ID: 1162441336 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:10694139-10694161 |
| Sequence | GACCAGCCTGGCCAGCAAGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1162441336_1162441342 | 27 | Left | 1162441336 | 19:10694139-10694161 | CCACCTTGCTGGCCAGGCTGGTC | No data | ||
| Right | 1162441342 | 19:10694189-10694211 | GTCTTGGCCTCCCAAAGTGCTGG | 0: 3058 1: 63262 2: 176853 3: 220638 4: 171177 |
||||
| 1162441336_1162441339 | 11 | Left | 1162441336 | 19:10694139-10694161 | CCACCTTGCTGGCCAGGCTGGTC | No data | ||
| Right | 1162441339 | 19:10694173-10694195 | ACCTCGTGATCCACTCGTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1162441336 | Original CRISPR | GACCAGCCTGGCCAGCAAGG TGG (reversed) | Intergenic | ||