ID: 1162440667

View in Genome Browser
Species Human (GRCh38)
Location 19:10690240-10690262
Sequence GGCCTGGGTAACCCCAGCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 313}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162440660_1162440667 21 Left 1162440660 19:10690196-10690218 CCTGTGGTGGAACATAACGCAGT 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1162440667 19:10690240-10690262 GGCCTGGGTAACCCCAGCCATGG 0: 1
1: 0
2: 1
3: 31
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162440667 Original CRISPR GGCCTGGGTAACCCCAGCCA TGG Exonic
900157593 1:1209428-1209450 GGGCTGGGCCACACCAGCCACGG + Intergenic
900189242 1:1346302-1346324 GGCCTGGGTCACCCCCACCTCGG + Intronic
900388128 1:2419861-2419883 GGCCTGGCTGGCCCCAGCCCAGG - Intergenic
900396424 1:2454961-2454983 GGCCTGGCTGCCCCCAGGCAGGG - Intronic
900420005 1:2552070-2552092 AGCCCGGGTCACCCCAGCCCTGG - Intergenic
900424420 1:2569572-2569594 AGCCCGGGTCACCCCAGCCCTGG + Intergenic
900784801 1:4642343-4642365 GGGCTCTGTAACCCCACCCAGGG - Intergenic
900912808 1:5613978-5614000 GGCCTGGGAACTCCCAGGCAAGG - Intergenic
901020429 1:6252529-6252551 GGCCTGGTTCTCCCCAGCTAAGG - Intronic
902709007 1:18226177-18226199 AGCCTGGATGATCCCAGCCATGG - Intronic
903320375 1:22539369-22539391 GGCCTCTGTGACCTCAGCCAGGG + Intergenic
904584970 1:31575421-31575443 TGGCTGGGTTACCCCTGCCATGG - Intergenic
906240419 1:44239114-44239136 GGCCTGGTAACCCCCAGCCCTGG + Intronic
907299179 1:53475836-53475858 TGCCTGGGTCACCCCTCCCACGG + Intergenic
907582782 1:55586948-55586970 GGCCTGGGTACCTCCAGGCTTGG + Intergenic
908605454 1:65792942-65792964 AGCCTGGGGAACCCGCGCCAGGG - Intronic
908757145 1:67479491-67479513 GGGAGGTGTAACCCCAGCCAGGG - Intergenic
912270934 1:108208752-108208774 TGCCTGGGTATCCCCAGCAGAGG + Intergenic
912455289 1:109792730-109792752 GGCCTGGGGAATTCCAGCCCAGG + Intergenic
912507402 1:110165637-110165659 ATCCTGGCTGACCCCAGCCAAGG - Intronic
912553218 1:110497818-110497840 GGCCGGGGCAACTCCAGCCCTGG - Intergenic
913537234 1:119784716-119784738 GGCTTGCGTAACCCAGGCCAGGG + Intergenic
914226202 1:145721257-145721279 GGCCCGCGTCACTCCAGCCATGG - Intronic
917222879 1:172749899-172749921 GGCCTGAGGAGCTCCAGCCAGGG + Intergenic
919774234 1:201183828-201183850 GTCCTTGGGAAGCCCAGCCATGG - Intergenic
921455385 1:215365230-215365252 TGCCTGAGTATCACCAGCCAAGG + Intergenic
921469674 1:215533061-215533083 TGCCTGGGTATCACCAGCCAAGG - Intergenic
921914644 1:220593818-220593840 GTCCTGGGTAGGCCCAGGCAGGG + Intronic
922007757 1:221549407-221549429 GGCCAGGAAACCCCCAGCCAAGG + Intergenic
922745380 1:228040116-228040138 GGCCATGGAAACGCCAGCCATGG + Intronic
1062818833 10:519140-519162 GGCCTGGGTTACCTGAGCCAAGG - Intronic
1063343782 10:5293021-5293043 GGCCTGCCCCACCCCAGCCAAGG + Intergenic
1063663642 10:8049700-8049722 GGCCAGGGTAACCTAATCCAGGG + Intergenic
1065022892 10:21515617-21515639 CGCCTTGTTAACCACAGCCAAGG - Exonic
1065323841 10:24533277-24533299 CGCCTGGGTCTCTCCAGCCATGG + Intronic
1065621701 10:27588147-27588169 TGCCTGGGTATCACCAGCCGAGG - Intergenic
