ID: 1162440784

View in Genome Browser
Species Human (GRCh38)
Location 19:10690859-10690881
Sequence TGTGTGCTAGAAAACTTTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162440781_1162440784 23 Left 1162440781 19:10690813-10690835 CCGTGTTTGACTTTCTTGGAGAG 0: 1
1: 0
2: 3
3: 12
4: 204
Right 1162440784 19:10690859-10690881 TGTGTGCTAGAAAACTTTTGAGG 0: 1
1: 0
2: 0
3: 18
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162440784 Original CRISPR TGTGTGCTAGAAAACTTTTG AGG Exonic
902832574 1:19026728-19026750 AATGGGATAGAAAACTTTTGGGG + Intergenic
903876048 1:26473364-26473386 TATGTCCTAGAAAAGTTGTGTGG + Intronic
909239014 1:73188786-73188808 TGTGTGCCAGATAACTCTTGAGG + Intergenic
909796294 1:79741160-79741182 TGGGTTATAGAAAACTTGTGGGG - Intergenic
909981723 1:82110270-82110292 TGTGTGCACAAAAACCTTTGAGG + Intergenic
910579294 1:88804437-88804459 TGTGTGCTGTAAAATTTCTGAGG + Exonic
910757047 1:90705106-90705128 TGTGTGTTAGAAAAGTTTGTGGG + Intergenic
921799748 1:219388638-219388660 GGTGTAGTAGACAACTTTTGGGG - Intergenic
923146314 1:231200938-231200960 TGTGGGCTTCAAAACTTTAGGGG + Intronic
924698448 1:246425219-246425241 TGTGTGTTGAAAAAGTTTTGGGG - Intronic
924730269 1:246704813-246704835 TGAATGCTAGAAAATTTTAGGGG + Intergenic
1062969437 10:1634659-1634681 TGTGTGCTTCTAAAGTTTTGAGG - Intronic
1064938683 10:20708774-20708796 GGTGTTTTAGAACACTTTTGGGG + Intergenic
1065482025 10:26205279-26205301 TGTGTACTTGAAAACTGCTGAGG - Intronic
1066665999 10:37783062-37783084 ACTGTGCTAGAAACCTTTTTTGG + Intronic
1068645685 10:59464317-59464339 TATGTGTGAGAATACTTTTGTGG - Intergenic
1073679872 10:105691286-105691308 TTTGTGATAAAAAACATTTGTGG + Intergenic
1074424056 10:113335637-113335659 TGTGTGCCACTAAACTTTTGTGG - Intergenic
1074700238 10:116086237-116086259 TGTGTGCTAGGGAACATTGGTGG - Intronic
1079204630 11:18403905-18403927 TTTTTGTTAGAAAACTTGTGTGG + Intronic
1082095690 11:48127445-48127467 TGTGTGTTTGACAACTTTTCTGG + Intronic
1083139273 11:60708336-60708358 TCTGTGCAAGAAAGGTTTTGGGG - Intronic
1083286215 11:61660821-61660843 TTTGTGCAAGAAAAAATTTGAGG - Intergenic
1085146266 11:74200712-74200734 GGTGTGCTAGAAAATCTCTGTGG + Intronic
1087266435 11:96066675-96066697 TATGTGCCAGAAACCCTTTGAGG + Intronic
1088449947 11:109970787-109970809 TTGGTGTTAGGAAACTTTTGAGG - Intergenic
1089804785 11:121075506-121075528 TGTCTGCAAGAAAACTTTGCTGG + Intronic
1089855105 11:121536803-121536825 TGTGTGCTAGGAAAGATTCGAGG + Intronic
1090573835 11:128078175-128078197 TGTTTACTAGAAAATATTTGGGG - Intergenic
1094799266 12:34012564-34012586 TGTGTCTTAGAAAATTTTTCTGG - Intergenic
1095381548 12:41600417-41600439 GAGGTGCAAGAAAACTTTTGAGG - Intergenic
1095631935 12:44387229-44387251 GGTATACTAGAAAACTTTTCAGG - Intronic
1098253481 12:68592703-68592725 TGTGTGCAAGAGAAATTTTGGGG - Intergenic
1101171388 12:102099537-102099559 TTAGAGCTAGAAAACTTTTTAGG + Intronic
