ID: 1162440603

View in Genome Browser
Species Human (GRCh38)
Location 19:10689913-10689935
Sequence CACGCTGCTTTCCCAAGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162440603_1162440615 22 Left 1162440603 19:10689913-10689935 CCTGCTCTTGGGAAAGCAGCGTG 0: 1
1: 0
2: 2
3: 9
4: 174
Right 1162440615 19:10689958-10689980 CCTTAGAGAGGGTCCAGTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 92
1162440603_1162440611 11 Left 1162440603 19:10689913-10689935 CCTGCTCTTGGGAAAGCAGCGTG 0: 1
1: 0
2: 2
3: 9
4: 174
Right 1162440611 19:10689947-10689969 TGGTCCCTGGTCCTTAGAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 150
1162440603_1162440607 -9 Left 1162440603 19:10689913-10689935 CCTGCTCTTGGGAAAGCAGCGTG 0: 1
1: 0
2: 2
3: 9
4: 174
Right 1162440607 19:10689927-10689949 AGCAGCGTGGGCCATCAGGATGG 0: 1
1: 0
2: 1
3: 35
4: 190
1162440603_1162440608 -2 Left 1162440603 19:10689913-10689935 CCTGCTCTTGGGAAAGCAGCGTG 0: 1
1: 0
2: 2
3: 9
4: 174
Right 1162440608 19:10689934-10689956 TGGGCCATCAGGATGGTCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 184
1162440603_1162440610 10 Left 1162440603 19:10689913-10689935 CCTGCTCTTGGGAAAGCAGCGTG 0: 1
1: 0
2: 2
3: 9
4: 174
Right 1162440610 19:10689946-10689968 ATGGTCCCTGGTCCTTAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162440603 Original CRISPR CACGCTGCTTTCCCAAGAGC AGG (reversed) Exonic
900099234 1:954039-954061 CACGAAGCTTCCCCCAGAGCGGG + Exonic
900680416 1:3913279-3913301 CAGGCTGCTTCCCACAGAGCAGG - Intergenic
901041797 1:6368533-6368555 CATGCTGCTTCCCCACCAGCAGG + Intronic
901071895 1:6524587-6524609 AATGGAGCTTTCCCAAGAGCTGG + Exonic
901644693 1:10710099-10710121 CACCTTGCTCTCCCAAGACCTGG + Intronic
903640510 1:24856766-24856788 CATGCTGCCTTTCCAAGAGGTGG - Intergenic
904494613 1:30879589-30879611 CAGGCTGCTTGCCAGAGAGCTGG - Intronic
904593478 1:31628288-31628310 CACCCCGCTTTACCCAGAGCAGG + Intronic
905235280 1:36542223-36542245 CACCCAGCTTTCCCAGGGGCTGG - Intergenic
906432989 1:45770806-45770828 CCATCTGCTTTCCCAAGATCTGG - Intergenic
907793945 1:57695648-57695670 CACTCTGCCTCCCCAAGTGCTGG - Intronic
908108915 1:60875190-60875212 GACTCTGCTTCCCCCAGAGCAGG + Intronic
910832352 1:91473658-91473680 ATCGCTGCATTCCCAAGAGGGGG + Intergenic
913381095 1:118210899-118210921 AACGCTGCTCTCACCAGAGCAGG - Intergenic
916217428 1:162409423-162409445 CACCCTCCTTTTCCAAAAGCTGG + Intronic
917334328 1:173912761-173912783 CACCCTGCTTTCCCAACACATGG + Intronic
918181007 1:182086073-182086095 CCTGCTGCTTACCCAAGAGTTGG - Intergenic
919932538 1:202230709-202230731 CAGGTTTCTTTCCCCAGAGCTGG + Intronic
922537276 1:226390526-226390548 CAGGCTGCTTTGTCAAGAACAGG - Exonic
922933484 1:229407655-229407677 CAGACTGCTTTCCCCAAAGCAGG - Intergenic
924920049 1:248619443-248619465 CAGGCTGCTTGCCCCAGAGATGG - Intergenic
1063083317 10:2789561-2789583 CACACAGCTTTCCCCAGAGAGGG + Intergenic