1066434085 10:35380725-35380747 GGACTGGGAGACCCCAGGCAAGG - Intronic
1067796350 10:49324913-49324935 TGCCTGGAAAACCGCAGCCAGGG + Exonic
1068516935 10:58036651-58036673 TGCCTGGGTATCACCAGCAAAGG + Intergenic
1069772496 10:70908451-70908473 GGCCAGGGTGAGCCCAGCCTAGG + Intergenic
1069881100 10:71593952-71593974 GGCATGGGTTACCACACCCATGG - Intronic
1070813172 10:79308462-79308484 GTCCTGGGCCACACCAGCCAGGG + Intronic
1072323319 10:94272131-94272153 GGATTGGGAAACCCCAGCCCTGG - Intronic
1073434944 10:103510674-103510696 GGCAGGGGTCAGCCCAGCCAGGG - Intronic
1073872451 10:107880575-107880597 GGCCTGGTTCACCCCATTCAGGG - Intergenic
1075092667 10:119452358-119452380 CTCCTGTGTCACCCCAGCCAGGG + Intronic
1075337405 10:121618120-121618142 GGCCTTGGGATCCCCAGCCACGG - Intergenic
1077233988 11:1471089-1471111 GGCAGGGGTCAGCCCAGCCAGGG - Intronic
1077388249 11:2285855-2285877 GGCCTGGGATGGCCCAGCCAGGG - Intergenic
1077390474 11:2298658-2298680 TGCCTGGGCCACCCCAGCCTGGG - Intronic
1077408351 11:2392497-2392519 GCCCAGGGAAACCACAGCCAAGG - Intronic
1077575844 11:3382777-3382799 GGCGTGGTTCACCCCAGCCCTGG + Intergenic
1078415587 11:11162169-11162191 GGCCATGGTAAGCCCAGGCATGG - Intergenic
1078600384 11:12725015-12725037 GGCCTGGGGAACTCAAGCAAAGG - Intronic
1083950671 11:65953831-65953853 GGCCTGGTTAGCCCCAGGGAAGG - Intronic
1086979433 11:93177652-93177674 TGCCTGGGTATCACCAGCAAAGG + Intronic
1087352078 11:97045413-97045435 TGCCTGGGTAACAGCAGCGATGG + Intergenic
1087820317 11:102704300-102704322 GAGCTGTGTAACCTCAGCCACGG + Intronic
1088815095 11:113415319-113415341 GGCTTGGGAAACCTCAGCAAGGG - Intronic
1090400370 11:126444950-126444972 GGCCTGGCTCACCCCAGCGAGGG + Intronic
1090805063 11:130197695-130197717 GGCCTGGGTAACCCCTGCCCTGG + Intronic
1092083519 12:5737266-5737288 GCCCTGGGTAAACCCAGTCTTGG + Intronic
1092567597 12:9685147-9685169 TGCCTGGGTATCACCAGCAAAGG + Intronic
1093404337 12:18786067-18786089 TGCCTGGGTAACAGCAGCCGTGG - Intergenic
1093960261 12:25264898-25264920 CTCCTTGGTCACCCCAGCCATGG - Intergenic
1094578267 12:31708394-31708416 GGATTGGGAAACCCCAGCCCTGG + Intronic
1094730058 12:33164115-33164137 TGCCTGGGTATCACCAGCGAAGG - Intergenic
1095793735 12:46195246-46195268 TGCCTGGGTATCACCAGCAAAGG + Intronic
1095933049 12:47648632-47648654 GGCCTGCTTAACACCAGGCATGG - Intergenic
1095942503 12:47736256-47736278 GGCCTGTGTATCCACATCCATGG + Intronic
1097282015 12:57850794-57850816 GGACTGGGTGTCCCGAGCCAAGG + Intergenic
1097349843 12:58536691-58536713 GGCCTGCCTACCTCCAGCCATGG + Intergenic
1097412221 12:59268733-59268755 TGCCTGGGTATCCCCAGCAGAGG - Intergenic
1098638432 12:72812851-72812873 TGCCTGGGTATCCCCAGCGGAGG + Intergenic
1099025541 12:77460116-77460138 TGCCTGGGTATCCCCAGCAGAGG - Intergenic
1103291228 12:119847861-119847883 AGCCTGGGTAACACTAGCCTGGG + Intronic
1103451560 12:121032843-121032865 GGCCTGGGTAACCACAGAAAGGG - Intronic
1104175307 12:126325962-126325984 TGCCTGGGTATCACCAGCAAAGG + Intergenic
1104485892 12:129150935-129150957 GGCCTGGCCACCACCAGCCAGGG - Intronic
1104686452 12:130788070-130788092 GGCCCAGGTCACCCCACCCAAGG + Intergenic
