ID: 1162440370

View in Genome Browser
Species Human (GRCh38)
Location 19:10688606-10688628
Sequence TCCTACAACCCAGGGTCACA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162440362_1162440370 14 Left 1162440362 19:10688569-10688591 CCGAAGCGGCGGGAACAGCTACG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1162440370 19:10688606-10688628 TCCTACAACCCAGGGTCACACGG 0: 1
1: 0
2: 2
3: 15
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162440370 Original CRISPR TCCTACAACCCAGGGTCACA CGG Exonic
900639410 1:3681613-3681635 TCCTGCACCCCAGGGCCACAGGG - Intronic
901177878 1:7317967-7317989 TCCTACCACCCAGGCTCTGATGG + Intronic
901672139 1:10862146-10862168 CCCTGAATCCCAGGGTCACAGGG - Intergenic
903350507 1:22713691-22713713 TCCCAGAACCCAGAGCCACATGG + Intronic
905982469 1:42241843-42241865 TCACACTACCCAGGGTCTCAAGG + Intronic
907556945 1:55352429-55352451 ACCTCCAGCCCAGAGTCACAGGG - Intergenic
909881802 1:80889242-80889264 TTCTAGAACCTAGGGTCACTGGG - Intergenic
910371461 1:86520606-86520628 TCCTACAGCTCAGGTTCAAAGGG - Intergenic
911448408 1:98031332-98031354 TCTTACAATCCAGAGTTACATGG + Intergenic
912391205 1:109304448-109304470 TCCTCCACCTCAGGGTCCCAGGG + Intronic
916977720 1:170099465-170099487 CCATACAACACAGGGCCACATGG - Intergenic
917122164 1:171654397-171654419 TCCTAGAACCCAGGATCACGTGG + Intergenic
918220219 1:182429936-182429958 TTCTTCATTCCAGGGTCACAAGG - Intergenic
919384201 1:196898239-196898261 TCCTACAACCCAGGGAAACAGGG + Intronic
1064092623 10:12397603-12397625 ACCTAGGCCCCAGGGTCACAGGG - Intronic
1064424950 10:15222358-15222380 TCCTACACACCTGGGCCACACGG + Intronic
1070765025 10:79051431-79051453 TCCTGCAACACAGGGTCACGTGG + Intergenic
1072789760 10:98309631-98309653 CCAAACAACCCAAGGTCACATGG - Intergenic
1074341056 10:112630490-112630512 ACCTACAACACAGGGTCATTGGG - Intronic
1076107345 10:127834267-127834289 TCCTCCTGCCCAGGGACACAGGG + Intergenic
1078068500 11:8093570-8093592 TCCTACACCCCAGCCTCCCATGG + Intronic
1085867281 11:80309137-80309159 TCTTTCAACCCAGTGCCACAAGG - Intergenic
1091040621 11:132277379-132277401 TCCTACAATCCTTGGTCACCTGG - Intronic
1100285010 12:93157031-93157053 TCCTACAAAGCAGAGTCACTGGG + Intergenic
1105611999 13:21976912-21976934 TCCGAAGACCCAGGGACACAGGG - Intergenic
1106589797 13:31089521-31089543 TCCTACAAGCTGGGGACACAGGG - Intergenic
1107824551 13:44316528-44316550 TCCTACCTCCTAGTGTCACATGG - Intergenic
1112184482 13:97114745-97114767 TCCTGCAACCCAAGTTCAAAGGG - Intergenic
1113151951 13:107273842-107273864 TCCAACCTCCCAGGGTCCCAGGG + Intronic
1114449868 14:22818461-22818483 CCCTAAGACCCAGGGTCTCAGGG - Intronic
1118006136 14:61565507-61565529 TCCAACCACCCTGGGTGACAGGG - Intronic
1122603965 14:102935891-102935913 TCCTACAACCCAGCCACAAAAGG + Intronic
1123213601 14:106785055-106785077 TCCTTCAACCCAGGGTGCCCTGG - Intergenic
