ID: 1162441339

View in Genome Browser
Species Human (GRCh38)
Location 19:10694173-10694195
Sequence ACCTCGTGATCCACTCGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162441338_1162441339 -1 Left 1162441338 19:10694151-10694173 CCAGGCTGGTCTCAAACTCTTGA No data
Right 1162441339 19:10694173-10694195 ACCTCGTGATCCACTCGTCTTGG No data
1162441336_1162441339 11 Left 1162441336 19:10694139-10694161 CCACCTTGCTGGCCAGGCTGGTC No data
Right 1162441339 19:10694173-10694195 ACCTCGTGATCCACTCGTCTTGG No data
1162441337_1162441339 8 Left 1162441337 19:10694142-10694164 CCTTGCTGGCCAGGCTGGTCTCA No data
Right 1162441339 19:10694173-10694195 ACCTCGTGATCCACTCGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162441339 Original CRISPR ACCTCGTGATCCACTCGTCT TGG Intergenic