1104949789 12:132434230-132434252 GGCCCTGGTGACCCCAGGCATGG - Intergenic
1105838382 13:24230911-24230933 GGTCTGATCAACCCCAGCCACGG - Intronic
1108170404 13:47735598-47735620 TGCCTGGGTAACACCAGCAGAGG - Intergenic
1110020042 13:70458138-70458160 TGCCTGGGTATCACCAGCAAAGG - Intergenic
1110823992 13:79951152-79951174 TGCCTGGGTATCACCAGCAAAGG - Intergenic
1112860933 13:103829326-103829348 TGCCTGGGTATCACCAGCGAAGG + Intergenic
1113513688 13:110874691-110874713 TGCTTGGGGAACCGCAGCCAAGG - Intergenic
1114552934 14:23544524-23544546 GGCCTGGGAAAATCCAGCCAGGG - Intronic
1114763445 14:25344015-25344037 GGATTGGGAAACCCCAGCCCTGG - Intergenic
1117655555 14:57952118-57952140 TGCCTGGGTATCACCAGCGAAGG - Intronic
1117930451 14:60836546-60836568 TGCCTGGGTATCCCCAGCGGAGG + Intronic
1118350780 14:64971651-64971673 GGCCTGGGTACCCCGAGCTGGGG - Intronic
1118485841 14:66213802-66213824 ATCATGGGTAACACCAGCCAGGG + Intergenic
1119735730 14:76980611-76980633 GGCCTGCCTGACCCCAGGCATGG - Intergenic
1120854587 14:89201651-89201673 GGCCTGGGCACGGCCAGCCAGGG + Intronic
1121013612 14:90535423-90535445 GGCCTGGGTACCCCCAAGCCAGG - Exonic
1121024773 14:90607454-90607476 GGCCTGGGAGAACCCAGCCCTGG - Intronic
1121265387 14:92599165-92599187 GCCCTGGGGAACCCCAGCGAAGG + Intronic
1121813874 14:96914327-96914349 CTCCTGGCTCACCCCAGCCATGG - Intronic
1121845591 14:97169531-97169553 GGCTTGAGTAGCCCCAGCCCAGG + Intergenic
1122162177 14:99792986-99793008 GCCCGGGGTAACCTCCGCCACGG - Intronic
1122842481 14:104473193-104473215 GGTCTGGGGATCCCCAGCGAAGG + Intergenic
1202904353 14_GL000194v1_random:59845-59867 GGCCAGGGGAGCCCCAGCCTAGG + Intergenic
1124966501 15:34436643-34436665 GGCCTTGGTAAGCCCAGGCTAGG - Intronic
1125354457 15:38802778-38802800 TGCCTGGGTATCACCAGCAAAGG + Intergenic
1125833053 15:42729717-42729739 TGCCTGGGGAGGCCCAGCCAGGG - Intronic
1126059950 15:44770991-44771013 GGATTGGGAAACCCCAGCCCTGG + Intergenic
1126561613 15:50049992-50050014 GGTCTAGGTGACCCCAGGCATGG - Intronic
1128328294 15:66739377-66739399 GGCCTGGGTAAGGCCAGGCACGG - Intronic
1129231025 15:74197304-74197326 GGCCTGGGCACCCCCACTCAGGG - Intronic
1130531187 15:84748704-84748726 GGCCGGGGCAGCCCCAGCCTGGG + Intronic
1132622060 16:872534-872556 GAGGTGGCTAACCCCAGCCAGGG - Intronic
1133100433 16:3476021-3476043 GGCCTGGGTCTTCCCAGCGATGG + Intronic
1133298247 16:4766134-4766156 GGCCTGGGAAGCCCCTGCCCTGG + Intronic
1133314453 16:4873982-4874004 TGCCGGGGTAAACCCAGCCCTGG + Intronic
1134147017 16:11773369-11773391 AGCCTGGGTAACCATAGCAAGGG - Intronic
1134190245 16:12115355-12115377 GGCCAGTGAAACCCCAGGCAGGG + Intronic
1134492744 16:14707878-14707900 GTCATGGGTCACCCCAGCCCTGG + Intergenic
1134498125 16:14747000-14747022 GTCATGGGTCACCCCAGCCCTGG + Intronic
1134582447 16:15382093-15382115 GGCATGGGTCACCCCAGCCCTGG - Intergenic
1135313767 16:21426144-21426166 GGCATGGGTCACCCCAGCCCTGG - Intronic
1135366691 16:21858424-21858446 GGCATGGGTCACCCCAGCCCTGG - Intronic
1135445124 16:22512734-22512756 GGCATGGGTCACCCCAGCCCTGG + Intronic
1136193846 16:28637273-28637295 GGCATGGGTCACCCCAGCCCTGG + Intergenic
