCCGGGCGCGCTGTGGGGCCGG + Exonic
1075616125 10:123891847-123891869 ACAGGGGCGCGCAGAGGCGCGGG + Intronic
1077233223 11:1468001-1468023 TCCAGGGCGCGCATTCGTGCCGG - Intergenic
1077360805 11:2139471-2139493 CCGCGGGCGCCCATTGGCGCGGG - Intronic
1081973289 11:47214831-47214853 ACCCGGGCTGGCACTGGCCCTGG + Intronic
1087188680 11:95230692-95230714 CCCCGGGCGCGCACTGGGGGAGG - Intronic
1088401204 11:109423625-109423647 GCCCTGGCACTCATTGGCGCGGG - Exonic
1097019092 12:56007547-56007569 ACCCGGGCGCTCAGAGGCGGCGG - Intergenic
1097848271 12:64388127-64388149 ACCCAGTGGCGCATTGGCCCAGG + Intronic
1106328627 13:28718566-28718588 ACCCGGGCGCGCACGAGCGCAGG - Exonic
1122888858 14:104723612-104723634 GCCCGGGCGCGCTGTGGCTCGGG - Intergenic
1128260444 15:66229278-66229300 GCCCTGGTGCGCATTGGGGCTGG - Intronic
1132301566 15:100779346-100779368 ACTCGGGAGCGCACTGGAGCTGG - Intergenic
1132498867 16:275962-275984 ACCCGGGCGCGGCGCGGCGCGGG - Intronic
1141557530 16:84845883-84845905 ACCTGGGCGCTCACTGGGGCAGG + Exonic
1142262893 16:89050900-89050922 TCCCGGGTGGGCCTTGGCGCAGG - Intergenic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1152729101 17:81961177-81961199 CCCCCGCCGCTCATTGGCGCGGG - Exonic
1158962295 18:62596856-62596878 ACCCGGGCAGGCATCGCCGCAGG - Intergenic
1162123352 19:8485851-8485873 ACCATGGAGCGCATTGGCTCTGG + Exonic
1162435107 19:10653630-10653652 ACCCGGGCGCGCATTGGCGCCGG + Intergenic
1163701824 19:18790049-18790071 AGCCGGGCGCGCAGTGGAGCAGG + Exonic
1168297577 19:55384894-55384916 ACCCGGGCACTCCTTGGGGCAGG - Intergenic
1175561444 20:59933774-59933796 ACCCCGGCGAGCGTTGGCGGGGG - Exonic
1175902802 20:62366706-62366728 ACCCGGGGGCGGCTGGGCGCCGG - Intronic
1180235711 21:46458503-46458525 ACGCGGACGCGCCATGGCGCGGG + Intergenic
1182429010 22:30289371-30289393 ACCCGGGCGCGCACCGGCTGCGG + Exonic
1185343026 22:50299971-50299993 CCCCGGGCGCGCTTTGCCCCTGG - Intronic
962277910 3:134029817-134029839 GGCCGGGCGCGGAGTGGCGCGGG + Exonic
968514684 4:1011275-1011297 ACCCGGGCGCGCGCGGGCGCAGG + Exonic
992796117 5:80256182-80256204 ACCCGGGCTCGCACTTCCGCTGG + Intergenic
1001773412 5:174312019-174312041 ACCCGGGCGCGCGGGGGCGCGGG + Intergenic
1011398777 6:86937623-86937645 ACCCCGGCGGGCACTGGCGCGGG + Exonic
1018134599 6:160767278-160767300 ACCGGGGCCCGCAAAGGCGCGGG - Intergenic
1049665439 8:143840797-143840819 TCCCGGGCCCGCCTCGGCGCCGG + Exonic