1063688485 10:8260893-8260915 CAACCTGTTTTCCCAAGAACAGG - Intergenic
1065827980 10:29589183-29589205 AACGCTGCTTTCCACAGAGCTGG - Intronic
1065920189 10:30386601-30386623 CCCCCTGCTTTCTCAAAAGCAGG - Intergenic
1066656148 10:37701325-37701347 GATGCTGCTTTCCCAACAGCTGG + Intergenic
1067040636 10:42951581-42951603 GATGCTGCTTTCCCAACAGCTGG + Intergenic
1069568012 10:69476766-69476788 TCTGCTGCTTTCTCAAGAGCTGG + Intronic
1070546932 10:77459730-77459752 CACTGTGCTATGCCAAGAGCGGG - Intronic
1070758319 10:79006985-79007007 CGCGCAGCTTTCCCAAGTCCTGG - Intergenic
1071123566 10:82308869-82308891 CACGCTGCTTTCACTATATCAGG - Intronic
1072797596 10:98367865-98367887 CACGCTGCCGTAACAAGAGCGGG + Intergenic
1072805278 10:98420086-98420108 CACGCTGCTGTTCCAGGAGGGGG - Exonic
1072828606 10:98633818-98633840 GAAGATCCTTTCCCAAGAGCAGG - Intronic
1075761225 10:124858460-124858482 CACGCTGCCTCCCAAAGTGCTGG - Intergenic
1076533041 10:131158266-131158288 TAAGACGCTTTCCCAAGAGCAGG + Intronic
1081937958 11:46918024-46918046 CTCGCTGCTCTTTCAAGAGCGGG - Intronic
1083714308 11:64567085-64567107 CAGGCTGCTCTCCCCAGAGAAGG + Intronic
1084375475 11:68773980-68774002 CATGCTCCCTTCCCAAGCGCTGG + Intronic
1095825817 12:46530430-46530452 CACGCTGCTCCCCCACAAGCAGG - Intergenic
1098700512 12:73618727-73618749 CAACCTACTTTCCAAAGAGCAGG - Intergenic
1101570254 12:105947054-105947076 CATGCTGCTTTCCAAAGACAAGG + Intergenic
1102937098 12:116906757-116906779 CTCCCTGTTCTCCCAAGAGCTGG + Intergenic
1103153955 12:118667470-118667492 CACCAGGGTTTCCCAAGAGCAGG - Intergenic
1104681500 12:130755109-130755131 GAGGCTGCTTTCTCAAGGGCAGG - Intergenic
1111899813 13:94187055-94187077 AAGGCTGCTATTCCAAGAGCAGG - Intronic
1112361409 13:98722033-98722055 CACGCTGCATTCCTGTGAGCTGG - Intronic
1112997165 13:105587911-105587933 CATGCTGCTTTCAGAAGAGAAGG - Intergenic
1113520510 13:110937238-110937260 CAGGCTGCTTTGTCAAGAACAGG + Intergenic
1113948294 13:114057339-114057361 CAAGCTTCATTCCCACGAGCTGG + Intronic
1115798795 14:36969264-36969286 TGAGCTGCTTTTCCAAGAGCGGG + Intronic
1115894688 14:38073170-38073192 CACCTGGCTTTCCCCAGAGCAGG - Intergenic
1117391012 14:55262839-55262861 CACACTGATTACCCTAGAGCAGG + Intergenic
1119229629 14:72970068-72970090 CACTCGGCTTTCCCAAAAGGCGG - Exonic
1119782518 14:77286565-77286587 TAGGCTGCTTTTCCCAGAGCAGG + Intronic
1120836835 14:89046530-89046552 CACACTGCTGTCCCCAGAACTGG + Intergenic
1122132319 14:99611885-99611907 CAAAGTGCTTTCCAAAGAGCTGG + Intergenic
1124464352 15:29923085-29923107 CACTCTGCCTTCCCAAAAGCTGG - Intronic
1125024643 15:35018541-35018563 ACCTCTGCTTTCCAAAGAGCTGG - Intergenic
1126431312 15:48587985-48588007 GATGCTGCTTTCTGAAGAGCTGG + Intronic
1126448726 15:48781686-48781708 TACGCTGGTTTGCCAAGAACAGG + Intronic
1128375854 15:67075325-67075347 CACTCTGCCTTCCCATGGGCTGG - Intronic