1136310431 16:29404847-29404869 GGCATGGGTCACCCCAGCCCTGG - Intergenic
1136323879 16:29506635-29506657 GGCATGGGTCACCCCAGCCCTGG - Intergenic
1136438564 16:30246618-30246640 GGCATGGGTCACCCCAGCCCTGG - Intronic
1139702617 16:68718020-68718042 AGCCTGGGCAACTCCAGCCTGGG - Intronic
1139858114 16:69997233-69997255 GGCATGGGTCACCCCAGCCCTGG - Intergenic
1139952252 16:70678140-70678162 GGCCTTGATGCCCCCAGCCAGGG + Intronic
1141243509 16:82285098-82285120 AGCCTGGGTAACAGCAGCCTTGG + Intergenic
1141665244 16:85462468-85462490 GGTCTGGGGAGCCCCAGCCCTGG + Intergenic
1142114867 16:88351364-88351386 GGCCTCCATCACCCCAGCCATGG + Intergenic
1142150518 16:88510625-88510647 CGCATGGGTGAGCCCAGCCAGGG - Intronic
1143163697 17:4887023-4887045 GACCTGGTTATCCCCACCCAAGG + Intronic
1143390162 17:6555599-6555621 GGCCTGGGTCTCCCCAGCATGGG + Intronic
1143621621 17:8084241-8084263 AGCCTGGGGACCACCAGCCAGGG - Intronic
1143681786 17:8481185-8481207 GGCCTGGGCTGCCTCAGCCATGG - Intronic
1144889239 17:18484551-18484573 GGCCTGGCTGACCCCTGCCGAGG + Intronic
1145142969 17:20459745-20459767 GGCCTGGCTGACCCCTGCCGAGG - Intronic
1145792899 17:27638940-27638962 GGCCTGGCTGACCCCTGCCGAGG + Intronic
1145807763 17:27746809-27746831 GGCCTGGCTGACCCCTGCCGAGG + Intergenic
1145941739 17:28746306-28746328 GCCCTTGCTGACCCCAGCCAGGG - Intronic
1146053898 17:29571895-29571917 GGCCTGGGTAGAGCCAGCCTGGG + Exonic
1146837618 17:36125176-36125198 GGCAGGGGTATCACCAGCCATGG - Intergenic
1147912539 17:43864609-43864631 TTCCAGGGAAACCCCAGCCAAGG - Intergenic
1148071894 17:44913474-44913496 GGCGTGGGGAACCCCAGCTGTGG - Intronic
1148356467 17:46978916-46978938 GCCCTGGGAAACCGCACCCACGG - Exonic
1152007496 17:77691725-77691747 GGTCTGGGCAGCCCCAGCCCTGG - Intergenic
1152613870 17:81329115-81329137 TGCCTGGGTTACCCCAGCTGGGG + Intronic
1154119560 18:11640505-11640527 GGCATGGGTCACCCCAGCCCTGG - Intergenic
1155114316 18:22749448-22749470 TGCCTGGGTAACACCAGCGGAGG - Intergenic
1155977008 18:32142016-32142038 AGCCTGGGCAACACCAGCCTGGG + Intronic
1157787873 18:50502389-50502411 GGCCTGGGTATCACCAGCAGAGG + Intergenic
1160678657 19:403820-403842 GGCCTGGTGAGCCCCAGTCAGGG - Intergenic
1161152514 19:2717079-2717101 GGCCTCGGTTTCCCCAGCCGAGG + Exonic
1161993804 19:7700217-7700239 TGCCTGTGTGACCTCAGCCAAGG + Intronic
1162415844 19:10536750-10536772 AGCCTGGGACAGCCCAGCCAGGG + Intergenic
1162440667 19:10690240-10690262 GGCCTGGGTAACCCCAGCCATGG + Exonic
1163134451 19:15299511-15299533 GGCCTGGGACATCCCCGCCATGG + Intronic
1163367044 19:16881100-16881122 ACCCTGGGCATCCCCAGCCATGG - Intergenic
1163481731 19:17560503-17560525 GGTCTGGGTATCCCCAGGGAAGG + Intronic
1163755541 19:19104433-19104455 GGCATGGGGGACCCGAGCCATGG - Intronic
1164060713 19:21671301-21671323 TGCCTGGGGAACCCCTGCAAAGG - Intergenic
1164617471 19:29675616-29675638 GTCCTGGGGGAGCCCAGCCAAGG - Intergenic
1165016109 19:32881102-32881124 GGCCTGGGGATCCCCACTCATGG - Intronic
1165996658 19:39848606-39848628 GGACTGGGGAGCCCCAGGCAGGG + Intergenic
1166776381 19:45315423-45315445 GGGCTGGGTGACCCCAGCAGTGG + Intronic