1106281893 13:28281594-28281616 GGTGTGTTAGAAATCTCTTGTGG + Intronic
1108455942 13:50613715-50613737 TGTGAGCCAGAAAAGCTTTGTGG - Intronic
1114019733 14:18467072-18467094 TGTGTTCTGGAAAACTTTTTGGG + Intergenic
1116443175 14:44978064-44978086 TGTGTGCTTGAAAACTGTAATGG + Intronic
1120090619 14:80328920-80328942 TGTGTGCTAAAAAATATTTAAGG + Intronic
1126390515 15:48145098-48145120 TGTCAACTAGAAAATTTTTGAGG - Intronic
1127952847 15:63826524-63826546 TGTGCTCTAAAATACTTTTGGGG - Intronic
1128446665 15:67768417-67768439 TGTGTGCTAGAGAAATTGTTTGG + Intronic
1128942319 15:71798982-71799004 TGAGAGCCAGAAAACTTTTTTGG - Intronic
1130149995 15:81304210-81304232 TATGTGATAGAAAACTTATCAGG - Intronic
1137331283 16:47499461-47499483 TGTGTGTTAGAAATCTTATTAGG - Intronic
1138193781 16:55037043-55037065 TGTGTGCAAGGAAAGATTTGGGG - Intergenic
1139588201 16:67917782-67917804 TGTGTGCTTGTCAACTTTTAGGG + Intronic
1144426561 17:15148186-15148208 TGTGTTCAAGAATACTTTTCAGG - Intergenic
1146231623 17:31116158-31116180 TGTATGGTTGAAAACTTTTTAGG + Intronic
1147290019 17:39434450-39434472 TTGATGCTAGAAAACTTTTGAGG - Intronic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1149104024 17:52940044-52940066 TGTGGGCTTGAAGATTTTTGTGG - Intergenic
1149169717 17:53794400-53794422 TGTCTTCTAGAAAAATTTGGAGG - Intergenic
1149411907 17:56417357-56417379 TGTATTTTAAAAAACTTTTGTGG - Intronic
1156226120 18:35110417-35110439 TGGCTACTAGAAAACTTATGTGG + Intronic
1156360712 18:36382163-36382185 TGTGTGCTTCACATCTTTTGGGG + Intronic
1158240031 18:55367137-55367159 TGTGTGCTGAAAAATTTTAGAGG - Intronic
1158862750 18:61608781-61608803 TGTGTGCTCTTAATCTTTTGAGG - Intergenic
1161879557 19:6938529-6938551 TGTGTGCTAGACAGCATTTTAGG - Intronic
1162440784 19:10690859-10690881 TGTGTGCTAGAAAACTTTTGAGG + Exonic
1162715397 19:12628294-12628316 TGTGTGTTAGAACACTTGTGTGG - Exonic
1163277086 19:16291634-16291656 TGTTCTCTAAAAAACTTTTGTGG + Intergenic
1163836861 19:19580258-19580280 TGCTTTCTAGAAACCTTTTGAGG + Intronic
1166647291 19:44541628-44541650 TGTGTGCCAGACACCTTTTTAGG + Intergenic
1166836081 19:45668910-45668932 TGTGTGCTAGAAAACCCTTTGGG + Intronic
927348914 2:22083074-22083096 TTTGGGCTAGATAACTATTGGGG + Intergenic
928921935 2:36535437-36535459 AGTGTGCCAGAAAATTTCTGTGG + Intronic
928995908 2:37290844-37290866 TGTGTGTTCTAAAATTTTTGTGG - Intronic
929059189 2:37905849-37905871 TATGTCCTAGAAAAATTTTACGG - Intergenic
929530451 2:42747905-42747927 GGGGTGCAAGAAAACTGTTGGGG - Intronic
930845680 2:55901017-55901039 TGTCTTCTAGTAGACTTTTGGGG + Intronic
931273664 2:60724904-60724926 TGTCTGCAAGAAACCTTTTTAGG - Intergenic
931681484 2:64752774-64752796 TGTGTGCTACAAGAAGTTTGTGG - Intergenic
931841870 2:66159854-66159876 AGGATACTAGAAAACTTTTGGGG + Intergenic
933058919 2:77710581-77710603 TGTCTGCAGGAAAACTTTTAAGG + Intergenic
939487415 2:142832187-142832209 TGTGCATTAGAAAACTTTTAGGG + Intergenic
