ID: 1162437080

View in Genome Browser
Species Human (GRCh38)
Location 19:10667577-10667599
Sequence TATTTGCTCTGAAATATACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162437080_1162437084 22 Left 1162437080 19:10667577-10667599 CCTGGTATATTTCAGAGCAAATA No data
Right 1162437084 19:10667622-10667644 AAATTTGTCTTAAATATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162437080 Original CRISPR TATTTGCTCTGAAATATACC AGG (reversed) Intronic