1167516985 19:49929255-49929277 TGCCTGCGTAGCCCCGGCCATGG + Exonic
1167603398 19:50467291-50467313 GGCCTTGGCACCCCTAGCCAAGG - Intronic
1168115885 19:54221201-54221223 GGCCTGGGAGAGCCCAGCCTGGG + Exonic
1168118868 19:54240949-54240971 GGCCTGGGAGAGCCCAGCCTGGG + Exonic
1168121689 19:54255404-54255426 GGCCTGGGAGAGCCCAGCCTGGG + Exonic
1168125186 19:54278930-54278952 GGCCTGGGAGAGCCCAGCCTGGG + Exonic
1168133808 19:54337518-54337540 GGCCTGGGAGAGCCCAGCCTGGG + Exonic
1168166526 19:54552112-54552134 GGCCTGGGAGAGCCCAGCCTCGG - Intergenic
1168169285 19:54575412-54575434 GGCCTGGGAGAGCCCAGCCTGGG - Exonic
1168172069 19:54595795-54595817 GGCCTGGGAGAGCCCAGCCTGGG - Exonic
1168176788 19:54632620-54632642 GGCCTGGGAGAGCCCAGCCTGGG - Exonic
1168185600 19:54697805-54697827 GGCCTGGGAGAGCCCAGCCTGGG - Intronic
1168187576 19:54709711-54709733 GGCCTGGGAGAGCCCAGCCTGGG - Intergenic
1168655670 19:58125807-58125829 GGCCTGGCTGACCCCAGTCCTGG + Intergenic
925275065 2:2643026-2643048 GGCTTGGGAAGCCCCAGCTAGGG + Intergenic
926633529 2:15158402-15158424 TGGCTGTGTAACCCCAGGCAGGG - Intergenic
926857259 2:17270670-17270692 GGCCAGGGTAAACACAGTCATGG + Intergenic
927118144 2:19925132-19925154 TGCCTGGGGAACCCCCGCAAAGG + Intronic
927239697 2:20910746-20910768 TGCCTGGGTATCAGCAGCCATGG + Intergenic
933269212 2:80215541-80215563 TGCCTGGGTAACACCAGCTGAGG + Intronic
934502292 2:94870556-94870578 GGCCAGGGGAGCCCCAGCCTAGG - Intergenic
936179390 2:110251743-110251765 TGCCTGGGTATCACCAGCAAAGG - Intergenic
938127446 2:128684754-128684776 GGCCTGGGGGACCCCCACCAGGG + Intergenic
939942088 2:148362819-148362841 TGCCTGGGTATCACCAGCAAAGG - Intronic
940475188 2:154153210-154153232 TGCCTGGGTAACAGCAGCGATGG + Intronic
944395622 2:199263087-199263109 GGATTGGGAAACCCCAGCCCTGG + Intergenic
945210791 2:207380497-207380519 TGCCTGGGTATCCCCAGCGGAGG + Intergenic
945329640 2:208524836-208524858 TGCCTGGGTATCACCAGCCGAGG + Intronic
948408780 2:237743063-237743085 TCCCTGGCTAACCCCAGCCAAGG - Intronic
948868523 2:240786947-240786969 TGCCAGGGCCACCCCAGCCACGG + Intronic
1169319953 20:4624630-4624652 TGCCTGGGTATCACCAGCAAAGG + Intergenic
1170681888 20:18533368-18533390 TGACTGTGTAACCCCAGCCCAGG - Intronic
1173925688 20:46779590-46779612 ATCCTGGGTAGCCCAAGCCATGG - Intergenic
1176169853 20:63691894-63691916 GCCGTGGGTGCCCCCAGCCACGG + Intronic
1176623721 21:9074612-9074634 GGCCAGGGGAGCCCCAGCCTAGG + Intergenic
1177460471 21:21402410-21402432 GGATTGGGAAACCCCAGCCCTGG + Intronic
1179444890 21:41424334-41424356 GGGCTGGGCAACCCCATCCAAGG - Intronic
1179545689 21:42111167-42111189 AGCCAGGTGAACCCCAGCCAGGG + Exonic
1179545696 21:42111182-42111204 AGCCAGGGGAGCCCCAGCCAGGG + Exonic
1179545735 21:42111317-42111339 AGCCAGGGGAGCCCCAGCCAGGG + Exonic
1180071273 21:45436884-45436906 AGCCAGGGTTCCCCCAGCCATGG - Intronic
1180750319 22:18119885-18119907 GCTCCGGGTAACCCAAGCCAGGG - Intronic
1182114761 22:27749807-27749829 AGCCTGGGCAACCCCACCCCTGG - Exonic
1182542051 22:31048921-31048943 GGCCTCCATAACCCCACCCAGGG + Intergenic
1182977443 22:34636715-34636737 GACCAGGGTAAACTCAGCCACGG + Intergenic