941273362 2:163458734-163458756 TGTGTGCAAGGTAACCTTTGTGG - Intergenic
942100311 2:172574801-172574823 TTAGTGCTAGTAAATTTTTGTGG + Intronic
942161498 2:173193269-173193291 TATGAACTAGAAGACTTTTGAGG + Intronic
945184448 2:207124997-207125019 TGTCTACCATAAAACTTTTGAGG + Intronic
946641892 2:221792825-221792847 TGTGTGTTTGAAAACTTTTCAGG + Intergenic
946988083 2:225296795-225296817 TGTGTTTTAGAAAACTCTTCAGG + Intergenic
947035836 2:225853600-225853622 TGAGTCCTAGAAGATTTTTGTGG + Intergenic
1169821187 20:9712044-9712066 CGTGTGTTAGAAAATCTTTGTGG - Intronic
1172491082 20:35338544-35338566 TATGTATTAGAAATCTTTTGGGG + Intronic
1172967677 20:38849821-38849843 TGTGTCCAGGAAGACTTTTGGGG - Intronic
1173853624 20:46235060-46235082 TGGGTGCTAATAAACATTTGTGG + Intronic
1177231462 21:18326216-18326238 GGTCTGCTTAAAAACTTTTGTGG + Intronic
1180444238 22:15397897-15397919 TGTGTTCTGGAAAACTTTTTGGG + Intergenic
1181733499 22:24864536-24864558 TGTGTGGTATAAGGCTTTTGAGG - Intronic
1182441009 22:30363980-30364002 TTTATGCTAAGAAACTTTTGAGG - Intronic
950700980 3:14746263-14746285 TTGGTGCTAGCAAAGTTTTGGGG + Intronic
952338014 3:32421486-32421508 TGTGTGTTGGAATGCTTTTGTGG + Intronic
953161956 3:40429013-40429035 TGTGTGCAAGGAAAGCTTTGTGG - Intergenic
953458037 3:43059550-43059572 AGAGTGCTATAAAACTTTTGAGG - Intronic
954237557 3:49268381-49268403 CATGTGCAAAAAAACTTTTGGGG - Intergenic
954816724 3:53288203-53288225 TGTCTGCTGGAAAACACTTGGGG + Exonic
956435702 3:69232631-69232653 TGTGTGCTGGAGTACTTGTGTGG + Intronic
957116577 3:76034567-76034589 TGTGTGTTAGAATGTTTTTGTGG + Intronic
957414731 3:79886642-79886664 TTTCTACTAGAAAACTTTAGAGG - Intergenic
958681322 3:97335584-97335606 TGGAGGCTAGAAAAGTTTTGAGG - Intronic
959728490 3:109573269-109573291 TGTGTCCAAGAAAATTTGTGAGG + Intergenic
960129774 3:114043522-114043544 TTTGGGCTAGAGAATTTTTGTGG - Intronic
960269784 3:115661075-115661097 TGTGTGAAAGAAACATTTTGTGG - Intronic
960575928 3:119229312-119229334 TGTGTGCTGCTAAACTTTTGTGG + Intronic
964117261 3:153149154-153149176 GGGGTGTTAGAAAACTTTTGTGG + Intergenic
964238886 3:154567937-154567959 TGTGTGCTCAAAAACTTTACTGG + Intergenic
964675812 3:159278793-159278815 TGTGAGCTATTATACTTTTGGGG - Intronic
966648440 3:182272180-182272202 TGTGTCCTAGAATGCTTTTGTGG - Intergenic
969875164 4:10130950-10130972 TGTGGGCTGCAAAACTCTTGTGG + Intergenic
970390860 4:15611936-15611958 TGAGTGCTACAAAACTCTAGAGG + Intronic
971416453 4:26436104-26436126 TTGGTGCTAGAAAACATTTAAGG + Intergenic
973217427 4:47685531-47685553 TGTGTGGGAGATAAATTTTGGGG + Intronic
978360898 4:107930845-107930867 CCTGGGCTAGAAAACTTATGCGG - Intergenic
980453767 4:133012240-133012262 TGTGAGCTTTGAAACTTTTGTGG - Intergenic
980504798 4:133703898-133703920 TTTGTTCTAAAAAAATTTTGTGG - Intergenic
980535991 4:134124400-134124422 TTGGTACTAGTAAACTTTTGGGG - Intergenic
980624041 4:135348817-135348839 TCTGTTCTAAAAAATTTTTGTGG - Intergenic