1131149143 15:90036069-90036091 CAAGCAGCTTTCTCAAGAGCTGG + Intronic
1132282482 15:100632288-100632310 CAGGCTGCTTTCCTGAGTGCAGG + Intronic
1133260565 16:4547037-4547059 GCCGCTGCCTTCCTAAGAGCTGG + Intergenic
1137432415 16:48428814-48428836 CATGCTCCTTTCCCAAGTGCTGG - Intronic
1139752611 16:69118900-69118922 CCAGCTGCTTTCCCCAGACCAGG - Exonic
1141205959 16:81933335-81933357 GCCGCTGGTTTCCCAAGAGTGGG - Intronic
1145433296 17:22999172-22999194 CACGTTGCTTTTCATAGAGCAGG + Intergenic
1145437512 17:23057458-23057480 CACGTTGCTTTTCATAGAGCAGG + Intergenic
1146258571 17:31406087-31406109 CACCCTGCTTGCACCAGAGCAGG - Intronic
1147925127 17:43941335-43941357 TGCCCTGTTTTCCCAAGAGCAGG + Intronic
1151942008 17:77298595-77298617 CAGGTTGCTTTCACAAGTGCAGG + Intronic
1152548750 17:81018621-81018643 TACGCTGCGTTCACAAAAGCAGG + Intergenic
1152926301 17:83089278-83089300 CACGCTGCTTTTAGAGGAGCCGG - Intronic
1153019372 18:612767-612789 CACGCTGCGTTCCAAAGGGAGGG - Intronic
1156378486 18:36535333-36535355 CATGCTGGTATCCCAAGGGCTGG + Intronic
1160483188 18:79261705-79261727 GACGCTACCTTGCCAAGAGCAGG - Intronic
1162440603 19:10689913-10689935 CACGCTGCTTTCCCAAGAGCAGG - Exonic
1162726294 19:12691389-12691411 CACTGTGCTGTCCCAGGAGCCGG + Exonic
1163182577 19:15614948-15614970 CACCCTGCCTTTCCAAGACCAGG - Intergenic
925112817 2:1351216-1351238 AAAGCAGCTTTCCAAAGAGCAGG + Intronic
925352176 2:3209053-3209075 CACCCTGCCTTCCCACCAGCAGG - Intronic
927254109 2:21024971-21024993 GAAGCAGCTTTCCCAGGAGCTGG + Exonic
928217850 2:29377226-29377248 CACCCTGGCTTCCCAAGTGCTGG - Intronic
934612460 2:95751401-95751423 CATGCTCCTTCCCCAAGAGGAGG - Intergenic
934841692 2:97628043-97628065 CATGCTCCTTCCCCAAGAGGAGG + Intergenic
935742193 2:106159498-106159520 CACACTGATGTCCCAGGAGCAGG + Intronic
937687702 2:124716862-124716884 CAGGATGATTTCCCAAGAGATGG - Intronic
938303136 2:130230104-130230126 CACGGAGCTTCCCCCAGAGCAGG - Intergenic
938972175 2:136442640-136442662 CTCTCTGCTTTCCCAAGATAGGG + Intergenic
939475944 2:142686577-142686599 CACCCTGCTTCCCAAAGTGCTGG + Intergenic
939603497 2:144223415-144223437 CATGGTGCTTTCCTAAGAGGAGG - Intronic
940938191 2:159524169-159524191 CACGTTGGTCTCCCAAGAGTTGG - Intronic
942089997 2:172480521-172480543 CGCCCTGTGTTCCCAAGAGCAGG + Intronic
942287823 2:174438411-174438433 TATGCTTCCTTCCCAAGAGCTGG + Intronic
943169174 2:184373808-184373830 CTAGATGCTTTTCCAAGAGCAGG + Intergenic
945280414 2:208030508-208030530 CACTCTGCTTCCCAAAGTGCTGG + Intergenic
947134144 2:226960146-226960168 CAAGCTGTTTTCCAAAGTGCTGG + Intronic
947945860 2:234101673-234101695 CACGCTCTTTGCCCCAGAGCCGG - Intergenic
948111592 2:235460606-235460628 CACTCAGCTCTCCCAATAGCTGG - Intergenic
948569809 2:238910839-238910861 CACGCTTCTGTATCAAGAGCGGG - Intergenic
948901373 2:240958409-240958431 ATGGCTCCTTTCCCAAGAGCAGG + Intronic
1168889167 20:1282938-1282960 CACTCCCCTTTCCCGAGAGCAGG - Intronic