1124206368 15:27724320-27724342 ACCTACAAGCCAGGGGCAAAAGG - Intergenic
1124696313 15:31867529-31867551 TACTACCACACAGGGTCCCAGGG + Intronic
1125468144 15:39975467-39975489 TCCTGCCACCCATGGCCACATGG + Intronic
1129781255 15:78273009-78273031 TCATACAACTAAGGGTCATATGG + Intronic
1130378231 15:83349503-83349525 GGCTAGAACGCAGGGTCACAGGG + Intergenic
1130577080 15:85102478-85102500 TCCTACACCACAAGTTCACAGGG + Intronic
1131446110 15:92499354-92499376 TCCTACAAGCCAGGGAGAGAGGG + Intronic
1133036245 16:3035882-3035904 TCCCAGAACCCAGGTTCTCAGGG + Intronic
1133425226 16:5682572-5682594 TCCTTCCTCCCAGGTTCACAAGG - Intergenic
1134638704 16:15811945-15811967 TCCTACACCCCAGGGACCCATGG + Intronic
1134759156 16:16698240-16698262 TCTTCCAACCCAGGGGCACAGGG - Intergenic
1134986917 16:18660944-18660966 TCTTCCAACCCAGGGGCACAGGG + Intergenic
1138353950 16:56362959-56362981 TCCTTCGACGCAGGGTCACGGGG + Exonic
1141424329 16:83935537-83935559 TGCAGCAACCCAGGGTCACAGGG + Intronic
1143641997 17:8204489-8204511 TCCCACAGCCCAGGGGCACTGGG - Intergenic
1145019203 17:19416500-19416522 TCCTACAATCCAGGGTCATCGGG - Exonic
1146504597 17:33394148-33394170 TGCTACATCCCAGGGTGACAGGG + Intronic
1149307675 17:55364808-55364830 TCCTACAGCTTAGGGTCAGATGG - Intergenic
1151090981 17:71440031-71440053 TCAAACAACCAAGGGTCAGAGGG + Intergenic
1152991951 18:371695-371717 TCCTACAATCAACTGTCACAAGG - Intronic
1157214040 18:45767422-45767444 TCCTACAACCCCTGGCAACAAGG + Intergenic
1157356721 18:46941952-46941974 TCCTACCAGCTAGGGTTACAGGG + Intronic
1158207698 18:55011918-55011940 TCCTAAAACTCAGGGGCATATGG - Intergenic
1158938271 18:62384626-62384648 TCCCACAGCCCGGGGCCACAGGG - Intronic
1160269171 18:77368356-77368378 TCTTACAACTCAGGGCAACATGG - Intergenic
1160341478 18:78092866-78092888 TCCTAGAGCCCAAAGTCACATGG - Intergenic
1162180951 19:8868317-8868339 TCCTCCAACCCAGAGGGACATGG + Intronic
1162372501 19:10287848-10287870 TCCTAGTCCCCAGGGTTACAGGG - Intronic
1162440370 19:10688606-10688628 TCCTACAACCCAGGGTCACACGG + Exonic
1167456484 19:49599005-49599027 TCCTACATTCCTGGGTCTCATGG + Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
927823622 2:26291415-26291437 TCCTTCAACCTAAGGTCACAGGG - Intergenic
930395652 2:50820641-50820663 GTCTACATCCCAGGGTCACCTGG - Intronic
931117780 2:59183094-59183116 TCCTACAACACAGGGGCAATAGG + Intergenic
935483155 2:103618243-103618265 TCCTTTAACCCAGGGGCATATGG - Intergenic
937024381 2:118685773-118685795 TCCTCCAAACAAGTGTCACATGG + Intergenic
937274709 2:120676245-120676267 TCCAACAACTCAGTGACACAGGG + Intergenic
937985085 2:127634787-127634809 TCCCACAACCCAGGGACACACGG - Intronic
943533057 2:189111498-189111520 TCCTTCATCCCAGGCCCACATGG + Intronic
944202181 2:197119489-197119511 TCCTACACCTCAGGCTCCCAAGG + Intronic
946783599 2:223219150-223219172 ACCTTCAAGGCAGGGTCACAGGG - Intergenic
1170545940 20:17435950-17435972 TCCTAAGACACAGGGGCACAGGG - Intronic
