ID: 1162441336

View in Genome Browser
Species Human (GRCh38)
Location 19:10694139-10694161
Sequence GACCAGCCTGGCCAGCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162441336_1162441339 11 Left 1162441336 19:10694139-10694161 CCACCTTGCTGGCCAGGCTGGTC No data
Right 1162441339 19:10694173-10694195 ACCTCGTGATCCACTCGTCTTGG No data
1162441336_1162441342 27 Left 1162441336 19:10694139-10694161 CCACCTTGCTGGCCAGGCTGGTC No data
Right 1162441342 19:10694189-10694211 GTCTTGGCCTCCCAAAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162441336 Original CRISPR GACCAGCCTGGCCAGCAAGG TGG (reversed) Intergenic