980833626 4:138162272-138162294 TATGATCTAGAAAACATTTGAGG - Intergenic
983141603 4:164156207-164156229 TTTGTGCGAGAAAAATTTTTTGG - Intronic
984966485 4:185144238-185144260 TATCTGCTTGAAAACTTTGGAGG + Intronic
985999719 5:3620829-3620851 TGTTTGCTAGGAAACTATTGAGG - Intergenic
986405608 5:7421791-7421813 TGTGGGCTATGAAAGTTTTGAGG + Intronic
986914312 5:12598446-12598468 TGTGAGCTAGAAAACCTTAAAGG - Intergenic
988270893 5:29015256-29015278 TGTCTGCAATAAAACTTCTGAGG + Intergenic
989535102 5:42554031-42554053 AATGTGCTATATAACTTTTGTGG - Intronic
989707844 5:44359189-44359211 TATGTGCCAGTAAAGTTTTGAGG + Intronic
990236598 5:53775349-53775371 AGTTTGCTAGAATATTTTTGAGG - Intergenic
990842068 5:60093050-60093072 TGTGTCCCAGAAAAGTTGTGAGG + Intronic
992255785 5:74919676-74919698 TGTGTGCTAGGGACCTCTTGTGG + Intergenic
994879123 5:105463059-105463081 TGTATGCTAGAAAAGTGTTCTGG + Intergenic
995283591 5:110361974-110361996 TGTTTGCAAGAAAGCTTTTCAGG + Intronic
995616117 5:113966231-113966253 TTTATGCTAAAAAAATTTTGTGG - Intergenic
995793484 5:115918209-115918231 TGTGTGCCAGACAAATTTTCAGG + Intergenic
996595610 5:125199149-125199171 TGTGTGCTTAAGAAGTTTTGGGG - Intergenic
997983641 5:138486921-138486943 TCTGAGCTGGAAACCTTTTGTGG + Intergenic
998196538 5:140077745-140077767 TGTGTTTTTAAAAACTTTTGGGG + Intergenic
998330498 5:141321626-141321648 TGTGTTCTATAATACTTCTGGGG + Intergenic
998332625 5:141342789-141342811 TCTGTGCTTGGAAACTTATGGGG + Intronic
999789084 5:154921402-154921424 TATGTGCTAGAAATCTGTGGAGG + Exonic
999802997 5:155055039-155055061 TGTGTTCTACAGAACCTTTGGGG + Intergenic
1001398018 5:171430425-171430447 TCTGTGCTAGGAATCTCTTGAGG - Intronic
1005151680 6:22758859-22758881 TGTTTTCAGGAAAACTTTTGAGG - Intergenic
1007795717 6:44345379-44345401 TGCTTGCTTGAAAAGTTTTGTGG - Intronic
1008478839 6:51962957-51962979 TATGTGCTAGACATCTTTTAGGG - Intronic
1009817128 6:68750781-68750803 TATGTGCTTTAAAACTTTTCTGG - Intronic
1011485791 6:87840274-87840296 TGTGACCTAGATATCTTTTGGGG - Intergenic
1013754663 6:113446854-113446876 TGAGTACAAGAAAACTTTAGAGG + Intergenic
1014731901 6:125042082-125042104 TGTTTGCTAGTGATCTTTTGAGG + Intronic
1015246779 6:131083792-131083814 TGAGTGCTTGTAAACTTTTATGG - Intergenic
1015541578 6:134319645-134319667 TGTCTGTTAAAACACTTTTGGGG - Intergenic
1015968279 6:138716969-138716991 TGTGTGCTTTAAAAATTTTAGGG - Intergenic
1016331351 6:142955154-142955176 TGTGGGCTAGATGAGTTTTGAGG + Intergenic
1016373403 6:143396961-143396983 TTTGTGCTAGAATTCTTTAGTGG + Intergenic
1017211041 6:151856805-151856827 TGTGTGCTAGCATAACTTTGGGG + Intronic
1017429535 6:154357305-154357327 TGTGGGAAAGAAAAGTTTTGTGG - Intronic
1020539604 7:9443592-9443614 CGGGTGCTAGAAAAGTTTTAGGG + Intergenic
1021542311 7:21773873-21773895 TTTGTTCTAGAAAACTCTTTGGG - Exonic
1021897776 7:25253384-25253406 TGGATGCTAGAAGAATTTTGAGG + Intergenic
1022807653 7:33838790-33838812 TGTCTGCTAGAGCTCTTTTGTGG + Intergenic