1183422927 22:37722833-37722855 GGCCTGTGTGACCCCAGGGAGGG - Intronic
1183441372 22:37824950-37824972 GGCCAGGCTCACCACAGCCACGG - Exonic
1183706640 22:39478534-39478556 GGCCAGGGTGAGGCCAGCCAAGG + Intronic
1183724186 22:39579278-39579300 GGCCTCAGTCTCCCCAGCCATGG - Intronic
949710300 3:6863254-6863276 GGTTTGGGTACCACCAGCCAGGG - Intronic
949896175 3:8768802-8768824 TGCCTGGGAAACCCCAGCTCTGG + Intronic
949951564 3:9233292-9233314 GGTCTGGGTGACTCCACCCAGGG + Intronic
950096298 3:10332753-10332775 GGCCAGGGTGACCACAGCAAGGG - Intronic
950561895 3:13735710-13735732 TGCCTGGGTATCACCAGCCGAGG + Intergenic
951237620 3:20253991-20254013 TGCCTGGGTATCACCAGCCGAGG + Intergenic
951310995 3:21125695-21125717 TGCCTGGGTATCACCAGCGAAGG - Intergenic
951689655 3:25382430-25382452 GGACTGGGTAGCCTCATCCATGG + Intronic
951855902 3:27196618-27196640 GTCCTGGGTAGCCATAGCCAGGG + Intronic
952073794 3:29671111-29671133 GGCCTGGGTATCACCAGCAGAGG - Intronic
953782057 3:45880090-45880112 GGCCTAGGCCAGCCCAGCCAAGG + Intronic
954003242 3:47574050-47574072 GGCCTGGGTGTACACAGCCAGGG + Intronic
954422576 3:50426420-50426442 GGCCTGGGGCAGCTCAGCCAAGG + Intronic
955774287 3:62416910-62416932 AGCCTGGGTAACAGCAGCCTGGG - Intronic
956382965 3:68685761-68685783 TGCCTGGGTATCCCCAGCAGAGG + Intergenic
959534699 3:107471195-107471217 TGCCTGGGTATCACCAGCAAAGG - Intergenic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
966595182 3:181719543-181719565 GGCCCGGGTCACCTCACCCATGG + Intergenic
967117457 3:186354850-186354872 TGGCTGGGTAACCCCAGGCAGGG + Intronic
968582462 4:1401461-1401483 GGCCTTGGTTCCTCCAGCCAAGG - Intergenic
968655786 4:1777928-1777950 TGCCTGGGGAGCCCCACCCATGG - Intergenic
969460332 4:7325675-7325697 GGCCTGGAAAAGCCCTGCCAAGG - Intronic
971319920 4:25597238-25597260 GGATTGGGAAACCCCAGCCCTGG - Intergenic
972178705 4:36439411-36439433 TGCCTGGGTATCACCAGCCGAGG + Intergenic
972212429 4:36855058-36855080 TGCCTGGGTAACACCAGCAGAGG - Intergenic
973592561 4:52457857-52457879 AGCCTTGGTACCACCAGCCAAGG + Intergenic
974707517 4:65540679-65540701 AGCCTAGGTAAAACCAGCCAGGG - Intronic
974851689 4:67412029-67412051 TGCCTGGGTATCACCAGCAAGGG + Intergenic
975729117 4:77320384-77320406 GGATTGGGAAACCCCAGCCCTGG - Intronic
978467281 4:109021877-109021899 GGATTGGGAAACCCCAGCCCTGG + Intronic
981295547 4:143126761-143126783 GGCTTGGGGAACCACTGCCATGG + Intergenic
985372540 4:189301636-189301658 GGCCTGGGGAAGCCCAGTGAGGG - Intergenic
985651475 5:1109685-1109707 GGCCTTGGTGTCCCCAGCCTGGG - Intronic
986468302 5:8049332-8049354 CCCCTGAGTAACCACAGCCAGGG - Intergenic
986581754 5:9272694-9272716 TGCCTGGGTATCACCAGCGAAGG - Intronic
986653948 5:9991580-9991602 TGCCTGGGTATCACCAGCTAAGG - Intergenic
987100357 5:14585770-14585792 GGCCAGGGTAAGCCCTGGCATGG + Intronic
987402836 5:17495729-17495751 GACCTGGGTCATTCCAGCCATGG + Intergenic
987409633 5:17602038-17602060 GACCTGGGTCATTCCAGCCATGG + Intergenic
987415132 5:17654548-17654570 GACCTGGGTCACTCCAGTCATGG + Intergenic
988502763 5:31797444-31797466 GGCGTGTGTAATCCCAGACAGGG - Intronic
