ID: 1162439330

View in Genome Browser
Species Human (GRCh38)
Location 19:10682898-10682920
Sequence TCCTATAGGCTACACTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162439318_1162439330 22 Left 1162439318 19:10682853-10682875 CCTCCGAGCCGTGTCGGGGAGGG 0: 1
1: 0
2: 1
3: 5
4: 76
Right 1162439330 19:10682898-10682920 TCCTATAGGCTACACTGGGGTGG 0: 1
1: 0
2: 1
3: 5
4: 59
1162439320_1162439330 19 Left 1162439320 19:10682856-10682878 CCGAGCCGTGTCGGGGAGGGCCT 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1162439330 19:10682898-10682920 TCCTATAGGCTACACTGGGGTGG 0: 1
1: 0
2: 1
3: 5
4: 59
1162439316_1162439330 23 Left 1162439316 19:10682852-10682874 CCCTCCGAGCCGTGTCGGGGAGG 0: 1
1: 0
2: 0
3: 0
4: 51
Right 1162439330 19:10682898-10682920 TCCTATAGGCTACACTGGGGTGG 0: 1
1: 0
2: 1
3: 5
4: 59
1162439321_1162439330 14 Left 1162439321 19:10682861-10682883 CCGTGTCGGGGAGGGCCTTGTGG 0: 1
1: 0
2: 1
3: 46
4: 180
Right 1162439330 19:10682898-10682920 TCCTATAGGCTACACTGGGGTGG 0: 1
1: 0
2: 1
3: 5
4: 59
1162439323_1162439330 -1 Left 1162439323 19:10682876-10682898 CCTTGTGGATGTTGTCCCAGCAT 0: 1
1: 0
2: 0
3: 20
4: 151
Right 1162439330 19:10682898-10682920 TCCTATAGGCTACACTGGGGTGG 0: 1
1: 0
2: 1
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162439330 Original CRISPR TCCTATAGGCTACACTGGGG TGG Intronic
913049761 1:115106964-115106986 TCCTTTAGGCCACAGAGGGGTGG + Intergenic
914855200 1:151345665-151345687 CCCTATAGGCTACCATGGAGAGG + Intronic
918110109 1:181448210-181448232 TTCTAGAGGTTACAATGGGGAGG + Intronic
1063449129 10:6139808-6139830 TCCTATTCACTACCCTGGGGCGG + Intergenic
1070929887 10:80253502-80253524 TCCTACAGGCAACAATGGGTAGG - Intergenic
1072686831 10:97542547-97542569 TCCCATGGGCCACACTGGGCAGG + Intronic
1074979020 10:118604340-118604362 TCCTATATGCTTCCTTGGGGAGG + Intergenic
1080783620 11:35454333-35454355 GCCTACAGGCAACCCTGGGGTGG - Intronic
1081416151 11:42818528-42818550 CCCTATAGACCACACCGGGGTGG + Intergenic
1089399739 11:118157509-118157531 TACTATAGGCCACATTGGGGTGG + Intergenic
1091399079 12:171928-171950 TCCCATAGGTGGCACTGGGGGGG - Intronic
1114621127 14:24096884-24096906 TCCTATAGGCTTAACTGGCATGG + Exonic
1115756962 14:36538065-36538087 TCCCATAGCTTACACTGGGCTGG - Intergenic
1121501824 14:94444120-94444142 TCCCATAGGCAGCACTTGGGTGG + Intronic
1124468799 15:29964875-29964897 TCCTACAGGCTCCACTGATGTGG + Intronic
1125002774 15:34788580-34788602 TGCTATAGGATACAATGGGGTGG + Exonic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1135178381 16:20251506-20251528 TCCTATTGGCTACATTGGGGGGG - Intergenic
1135879458 16:26240179-26240201 TGCTATAGCCTACAGTGGTGAGG - Intergenic
1142799075 17:2333459-2333481 CCCTATAGGATAGAGTGGGGTGG - Intronic
1151230730 17:72683373-72683395 TCCTATAGGCTAGAGTGCAGTGG + Intronic
1155698453 18:28713073-28713095 TCTTAAAGTCTACATTGGGGAGG + Intergenic
1155811073 18:30235790-30235812 TCCTATAGGCTAAACTCCTGGGG - Intergenic
