ID: 1162442630

View in Genome Browser
Species Human (GRCh38)
Location 19:10702233-10702255
Sequence GTGCAGATCCAGAATGCGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162442619_1162442630 21 Left 1162442619 19:10702189-10702211 CCCCCTACGACGGCAATGAGACC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1162442630 19:10702233-10702255 GTGCAGATCCAGAATGCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 61
1162442620_1162442630 20 Left 1162442620 19:10702190-10702212 CCCCTACGACGGCAATGAGACCC 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1162442630 19:10702233-10702255 GTGCAGATCCAGAATGCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 61
1162442626_1162442630 -10 Left 1162442626 19:10702220-10702242 CCCGGAGAAATCCGTGCAGATCC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1162442630 19:10702233-10702255 GTGCAGATCCAGAATGCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 61
1162442625_1162442630 -1 Left 1162442625 19:10702211-10702233 CCTGCTGAGCCCGGAGAAATCCG 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1162442630 19:10702233-10702255 GTGCAGATCCAGAATGCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 61
1162442624_1162442630 0 Left 1162442624 19:10702210-10702232 CCCTGCTGAGCCCGGAGAAATCC 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1162442630 19:10702233-10702255 GTGCAGATCCAGAATGCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 61
1162442622_1162442630 18 Left 1162442622 19:10702192-10702214 CCTACGACGGCAATGAGACCCTG 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1162442630 19:10702233-10702255 GTGCAGATCCAGAATGCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 61
1162442621_1162442630 19 Left 1162442621 19:10702191-10702213 CCCTACGACGGCAATGAGACCCT 0: 1
1: 0
2: 0
3: 3
4: 15
Right 1162442630 19:10702233-10702255 GTGCAGATCCAGAATGCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 61
1162442618_1162442630 26 Left 1162442618 19:10702184-10702206 CCGCTCCCCCTACGACGGCAATG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1162442630 19:10702233-10702255 GTGCAGATCCAGAATGCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162442630 Original CRISPR GTGCAGATCCAGAATGCGCT GGG Exonic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
905225049 1:36473479-36473501 GTGCAGGCAGAGAATGCGCTGGG - Exonic
911721352 1:101194720-101194742 GTGAAGATCCTGAATAAGCTGGG - Intergenic
913124826 1:115776311-115776333 GTGCAGGTCCAGATTGCATTTGG + Intergenic
915362297 1:155293433-155293455 GTGAAGATGCAGCATGCGGTAGG - Exonic
1067670855 10:48319785-48319807 TGAGAGATCCAGAATGCGCTGGG - Intronic
1069705390 10:70456328-70456350 TTTCAGAGCCAGAAAGCGCTGGG + Intergenic
1074088071 10:110223735-110223757 GTCCAGATCCAAAATGACCTGGG + Intronic
1077454681 11:2671396-2671418 GTGCACATCCAGAGTACCCTGGG - Intronic
1077899741 11:6478781-6478803 CTGCAGACCCAGCATGCACTGGG - Exonic
1078611055 11:12819965-12819987 GTGGAGAAACAGAATGGGCTGGG + Intronic
1080123964 11:28709579-28709601 GTGCAAATACATAATGCCCTTGG + Intergenic
1082956781 11:58878390-58878412 GTGAAGATCCAAAATGCGAGAGG - Intronic
1089410602 11:118238698-118238720 GTGCAGATCTCTAATGTGCTAGG + Intronic
1092124762 12:6067155-6067177 CAGCACATCCAGAATGGGCTGGG - Intronic
1102734398 12:115145449-115145471 GTGGAGATCCAGAAGCCACTGGG - Intergenic
