ID: 1162445117

View in Genome Browser
Species Human (GRCh38)
Location 19:10718176-10718198
Sequence GCCAGGTCGTTGAGGGTCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162445108_1162445117 15 Left 1162445108 19:10718138-10718160 CCGGGCGGGCGGGGAGCAACGGC 0: 1
1: 0
2: 1
3: 9
4: 132
Right 1162445117 19:10718176-10718198 GCCAGGTCGTTGAGGGTCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 76
1162445105_1162445117 22 Left 1162445105 19:10718131-10718153 CCGAGGCCCGGGCGGGCGGGGAG 0: 1
1: 0
2: 3
3: 52
4: 420
Right 1162445117 19:10718176-10718198 GCCAGGTCGTTGAGGGTCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 76
1162445106_1162445117 16 Left 1162445106 19:10718137-10718159 CCCGGGCGGGCGGGGAGCAACGG 0: 1
1: 0
2: 0
3: 19
4: 173
Right 1162445117 19:10718176-10718198 GCCAGGTCGTTGAGGGTCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162445117 Original CRISPR GCCAGGTCGTTGAGGGTCGG CGG Exonic
900501544 1:3007912-3007934 CACAGGTCGTTGAGTGTCTGTGG - Intergenic
903848223 1:26290952-26290974 GCCAGGTGCTTCAGGGTCTGTGG - Intronic
906961732 1:50423094-50423116 GGCAGGTAGTTGAGGGCCGCAGG - Exonic
909104796 1:71394092-71394114 CCCAGGTTGTTGAGGGCCTGTGG - Intergenic
915972309 1:160363324-160363346 GCCTTGTCCTTGAGGGTGGGGGG - Intergenic
919861221 1:201740450-201740472 GCCCGGCCTGTGAGGGTCGGGGG + Intronic
924508170 1:244705475-244705497 GCCAGGGAGTGGAGGGTGGGAGG - Intronic
1063394120 10:5670612-5670634 GTCAGGACGGTGGGGGTCGGGGG + Intergenic
1069569441 10:69485525-69485547 GCCACGTGGCTGAGGGTAGGTGG + Intronic
1076538608 10:131199075-131199097 GCCAGGCCCTTGAGGGTGGAAGG - Intronic
1078268132 11:9770144-9770166 AGGAGGTTGTTGAGGGTCGGGGG + Intergenic
1079610179 11:22423306-22423328 GCCAGGGTGTTGAGGGTTTGGGG - Intergenic
1081992788 11:47346698-47346720 TCCAGGTCTTTGAGGGAAGGTGG - Intronic
1090977016 11:131687468-131687490 GCCAGGCCGGTGATGGTCTGAGG - Intronic
1091308086 11:134553389-134553411 GACAGGTCATTGAGTGCCGGGGG + Intergenic
1092443943 12:8536128-8536150 ACCAGGTTGTCGAGGGTCAGTGG - Exonic
1096512879 12:52141467-52141489 GCCATGTGGTTGAGGGTGGGAGG - Intergenic
1105758673 13:23493326-23493348 GCCAGGCAGTTGAGGGAAGGTGG - Intergenic
1106559259 13:30834370-30834392 CCCAGGTTGATGAGGGTGGGGGG - Intergenic
1110035049 13:70672696-70672718 GTCAGGTCCTTGAGGGCCTGGGG - Intergenic
1110079752 13:71295414-71295436 GCCAGGTCCTTTAGGGAAGGGGG + Intergenic
1114073474 14:19133163-19133185 GCAAGGAGGTAGAGGGTCGGTGG - Intergenic
1114088791 14:19266820-19266842 GCAAGGAGGTAGAGGGTCGGTGG + Intergenic
1114664465 14:24369666-24369688 GCCAGGTCGGTGAGGCTGGGAGG + Exonic
1121855459 14:97265537-97265559 GCCAGTGCGGTGAGGGTTGGGGG + Intergenic
1127103942 15:55593382-55593404 ACCAGGTGGTGGAGGGTGGGAGG + Intergenic
1127123376 15:55789941-55789963 GGCAGGTGGTGGAGGGTGGGGGG - Intergenic
1132759285 16:1501020-1501042 GCCAGGTCGCTCTGGGTCGGTGG + Intronic
1134418106 16:14062014-14062036 GCCAGGGCTTTGTGGGTCTGGGG + Intergenic
1136535472 16:30896691-30896713 GCCGGGTCGCTGAGGGGCGCAGG + Intronic
1138439747 16:57026876-57026898 GCCAGGTCGGTGCAGGTCAGTGG - Exonic
1142852196 17:2709662-2709684 TCTAGGCCATTGAGGGTCGGGGG - Intronic
1147505406 17:41011696-41011718 GCCAGGTCATTGAAGGTCTTGGG + Intronic
1148048353 17:44757719-44757741 GGCAGGTGGTTGGGGGTGGGGGG + Intergenic