1171145222 20:22775403-22775425 AATGCTGCTTCCCAAAGAGCAGG + Intergenic
1172591165 20:36119226-36119248 CACCCTGCTCTCCCCAGGGCTGG - Intronic
1173079980 20:39856724-39856746 CATGCTGATCTCCCAAGACCAGG + Intergenic
1173205001 20:40985916-40985938 CCCTCTGCTCTCCCAAGAGAGGG + Intergenic
1175587027 20:60149254-60149276 CATGCTCCTCTCCCAAGTGCTGG + Intergenic
1175769710 20:61616051-61616073 CACTCTGAGTTCCCAAGGGCAGG - Intronic
1176022451 20:62968848-62968870 CACCCAGCTTTCCCAAGATGTGG + Exonic
1176235048 20:64050031-64050053 GAGGCTGCCTTCCCAACAGCCGG + Intronic
1183178977 22:36245706-36245728 CACACTGCTTTCCCAGGGTCAGG - Intergenic
1185011940 22:48319355-48319377 AGAGCTGCCTTCCCAAGAGCCGG + Intergenic
1185065754 22:48631002-48631024 CACGCTGCATTCCAGAGCGCCGG - Intronic
950072204 3:10161692-10161714 CACGCTGCTTGCGGAAGAGAAGG + Intergenic
950494592 3:13326074-13326096 CACGCTGCCTGCCCCAGTGCCGG + Intronic
950612970 3:14137867-14137889 AACGCTACATTTCCAAGAGCAGG - Intronic
951822446 3:26827580-26827602 CAGACTGCTCTCCCATGAGCTGG - Intergenic
952408406 3:33025997-33026019 CACGCTGCTCCCCCACCAGCGGG - Intronic
954725788 3:52608409-52608431 CATGGTGCTTTACGAAGAGCTGG + Intronic
959241617 3:103803208-103803230 AACGGTGCTTTCCAAAGACCAGG + Intergenic
961313907 3:126021297-126021319 CATGCAGCTCTCCCAAGTGCTGG - Intronic
967961517 3:194929027-194929049 CATGCGGCCTTCCCAAGTGCTGG + Intergenic
970524400 4:16916849-16916871 CACGGTGATTTCCCTTGAGCAGG + Intergenic
977318918 4:95486547-95486569 CACGCTGATCTCCCAAGAATGGG + Intronic
978405060 4:108370565-108370587 CACGCTGCTTTACAAAGAGCAGG + Intergenic
979525703 4:121714348-121714370 CACTCTGCTTCCCAAAGTGCTGG - Intergenic
979776503 4:124595046-124595068 CACTCTATTCTCCCAAGAGCTGG + Intergenic
980462126 4:133127764-133127786 CACTCTGCCATCCCAAGGGCTGG - Intergenic
981017159 4:139986051-139986073 GACCCTGCTTTCCATAGAGCTGG - Intronic
984820044 4:183874081-183874103 CATTCTGCTTTCCTAAGAGATGG + Intronic
986408729 5:7453778-7453800 CATGCTCCCCTCCCAAGAGCTGG - Intronic
987488024 5:18544526-18544548 CATGCTGCCCTCCCAAGTGCCGG + Intergenic
989733913 5:44679664-44679686 CACACTGCTTTGCCAATAGGTGG + Intergenic
991583772 5:68182492-68182514 CACCCTTCTTTCCCTTGAGCAGG + Intergenic
993673600 5:90791855-90791877 CAGGCTGCTCTGCCAAGATCTGG + Intronic
997280590 5:132641712-132641734 AACACTGCTTTCTTAAGAGCTGG - Intronic
999285740 5:150393279-150393301 CAGGCTGCTTTCCTCACAGCAGG + Intronic
1000139488 5:158388098-158388120 GAAGCTGCTTTTCAAAGAGCAGG - Intergenic
1000305099 5:159987481-159987503 CACGCCCCTTTCCCCTGAGCAGG + Intergenic
1001109210 5:168881901-168881923 GAGGGTGTTTTCCCAAGAGCAGG - Intronic
1001188290 5:169599825-169599847 CCCTCTGCCTCCCCAAGAGCTGG - Intronic
1005902198 6:30226551-30226573 CATGCTGCCTTCCCTAAAGCAGG - Intergenic
1006386074 6:33731703-33731725 CATGCTGCTCTGCCAAGGGCAGG - Intronic