989571940 5:42953329-42953351 GGCCTGGGAGAGCCCCGCCACGG - Intergenic
990230237 5:53705495-53705517 TGCCTGGGTAACACCAGCAGAGG + Intergenic
990541883 5:56781604-56781626 TGCCTGGGTATCACCAGCCGAGG + Intergenic
996234005 5:121105015-121105037 AGCCTGGGTGACACCAGCCTGGG + Intergenic
998005593 5:138654837-138654859 GGCCTGAGCTACCCCAGCCCTGG + Intronic
998039689 5:138944462-138944484 GGCCCGGGTCAGCCCAGCCCAGG + Intergenic
998717808 5:144905916-144905938 TGCCTGGGTATCACCAGCAAAGG - Intergenic
999145620 5:149391366-149391388 GGCATGGAGAACCTCAGCCACGG + Intronic
999460037 5:151749743-151749765 GGCCTGGGTTTCCCCAGCTGTGG - Intronic
1001425278 5:171618524-171618546 GGCCTGGGCAGCCCCAGGAAAGG - Intergenic
1002093346 5:176817372-176817394 GCCCTAGGTGTCCCCAGCCAGGG + Intronic
1004123776 6:12852248-12852270 GGCATGGGTCACCCCAGCTCTGG - Intronic
1004603138 6:17170008-17170030 GGGCTGGCTAATCCCATCCATGG - Intergenic
1006041467 6:31259786-31259808 TGCCTGGGTAACACCAGCAGAGG + Intergenic
1006752387 6:36386963-36386985 TGCCTGGGAAACGCCAGCCACGG + Intronic
1006770705 6:36550160-36550182 AGCCTGGGTGACCCCAGCCTGGG - Intergenic
1007399988 6:41598022-41598044 GGGATGGGGAACCCCACCCAGGG - Intronic
1009240878 6:61184301-61184323 GGCCTGGGTATCACCAGCGGAGG - Intergenic
1010459553 6:76098379-76098401 TGCCTGGGTATCACCAGCGAAGG - Intergenic
1011663994 6:89617652-89617674 GGCCTGGGTACCACCCACCAAGG - Intronic
1014922525 6:127229321-127229343 TGCCTGGGTATCACCAGCGAAGG - Intergenic
1015387060 6:132635959-132635981 TGCCTGGGTATCACCAGCCAAGG - Intergenic
1015447597 6:133325759-133325781 GAGCTGGGTAACTGCAGCCATGG - Intronic
1018038702 6:159903308-159903330 CGCCTGGTAAACCCCAGCCCTGG + Intergenic
1018525687 6:164708028-164708050 TGCCTGGGTAACAGCAGCCATGG + Intergenic
1019770718 7:2882388-2882410 GGCATTGTTAGCCCCAGCCAGGG + Intergenic
1020874180 7:13673327-13673349 GGCCTGGGTATCACCAGCAGAGG + Intergenic
1023876688 7:44289972-44289994 GGCCTGTGCCACCCCAGCCAGGG + Intronic
1024666986 7:51557448-51557470 TGCCTGGGTATCACCAGCAAAGG + Intergenic
1024886716 7:54150536-54150558 GGCCCTGGCAACCACAGCCAGGG - Intergenic
1024996548 7:55276984-55277006 GGCCTGGCTAGACCCTGCCATGG + Intergenic
1025757293 7:64357114-64357136 GCCCTGGGTGAGGCCAGCCAAGG + Intergenic
1026890079 7:73976805-73976827 GGGCTGGGTAGTCCTAGCCAGGG + Intergenic
1027778124 7:82492035-82492057 GGCCTGGGTATCACCAGCGGAGG + Intergenic
1028022276 7:85791726-85791748 TGCCTGGGTATCACCAGCGAAGG - Intergenic
1029497004 7:100901114-100901136 GTCCCTGGAAACCCCAGCCAAGG - Intergenic
1029647196 7:101865138-101865160 GGCCTGGGTTCCCCCTGCCGTGG + Intronic
1029845157 7:103405492-103405514 TGCCTGGGTATCACCAGCGAAGG + Intronic
1033156858 7:138964330-138964352 GGCATGTGCACCCCCAGCCACGG - Intronic
1033663835 7:143422868-143422890 GGCCTGGCTAACCTCAGCACTGG + Intergenic
1034414039 7:150955669-150955691 TGCCAGGGTGACCCCAGCCCTGG - Intronic
1037679136 8:21079298-21079320 GGGGTGGGTAAACCCAGTCAAGG + Intergenic
1037835753 8:22213902-22213924 GTCCAGGGTAGGCCCAGCCAGGG + Intergenic
1037908443 8:22729075-22729097 GGCCTGGATAATGCCAGCCCTGG - Intronic