1161135554 19:2617502-2617524 GCCAGGTCTTTGAGGGCTGGAGG - Intronic
1162445117 19:10718176-10718198 GCCAGGTCGTTGAGGGTCGGCGG + Exonic
1162759644 19:12881112-12881134 GCCAGCTCTTAGAGGGTCCGGGG - Exonic
1163054240 19:14706368-14706390 GCCAGGAGGTTGAGGGGTGGAGG - Intronic
1163083245 19:14958736-14958758 GCCAGGTGGCTGAGTGTAGGGGG - Intronic
1166105760 19:40597338-40597360 GCCAGGTCGTCGAGGTCCCGGGG + Exonic
1166949382 19:46416462-46416484 GCCAGGTCGTTGGGCTTCGCTGG + Intergenic
930634163 2:53786803-53786825 GGCAGGTCGGTGAGTCTCGGAGG - Exonic
931669751 2:64636540-64636562 GCCAGGTGGCTGAAGGCCGGCGG + Exonic
932772432 2:74507970-74507992 GCCAGGCCTTTGGGGGTAGGAGG - Exonic
935719867 2:105970612-105970634 GCCAGGTCTCTGAGATTCGGGGG + Intergenic
938310564 2:130286026-130286048 GCCTGGTCCTGGAGGGTGGGGGG + Intergenic
941287527 2:163632447-163632469 GCCAGCTGGTTGAAAGTCGGGGG - Intronic
942292497 2:174486749-174486771 GCCAGGGCGCAGAGGGTCGGCGG + Intronic
944632570 2:201642651-201642673 GCCAGGTGCTTGGGGGCCGGCGG - Intronic
948839857 2:240643544-240643566 GCCAGGTGGCAGAGGGGCGGCGG + Intergenic
1169690787 20:8329271-8329293 GCCAGGTCTTTGAGTATAGGTGG + Intronic
1176382121 21:6118802-6118824 GGCAGGTCGGAAAGGGTCGGTGG - Exonic
1179741351 21:43419437-43419459 GGCAGGTCGGAAAGGGTCGGTGG + Exonic
1180188160 21:46150656-46150678 GCCAGCTCAGTGAGGGACGGAGG - Intronic
1180491916 22:15855516-15855538 GCAAGGAGGTAGAGGGTCGGTGG - Intergenic
1180897985 22:19351183-19351205 GCCAGGTTGTGGAGGGCCGTCGG + Intronic
1182422043 22:30253438-30253460 GCCAGGGCGTTGTGGAGCGGGGG - Intergenic
1185419764 22:50728823-50728845 GCCAGGTGGTGTTGGGTCGGGGG - Intergenic
950469015 3:13173319-13173341 GACAGGTGGGTGAGGGTCCGAGG - Intergenic
951672374 3:25199299-25199321 GAAAGGTCGTTGAAGGTTGGGGG + Intronic
953033081 3:39190646-39190668 GGTAGGTCATTGAGGGGCGGGGG - Intronic
953411334 3:42692030-42692052 GCCAGGCCAGTGAGGGTCGCAGG - Exonic
954331870 3:49895521-49895543 GCCAGGTCATTCAGGTTGGGAGG + Exonic
960139660 3:114139842-114139864 GTCAGGTCCTTGAGGGTAGAAGG + Intronic
969720546 4:8891142-8891164 CCCAGGTCGTGGTGGGTCGCCGG + Intergenic
982723793 4:158884529-158884551 GCCAGGTCCTTGAGGGATTGTGG + Intronic
984784550 4:183555392-183555414 CCCAGCACGTTGAGGGTCTGAGG + Intergenic
993482044 5:88435571-88435593 GTTAGGTGGTTGAGGGTGGGGGG + Intergenic
997267330 5:132502481-132502503 GCCCGGTAGGTGAGGGTCTGAGG - Intergenic
997975361 5:138438903-138438925 GGCAGGGCACTGAGGGTCGGAGG + Intergenic
1000226178 5:159263732-159263754 GCGAGGTGGTGCAGGGTCGGGGG - Intronic
1001794906 5:174493713-174493735 GCCAGGACGTTAAGGGGAGGGGG + Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1019989816 7:4683133-4683155 TCCAGGCCGGTGGGGGTCGGGGG - Intronic
1027236970 7:76303878-76303900 GCCAGGTCGGGGTGGGTGGGTGG + Intronic
1029111141 7:98213558-98213580 GCCTGGTTGTGGAGGGTCTGGGG + Intergenic
1035236063 7:157498316-157498338 GCCAGGACTCTGAGGGTGGGAGG - Intergenic
1053886830 9:42650004-42650026 GCCAGGTGGGTGAGGGTGTGCGG - Intergenic
1054225849 9:62457454-62457476 GCCAGGTGGGTGAGGGTGTGCGG - Intergenic
1056569570 9:87803476-87803498 GCCAGGTAGTGAAGGGTTGGAGG - Intergenic
1061993498 9:134172726-134172748 GCCAGCTCCTGGAGGGTCGATGG - Intergenic
1194832797 X:98645713-98645735 GCCGGGTCCCTAAGGGTCGGTGG - Intergenic
1199628377 X:149760246-149760268 GCCAGGTGGTTGGGGGTGGGAGG + Intergenic