1171953581 20:31442131-31442153 ACTTACAACCCAGGGTGACAAGG + Intronic
1172184255 20:33021428-33021450 TCCCACCTCCCAGGCTCACAGGG + Intronic
1173029208 20:39339091-39339113 TCCTACTACCCAAGGTTACAGGG + Intergenic
1173441070 20:43076784-43076806 TCCTACAACCAAAGGTCCCTGGG + Intronic
1174988968 20:55487929-55487951 TTCTACAACCCAGGACCATATGG - Intergenic
1179565188 21:42243162-42243184 TCTGACCACCCAGGTTCACAAGG - Intronic
1180927964 22:19569190-19569212 TCCAAGATCCCAGGGTCTCATGG + Intergenic
1181521619 22:23451786-23451808 TTCTACAAGCGAGGTTCACAGGG + Intergenic
1182041983 22:27245261-27245283 CCCTGTAACCCAAGGTCACACGG + Intergenic
1183544919 22:38450336-38450358 TCTTTCAGCCCAGGTTCACATGG + Intronic
1183936244 22:41264089-41264111 TCCTCCAACCCTGGGTCTAAAGG + Intronic
1184171771 22:42764324-42764346 CCCTACACCCCAGAGACACAGGG + Intergenic
949274871 3:2267797-2267819 TTCTACCACCAAGAGTCACAGGG + Intronic
949946460 3:9193602-9193624 AACTCCAACCCAGTGTCACAGGG - Intronic
950033651 3:9868519-9868541 ACCTGCCACCCAGGGTCATAAGG + Intronic
950055290 3:10019314-10019336 ACCTGCCACCCAGGGTCATAAGG + Intergenic
950143015 3:10628158-10628180 CCCGACAACCCAGGGCCTCAGGG + Intronic
951850049 3:27129302-27129324 TCCTTCAAACTAGGGACACAGGG + Intronic
951938532 3:28051439-28051461 ACCTAGACCCCAGGGTAACATGG + Intergenic
953767669 3:45756252-45756274 TCTTACAACTCAGGGCCACCTGG - Exonic
956063777 3:65375502-65375524 TGCAGCAACACAGGGTCACAGGG + Intronic
956088158 3:65635614-65635636 TCCTAAAACCCTGGATTACAAGG - Intronic
961831463 3:129625189-129625211 TCCCAAAACACAGGGTCACAGGG + Intergenic
971498101 4:27289182-27289204 TCCTAAAACCCAGTGACTCAAGG + Intergenic
976492985 4:85693511-85693533 TGCTACAGCCCTGGGGCACAGGG + Intronic
980668806 4:135975308-135975330 TTCTGCATCCCAGGGACACAGGG - Intergenic
984770463 4:183432788-183432810 ACCTCCAACCCTGGGCCACACGG - Intergenic
985387330 4:189461521-189461543 TCCTACAACCCAGGCACCCATGG - Intergenic
985827659 5:2204939-2204961 TCCTTCTACCCAGGCCCACAGGG - Intergenic
986215613 5:5716348-5716370 GCCTACAACCCCCGGACACAAGG + Intergenic
990681391 5:58248513-58248535 TCCTCCAACCCATAGTCACTAGG + Intergenic
992218841 5:74551736-74551758 TCCTAGAGTCCTGGGTCACAGGG - Intergenic
995951204 5:117716105-117716127 ACCTGCAACACAGGGTGACAAGG + Intergenic
1005609288 6:27508225-27508247 TCCTACAACCCAGACACAAATGG - Intergenic
1006941039 6:37752565-37752587 TCCTACAGCCCAAGGTCTCTGGG - Intergenic
1007627623 6:43255232-43255254 TCCTCCAGCCCAGGGTCTCTGGG - Intronic
1009604328 6:65847911-65847933 TCCTGTAACACAGGGGCACACGG - Intergenic
1010478620 6:76321279-76321301 TCCCACAACACAGGGACACCTGG - Intergenic
1012935484 6:105363527-105363549 TGTTACACCCCAGGGGCACAAGG + Intronic
1014580695 6:123133723-123133745 TATTACAACCCAGTTTCACAGGG - Intergenic
1018896834 6:168025278-168025300 GCCTCCAACCGAGGGACACAGGG - Intronic