1105468281 13:20667804-20667826 GGGCAGATCCAGAATGTGTGGGG - Intronic
1108615709 13:52129556-52129578 GTGCAAATCCAGAATGGGGCAGG - Intergenic
1110224733 13:73107768-73107790 GTGCAGCTCCCGAAAGAGCTGGG + Intergenic
1118839662 14:69500975-69500997 CTGCAGATCCAGGATGGGGTGGG + Intronic
1118882833 14:69843363-69843385 GTGCAGCTCGGGACTGCGCTTGG + Intergenic
1121558470 14:94856521-94856543 GTGGAGCTGCAGAATGTGCTCGG - Intergenic
1122679952 14:103452086-103452108 GTCCAGAGCCATAATACGCTAGG + Intronic
1125412277 15:39417892-39417914 GTGGAGAGCCAGAATGCTGTTGG + Intergenic
1129882630 15:79017133-79017155 GAGCAGACCCAGAATGCCCATGG - Intronic
1140507053 16:75480039-75480061 GTACAAATGCAGAATGCGGTCGG + Intronic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1148190880 17:45677897-45677919 GTGCAAACCCAGAATAAGCTGGG - Intergenic
1150692687 17:67378633-67378655 GTGCAGATCCCGAGGGCGCAGGG - Intronic
1160579084 18:79873490-79873512 GAGCACATCCAGCCTGCGCTTGG + Intronic
1162442630 19:10702233-10702255 GTGCAGATCCAGAATGCGCTGGG + Exonic
929816443 2:45236672-45236694 GTGCATATCCAGAGTTTGCTAGG - Intergenic
930221189 2:48748360-48748382 GAAAAGATCCAGAATGGGCTTGG + Intronic
932125225 2:69139243-69139265 GGGCAGGTCCAGAAAGCACTGGG - Intronic
935469470 2:103439632-103439654 ATGCAGATCTAGAGTGAGCTGGG - Intergenic
943745135 2:191454365-191454387 GTGCACAGACAGAATGAGCTTGG + Intergenic
944410109 2:199432139-199432161 GCTCAGATTCAGACTGCGCTGGG + Intronic
947759607 2:232594124-232594146 GGGCGGATCCAGGATGAGCTTGG + Intergenic
1184100163 22:42337907-42337929 GTCCAAATCCAGAATGGGCCTGG + Intronic
953229256 3:41050133-41050155 GAGAAGATCCAGAATTCTCTGGG + Intergenic
955506746 3:59640122-59640144 GTGCTGCTCCAGAATGCAATGGG + Intergenic
956748296 3:72326969-72326991 GTGCAGACCCAGCATGCCCTAGG + Intergenic
957021093 3:75127281-75127303 GTGCAGCTCCACAATGTGTTTGG + Intergenic
962411388 3:135144173-135144195 GTGCAGAACCAGAAACAGCTGGG - Intronic
975472596 4:74787610-74787632 TTGCAGATCCAGTATCAGCTGGG + Intronic
985796258 5:1964255-1964277 GTTCTGAACCAGAATGCGCAGGG - Intergenic
990511535 5:56493491-56493513 GTGCAGATCCTGAATGGAGTAGG - Intergenic
991480175 5:67069565-67069587 GTGCATATCCAGAACATGCTGGG - Intronic
999991006 5:157049784-157049806 ATGCAGATGCAGAAGGAGCTGGG - Intronic
1000662286 5:163951328-163951350 GTGCAGCTACACAATGCCCTAGG + Intergenic
1007636968 6:43305541-43305563 TTGAAGCTCCAGAATGTGCTGGG + Exonic
1011157608 6:84350455-84350477 GTGCAGTTTCAAAATGCTCTGGG - Intergenic
1012857432 6:104518802-104518824 GGGCACATCCAGACTGCCCTGGG - Intergenic
1015538750 6:134293917-134293939 GTGTACATCCAGAAGGTGCTAGG + Intronic
1017886655 6:158605665-158605687 GTGCAGATGCAGCATGCTCTTGG + Intronic
1020518039 7:9149969-9149991 GTGCAGATACACAATTTGCTAGG + Intergenic
1022614159 7:31911562-31911584 GTGAAGATCCAGGGTGTGCTGGG - Intronic
1038214884 8:25552497-25552519 GTGAAGATCCAGAATGAAATGGG + Intergenic
1044966925 8:97582786-97582808 GTGCAGCTCTAGAATGAGGTGGG - Intergenic
1052999918 9:34572186-34572208 CTGCAGATCCAGAAAGCCCCAGG + Intronic
1056615684 9:88163691-88163713 GTGCAGATCCAGCATGGCATGGG - Intergenic
1186339562 X:8629540-8629562 ATTCAGTTCCAGAATGCCCTAGG + Intronic
1192037368 X:67578779-67578801 GTGCATAGACAGAATGGGCTGGG + Intronic
1201944410 Y:19496377-19496399 GACCAGATCAAGAATGTGCTTGG - Intergenic