ID: 1162441340 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:10694174-10694196 |
| Sequence | GCCAAGACGAGTGGATCACG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1162441340_1162441344 | 1 | Left | 1162441340 | 19:10694174-10694196 | CCTCGTGATCCACTCGTCTTGGC | No data | ||
| Right | 1162441344 | 19:10694198-10694220 | TCCCAAAGTGCTGGTATTACAGG | No data | ||||
| 1162441340_1162441342 | -8 | Left | 1162441340 | 19:10694174-10694196 | CCTCGTGATCCACTCGTCTTGGC | No data | ||
| Right | 1162441342 | 19:10694189-10694211 | GTCTTGGCCTCCCAAAGTGCTGG | No data | ||||
| 1162441340_1162441347 | 15 | Left | 1162441340 | 19:10694174-10694196 | CCTCGTGATCCACTCGTCTTGGC | No data | ||
| Right | 1162441347 | 19:10694212-10694234 | TATTACAGGCGTGAGCCACACGG | No data | ||||
| 1162441340_1162441348 | 22 | Left | 1162441340 | 19:10694174-10694196 | CCTCGTGATCCACTCGTCTTGGC | No data | ||
| Right | 1162441348 | 19:10694219-10694241 | GGCGTGAGCCACACGGCGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1162441340 | Original CRISPR | GCCAAGACGAGTGGATCACG AGG (reversed) | Intergenic | ||