1019589719 7:1824697-1824719 TTCTACAAGCGAGGTTCACAGGG - Intronic
1019656931 7:2200909-2200931 TCCTGGAACCCACGGTCACTCGG - Intronic
1022469396 7:30672984-30673006 TGCTGAAACACAGGGTCACAGGG - Intronic
1024780388 7:52841079-52841101 TCCTACAACCCCAGGTCCCCTGG - Intergenic
1025238365 7:57250615-57250637 GCCATCAACCCAGGGTCACTGGG - Intergenic
1026125725 7:67577800-67577822 GCCTACAACCCAGGGAAAGAAGG + Intergenic
1035106397 7:156445106-156445128 TCCTCACACCCAGGGTCACCGGG + Intergenic
1035231196 7:157467030-157467052 TCCTGCCACCCAGCGGCACAAGG + Intergenic
1038642306 8:29338200-29338222 ACCTTCAACCCAGGCTTACAGGG + Intronic
1041915841 8:63137973-63137995 TGTTACAGCCCAGGGGCACATGG - Intergenic
1042370787 8:67988491-67988513 TCCTACAACTGAGAGTCCCATGG + Intronic
1047492586 8:125386924-125386946 TGCTACAGCCCAGGCTCACCAGG - Intergenic
1049132765 8:140862850-140862872 TTCTACAGACCAGGGCCACAGGG - Intronic
1051534463 9:18141419-18141441 TTCTAGAACACAGAGTCACAGGG + Intergenic
1052278183 9:26702433-26702455 TTCTACATCCCCAGGTCACATGG - Intergenic
1054907321 9:70422195-70422217 TCCTCCACCCCACTGTCACATGG + Intergenic
1057110830 9:92469420-92469442 TCCTCAATCCCAGGGTGACAGGG + Intronic
1057296899 9:93851659-93851681 TCCAACCACCCTGGGCCACAGGG - Intergenic
1058002250 9:99878009-99878031 CCCTATAAGCCAGGGTCCCAAGG - Intergenic
1059165831 9:112075659-112075681 TGCTACAGCCCAGGGGCTCAAGG + Intronic
1060549310 9:124477644-124477666 TCCCACAACCCGGGTTCACGCGG - Intronic
1060847146 9:126846624-126846646 TACTACAACCCAGCTTGACAGGG + Intergenic
1061389853 9:130311415-130311437 TCCTTCAACACAGGGTCACCAGG + Intronic
1189916463 X:45860537-45860559 TTCTCTAACCCAGGGTCCCAGGG + Intergenic
1194562240 X:95436853-95436875 GGCTGCAACCCAGGGTCTCATGG - Intergenic
1194689286 X:96963204-96963226 TCCTACATCCCAGGAACACGTGG - Intronic
1195737124 X:108023734-108023756 TCATGCCACACAGGGTCACATGG + Intergenic
1196951666 X:120931238-120931260 GCCTAGAACCCTGGGACACACGG + Intronic
1196952350 X:120936099-120936121 GCCTAGAACCCTGGGACACACGG + Intronic
1196953035 X:120940960-120940982 GCCTAGAACCCTGGGACACACGG + Intronic
1196953720 X:120945820-120945842 GCCTAGAACCCTGGGACACACGG + Intronic
1196954405 X:120950681-120950703 GCCTAGAACCCTGGGACACACGG + Intronic
1196955088 X:120955541-120955563 GCCTAGAACCCTGGGACACACGG + Intronic
1196955776 X:120960424-120960446 GCCTAGAACCCTGGGACACACGG + Intronic
1196956457 X:120965285-120965307 GCCTAGAACCCTGGGACACACGG + Intronic
1196957139 X:120970145-120970167 GCCTAGAACCCTGGGACACACGG + Intronic
1196957821 X:120975005-120975027 GCCTAGAACCCTGGGACACACGG + Intronic
1196958503 X:120979865-120979887 GCCTAGAACCCTGGGACACACGG + Intronic
1196959184 X:120984725-120984747 GCCTAGAACCCTGGGACACACGG + Intronic
1198095508 X:133376289-133376311 CCCTGCCACCCAGGGCCACAGGG + Intronic
1199686627 X:150270937-150270959 TCCAACAACCCAGGGAGAGAAGG + Intergenic