1023251979 7:38273935-38273957 TGTATACAAGAAAACTTTTTAGG - Intergenic
1023689466 7:42771407-42771429 TGTGTGCTACACAACTTCTGGGG - Intergenic
1024822525 7:53350073-53350095 TGTGTGCAAGAAATGTATTGGGG + Intergenic
1028186583 7:87793421-87793443 GGTTTGCTAGTATACTTTTGAGG - Intronic
1028808435 7:95056204-95056226 TGTGTGCTAAAGAACTTTAATGG + Intronic
1031395221 7:121265489-121265511 TGTGTGCTCAAAAACTTTACTGG - Intronic
1031714191 7:125086761-125086783 TTTATGCTATACAACTTTTGTGG - Intergenic
1034131659 7:148723967-148723989 TGTTTGCTAGAAGACTTCAGAGG - Intronic
1037244739 8:16820538-16820560 TGTGTGCTGGAAACCCTTTTTGG + Intergenic
1038892329 8:31739572-31739594 TGTGTGCTAAAACATTGTTGTGG + Intronic
1038942795 8:32323937-32323959 TGTGTGATAGGAAACATTTTTGG - Intronic
1040542915 8:48375988-48376010 TGAGTGCTAGAAACCTAATGAGG - Intergenic
1041022676 8:53654073-53654095 TGTGTTCTACAAAACTCTGGGGG + Intergenic
1043415264 8:80041550-80041572 TGGGAACTAGACAACTTTTGAGG + Intronic
1045248929 8:100467086-100467108 TTTATGGTATAAAACTTTTGGGG - Intergenic
1046857969 8:119056370-119056392 TTTTTCCCAGAAAACTTTTGGGG - Intronic
1047083490 8:121491293-121491315 TGTGTGCTAGAGAACAGTGGCGG - Intergenic
1047571722 8:126106034-126106056 TTTGTTTTAGAGAACTTTTGAGG - Intergenic
1048370098 8:133769651-133769673 TTTGTGGTAAAATACTTTTGTGG - Intergenic
1050986430 9:12089132-12089154 CTTGTTCTTGAAAACTTTTGGGG - Intergenic
1051719495 9:20021600-20021622 TGTGTGCTTGAAAACGTCTTTGG - Intergenic
1057457271 9:95226215-95226237 AGTATGACAGAAAACTTTTGTGG + Intronic
1057997792 9:99835449-99835471 TGGGTGCTAGAAAAGTATTCAGG + Intronic
1058209098 9:102144989-102145011 TGTGTGCTAGTAAACGGCTGAGG - Intergenic
1059610551 9:115887879-115887901 TGTGTTCTAGAAAACATAGGGGG + Intergenic
1060409206 9:123389042-123389064 TGTATGCTAGAATTCTTTTGAGG + Intronic
1060846847 9:126844215-126844237 TGTGGGCTAGATAACTTAGGAGG + Intergenic
1186961190 X:14738022-14738044 TGTGTGCCATAAAATTTTGGAGG + Intergenic
1188415509 X:29928294-29928316 TGTGTGCTAGATAATTTCTGTGG - Intronic
1189055135 X:37691473-37691495 GGTATGCTAGTAAACTGTTGGGG + Intronic
1189133723 X:38527501-38527523 TGTATGGTAGGAAACTTCTGGGG - Intronic
1192562682 X:72137877-72137899 TGTGTATGAGAAAACCTTTGGGG + Intronic
1194013083 X:88585325-88585347 TGTATGCTAGAAAAATATTTTGG - Intergenic
1194279660 X:91933850-91933872 TTTTTACTAGAAAATTTTTGAGG - Intronic
1194354195 X:92860457-92860479 TGTTGGCTAGAATATTTTTGAGG - Intergenic
1195653452 X:107311682-107311704 TTTGTGATGGAGAACTTTTGAGG + Intergenic
1196482980 X:116172503-116172525 TATATGCTAGAAACCTTTTTAGG - Exonic
1196687636 X:118525788-118525810 TTTGTGCTAGAAAACTCTGGGGG + Intronic
1196724651 X:118885389-118885411 TGTGTGCAAGAAACCTCTAGTGG + Intergenic
1198056191 X:132997661-132997683 TGTCTGCTATAAAATATTTGTGG - Intergenic
1200597137 Y:5157331-5157353 TTTTTACTAGAAAATTTTTGAGG - Intronic