1162439330 19:10682898-10682920 TCCTATAGGCTACACTGGGGTGG + Intronic
1162557137 19:11394267-11394289 TCCAATGGGCTACAGTTGGGTGG + Intronic
1166049225 19:40248150-40248172 TCCTGCAGGCAACACTGGGCAGG + Intronic
930307037 2:49687463-49687485 CCCTATGTTCTACACTGGGGAGG - Intergenic
933074075 2:77900612-77900634 TCCTAAAGGGTAAAGTGGGGAGG - Intergenic
937303597 2:120857736-120857758 CCCTGTGGGCTACACTGAGGTGG - Intronic
942905058 2:181170266-181170288 TCCTGTAGACTACACAGAGGTGG - Intergenic
944534354 2:200695003-200695025 TCCTCTTGGCGACACAGGGGAGG - Intergenic
1170905512 20:20512572-20512594 TCCTCGGGGCTCCACTGGGGAGG + Exonic
1173027617 20:39323996-39324018 TCCTATAAGGTACATTGGTGAGG + Intergenic
1175080819 20:56418985-56419007 TCCTATAGAGCACACTTGGGGGG + Intronic
1175255860 20:57646836-57646858 TCCTACTGGCTGCACTGGGGTGG + Intergenic
1176378951 21:6102154-6102176 TCCTGCAGGCTGCACAGGGGGGG - Intergenic
1179744523 21:43436083-43436105 TCCTGCAGGCTGCACAGGGGGGG + Intergenic
1181372723 22:22431236-22431258 TCCTCTAGGATTCCCTGGGGAGG - Intergenic
1183930647 22:41234237-41234259 TCCTATAAGCCACACTGTGCTGG - Intronic
1184755421 22:46513037-46513059 TCCTATTCACTCCACTGGGGAGG - Intronic
961072194 3:123943424-123943446 TCCTATGGCCTACAATGGGGAGG - Intronic
966640445 3:182183712-182183734 TCCTTGTGGCCACACTGGGGAGG - Intergenic
967529713 3:190534472-190534494 TCCTATAGGCAGCACTGGATCGG - Intronic
970504213 4:16710617-16710639 TCCTGTTGACTACACAGGGGTGG - Intronic
996801715 5:127410712-127410734 GCCTCTAGGCTACTCTGGGCAGG + Intronic
1003893598 6:10585690-10585712 TCCTAGAGGCTGGACTGGGCTGG + Intronic
1005821061 6:29599582-29599604 TCAGATAGGGTACAGTGGGGAGG - Intronic
1007270316 6:40631055-40631077 TCCTAGAGGCTTCACAGTGGGGG + Intergenic
1009286657 6:61827260-61827282 TCCTCTAGGTTACAGTTGGGAGG + Intronic
1009437825 6:63637000-63637022 TCCTAGAGACTAGATTGGGGTGG + Intronic
1011692829 6:89886119-89886141 TCCTGTACGCTACTCTGAGGAGG + Intergenic
1016458055 6:144251677-144251699 TCCTAAAGGCAACACTGCAGAGG + Intergenic
1030029535 7:105356178-105356200 TCCTATAAGCTTCAATGGAGAGG - Intronic
1034315491 7:150127350-150127372 TCCTGTGGGCAAGACTGGGGAGG - Intergenic
1038410891 8:27359041-27359063 TCCTAATGGCTAAAATGGGGAGG - Intronic
1038857506 8:31349568-31349590 CCCTACAAGCTTCACTGGGGTGG - Intergenic
1049865350 8:144932084-144932106 TCAAATAGTCCACACTGGGGAGG - Exonic
1050405459 9:5304311-5304333 TCCCATTGGTTACTCTGGGGCGG - Intronic
1050408761 9:5339477-5339499 TCCCATTGGTTACTCTGGGGCGG - Intronic
1051094399 9:13449361-13449383 TACTACCTGCTACACTGGGGTGG + Intergenic
1051231827 9:14963263-14963285 TTCCCTAGGCCACACTGGGGAGG + Intergenic
1058856066 9:109063608-109063630 TCCTACAGGCAAAACTAGGGAGG + Intronic
1061359423 9:130131666-130131688 GCCTATAGGGAACAATGGGGAGG - Intronic
1192550366 X:72048674-72048696 TCCTGTAGGCAACACCAGGGCGG + Intergenic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1201617245 Y:15914215-15914237 TTCTATAGGCCAAAGTGGGGAGG - Intergenic