ID: 1162437080 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:10667577-10667599 |
Sequence | TATTTGCTCTGAAATATACC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1162437080_1162437084 | 22 | Left | 1162437080 | 19:10667577-10667599 | CCTGGTATATTTCAGAGCAAATA | No data | ||
Right | 1162437084 | 19:10667622-10667644 | AAATTTGTCTTAAATATGTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1162437080 | Original CRISPR | TATTTGCTCTGAAATATACC AGG (reversed) | Intronic | ||