1006638789 6:35478288-35478310 CAGGCTGCTGTCCCAGGAGAGGG + Exonic
1012605160 6:101149078-101149100 CATTCTTCTTTCCCAAGACCTGG - Intergenic
1013597683 6:111674710-111674732 CAAGCTACTTTCCTGAGAGCAGG + Intronic
1015500819 6:133931288-133931310 CCCGCTGCTCTCCTTAGAGCTGG - Intergenic
1017953310 6:159156954-159156976 CACTCTGCCTTCCAAAGTGCTGG + Intergenic
1019500433 7:1361891-1361913 CAGGCTGCTCTCCCAAAACCCGG - Intergenic
1019934099 7:4242967-4242989 CACGAGGCCTTCCCAAGGGCTGG + Intronic
1023754503 7:43403527-43403549 CTCGCTATTTTCCCAAAAGCAGG - Intronic
1026447746 7:70500264-70500286 TAGGCTGCTTTTCCAAGAACAGG - Intronic
1026475060 7:70728048-70728070 CACCCTTCTTTCCCCAAAGCAGG - Intronic
1027616522 7:80431055-80431077 CATGCTCCTCTCCCAAGTGCTGG + Intronic
1028250877 7:88539183-88539205 CACGCTACTTCCACCAGAGCAGG - Intergenic
1029292970 7:99516723-99516745 CAGGGTGCTTTCCCCACAGCAGG - Intronic
1029428153 7:100510395-100510417 CCTGCTGTTTTCTCAAGAGCAGG - Intergenic
1036255409 8:7202411-7202433 CACGCTGGCCTCCCTAGAGCCGG + Intergenic
1041644993 8:60242649-60242671 CAGGTAGCTTTCCCAGGAGCTGG - Intronic
1047450693 8:124962845-124962867 CATGCTCCTCTCCCAAGTGCTGG + Intergenic
1047740418 8:127802162-127802184 CACTCAGCTTTCCAAAGTGCTGG + Intergenic
1049109332 8:140634042-140634064 CCCGGTCCTTTCCCAAGAGGGGG + Intronic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1050093706 9:2041809-2041831 CTGGCTGCATTCTCAAGAGCTGG - Intronic
1053012586 9:34643081-34643103 CACCCTGGCTTCCCAAGAGCTGG + Intronic
1056272072 9:84955970-84955992 CACGCTGGAGTGCCAAGAGCAGG - Intronic
1057852122 9:98573940-98573962 CACCCTGCATTCCCAATAGGGGG - Intronic
1059071556 9:111142718-111142740 ACCTCTGCTTCCCCAAGAGCTGG + Intergenic
1059227017 9:112681624-112681646 CACGCTCCTTCCCCAACAGCCGG - Intergenic
1059771506 9:117430925-117430947 CATGCCGCCTTCACAAGAGCTGG - Intergenic
1060526070 9:124322003-124322025 CAAGATGCTTTCCCAAGAGCTGG - Intronic
1060527745 9:124330011-124330033 AAGGCTGCTGACCCAAGAGCTGG + Intronic
1060666300 9:125434075-125434097 CTGGCTGCTTTCCAAATAGCAGG + Intergenic
1061965386 9:134010984-134011006 CACGCTGTCTTCCCAGCAGCTGG + Intergenic
1062521576 9:136960054-136960076 CACACTGCTTTCCCAGGATCAGG + Intergenic
1187225701 X:17374284-17374306 GAGGCTGCATTCCCAAGATCTGG + Intergenic
1189419921 X:40847756-40847778 CATGCTCCTCTCCCAAGTGCTGG + Intergenic
1189794755 X:44635164-44635186 CCAGCTGCTTTCCCCAGACCAGG + Intergenic
1190771893 X:53521727-53521749 CATGCTCCTCTCCCAAGCGCCGG - Intergenic
1193654141 X:84178040-84178062 CACGCTGCCTCCCAAAGTGCTGG + Intronic
1194214263 X:91109228-91109250 CAGGCTGCTTCTCCAAGGGCTGG + Intergenic
1194719570 X:97324378-97324400 TACGATGCTTTCCAAACAGCTGG - Intronic
1196941509 X:120780962-120780984 AAGCCTGCTTTCCTAAGAGCTGG - Intergenic
1200037940 X:153345498-153345520 CAATCTCCTTTCCCATGAGCAGG + Exonic