ID: 1162440527

View in Genome Browser
Species Human (GRCh38)
Location 19:10689314-10689336
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 21}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162440527 Original CRISPR TAGAAATCTCCGCCCCGCGG GGG (reversed) Exonic