ID: 1162441338

View in Genome Browser
Species Human (GRCh38)
Location 19:10694151-10694173
Sequence TCAAGAGTTTGAGACCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162441338_1162441339 -1 Left 1162441338 19:10694151-10694173 CCAGGCTGGTCTCAAACTCTTGA No data
Right 1162441339 19:10694173-10694195 ACCTCGTGATCCACTCGTCTTGG No data
1162441338_1162441344 24 Left 1162441338 19:10694151-10694173 CCAGGCTGGTCTCAAACTCTTGA No data
Right 1162441344 19:10694198-10694220 TCCCAAAGTGCTGGTATTACAGG No data
1162441338_1162441342 15 Left 1162441338 19:10694151-10694173 CCAGGCTGGTCTCAAACTCTTGA No data
Right 1162441342 19:10694189-10694211 GTCTTGGCCTCCCAAAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162441338 Original CRISPR TCAAGAGTTTGAGACCAGCC TGG (reversed) Intergenic