1037986358 8:23292975-23292997 GGCCTGTCTCAGCCCAGCCAAGG - Intronic
1038540958 8:28389685-28389707 AGCCTGGGTAACACCATCCCTGG + Intronic
1040373338 8:46798172-46798194 TGCCTGGGTAACAGCAGCGATGG - Intergenic
1040829324 8:51660340-51660362 GGCCTGGGTATCCTCAGGAAGGG - Intronic
1041860129 8:62503510-62503532 GGATTGGGAAACCCCAGCCCTGG - Intronic
1042478899 8:69281028-69281050 GGCCTGGGTATCACCAGCGGAGG - Intergenic
1043746647 8:83880903-83880925 TGCCTGGGTATCACCAGCGAAGG + Intergenic
1048239191 8:132724244-132724266 GGATTGGGAAACCCCAGCCCTGG - Intronic
1049200622 8:141338603-141338625 GGCCTTGGGAAAGCCAGCCAAGG - Intergenic
1049696238 8:143985569-143985591 GGCCTGGGGAACCCGGGCCAGGG + Exonic
1050146059 9:2568876-2568898 GGGCTGAGTCATCCCAGCCAAGG + Intergenic
1050537121 9:6640392-6640414 GGCCTGGGGAACAGCTGCCACGG + Intronic
1052146813 9:25060618-25060640 GGCCTGGGTATCACCAGCAGAGG + Intergenic
1053052864 9:34976394-34976416 AGCCTGGGTGACCCTGGCCATGG + Intronic
1053071548 9:35104995-35105017 GGCCTGGGAAACCCAAGGGAGGG + Exonic
1054460539 9:65459929-65459951 GGCCTGGGAGGCCCCAGGCAGGG + Intergenic
1056762469 9:89425186-89425208 GGCCTGGGTAACACTGGGCAAGG - Intronic
1057062953 9:92021685-92021707 AGCCTGGGCAACTCCAGCCTGGG - Intergenic
1057488847 9:95506956-95506978 GGGCTGCGTAATCCCAGCGATGG + Intronic
1058492437 9:105516523-105516545 GGCCTGGGTATCACCAGCGGAGG - Intronic
1059363672 9:113768395-113768417 TGCCAGGGTAACCACAGTCAAGG + Intergenic
1061664029 9:132149892-132149914 GGCCTGGGCACCCCCAGCATCGG + Intergenic
1062032591 9:134368373-134368395 GGGCTGGATAGCCCCTGCCATGG + Intronic
1062043360 9:134414300-134414322 GGCATGGGGAGCCCCAGACAAGG - Intronic
1062395467 9:136350951-136350973 TGCCAGGGCCACCCCAGCCACGG + Intronic
1062606917 9:137352589-137352611 CGCCAGGGTGACCCCAGCCAGGG - Intronic
1203746907 Un_GL000218v1:45040-45062 GGCCAGGGGAGCCCCAGCCTAGG + Intergenic
1186773219 X:12838664-12838686 TGCCTGGGTATCCCCAGCGAAGG + Intergenic
1186929230 X:14370025-14370047 TGCCTGGGTATCACCAGCGAAGG - Intergenic
1191115487 X:56847579-56847601 TGCCTGGGTATCACCAGCAAAGG - Intergenic
1192195153 X:69023011-69023033 GGCCAGGGTGTCCCCAGGCAGGG - Intergenic
1195163613 X:102196339-102196361 TGCCTGGGTATCACCAGCCAGGG + Intergenic
1195556757 X:106235657-106235679 GGATTGGGAAACCCCAGCCCTGG + Intergenic
1195988417 X:110657717-110657739 TGCCTGGGTAACACCAGCAGAGG - Intergenic
1198320756 X:135516678-135516700 GGGCTGGGTAACCCTAGGAAAGG + Intergenic
1198858598 X:141045141-141045163 TGCCTGGGTATCACCAGCCGAGG - Intergenic
1198904099 X:141542247-141542269 TGCCTGGGTATCACCAGCCGAGG + Intergenic
1199121593 X:144060931-144060953 TGCCTGGGAAGCCCCACCCAAGG + Intergenic
1200232584 X:154451396-154451418 GGCCAGGATCACCCCAGCCCTGG + Intergenic
1201179813 Y:11333293-11333315 GGCCTGGGAACCCCAAGCCAGGG + Intergenic
1201621710 Y:15966266-15966288 GGATTGGGAAACCCCAGCCCTGG - Intergenic
1201645221 Y:16223131-16223153 TGCCTGGGTATCAGCAGCCATGG + Intergenic
1201657592 Y:16362191-16362213 TGCCTGGGTATCAGCAGCCATGG - Intergenic
1201922266 Y:19246080-19246102 GGCCTGGGTATCACCAGCAGAGG - Intergenic