ID: 1162441337

View in Genome Browser
Species Human (GRCh38)
Location 19:10694142-10694164
Sequence TGAGACCAGCCTGGCCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162441337_1162441342 24 Left 1162441337 19:10694142-10694164 CCTTGCTGGCCAGGCTGGTCTCA No data
Right 1162441342 19:10694189-10694211 GTCTTGGCCTCCCAAAGTGCTGG No data
1162441337_1162441339 8 Left 1162441337 19:10694142-10694164 CCTTGCTGGCCAGGCTGGTCTCA No data
Right 1162441339 19:10694173-10694195 ACCTCGTGATCCACTCGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162441337 Original CRISPR TGAGACCAGCCTGGCCAGCA AGG (reversed) Intergenic