ID: 1162441340

View in Genome Browser
Species Human (GRCh38)
Location 19:10694174-10694196
Sequence GCCAAGACGAGTGGATCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162441340_1162441344 1 Left 1162441340 19:10694174-10694196 CCTCGTGATCCACTCGTCTTGGC No data
Right 1162441344 19:10694198-10694220 TCCCAAAGTGCTGGTATTACAGG No data
1162441340_1162441342 -8 Left 1162441340 19:10694174-10694196 CCTCGTGATCCACTCGTCTTGGC No data
Right 1162441342 19:10694189-10694211 GTCTTGGCCTCCCAAAGTGCTGG No data
1162441340_1162441347 15 Left 1162441340 19:10694174-10694196 CCTCGTGATCCACTCGTCTTGGC No data
Right 1162441347 19:10694212-10694234 TATTACAGGCGTGAGCCACACGG No data
1162441340_1162441348 22 Left 1162441340 19:10694174-10694196 CCTCGTGATCCACTCGTCTTGGC No data
Right 1162441348 19:10694219-10694241 GGCGTGAGCCACACGGCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162441340 Original CRISPR GCCAAGACGAGTGGATCACG AGG (reversed) Intergenic