ID: 1162446155

View in Genome Browser
Species Human (GRCh38)
Location 19:10724101-10724123
Sequence CGATAAGTATGATGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162446149_1162446155 30 Left 1162446149 19:10724048-10724070 CCTTCCAGCCTGGGCGGAAGAAC 0: 1
1: 1
2: 73
3: 1187
4: 3468
Right 1162446155 19:10724101-10724123 CGATAAGTATGATGGAAAAAAGG 0: 1
1: 0
2: 1
3: 8
4: 189
1162446152_1162446155 3 Left 1162446152 19:10724075-10724097 CCTCGTCTCAAAAAAAAAAAAAA 0: 958
1: 16714
2: 20366
3: 47370
4: 185172
Right 1162446155 19:10724101-10724123 CGATAAGTATGATGGAAAAAAGG 0: 1
1: 0
2: 1
3: 8
4: 189
1162446150_1162446155 26 Left 1162446150 19:10724052-10724074 CCAGCCTGGGCGGAAGAACGAGA 0: 1
1: 39
2: 2135
3: 36786
4: 116087
Right 1162446155 19:10724101-10724123 CGATAAGTATGATGGAAAAAAGG 0: 1
1: 0
2: 1
3: 8
4: 189
1162446151_1162446155 22 Left 1162446151 19:10724056-10724078 CCTGGGCGGAAGAACGAGACCTC 0: 1
1: 0
2: 8
3: 167
4: 3280
Right 1162446155 19:10724101-10724123 CGATAAGTATGATGGAAAAAAGG 0: 1
1: 0
2: 1
3: 8
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162446155 Original CRISPR CGATAAGTATGATGGAAAAA AGG Intronic
903047751 1:20576904-20576926 TGATAAGTTCCATGGAAAAAAGG - Intergenic
905228247 1:36493876-36493898 GGATGAGTATGATGGGTAAATGG - Intergenic
908349212 1:63267727-63267749 TGCTAATAATGATGGAAAAAGGG + Intergenic
908700434 1:66893183-66893205 CAATATATATGATAGAAAAAAGG + Intronic
910969681 1:92843739-92843761 TGATAAGTATGATTTGAAAATGG - Exonic
912897949 1:113613352-113613374 AGAAAAGTATGGTGGAGAAATGG + Intronic
916909338 1:169328558-169328580 AAATCAGTATGAAGGAAAAAGGG + Intronic
917195771 1:172464124-172464146 TGAAAAGAATGAAGGAAAAAAGG + Intronic
917447831 1:175121638-175121660 AGGTAAGCATGATGGCAAAAGGG + Intronic
918884442 1:190173078-190173100 CCAAAAGTATGATAGAAACAAGG - Intronic
919450314 1:197764566-197764588 CAACACGTATGGTGGAAAAATGG + Intronic
920667933 1:207979781-207979803 AGAGAAATATGATGGAAGAATGG - Intergenic
920679106 1:208059273-208059295 AGATGAGGAAGATGGAAAAAGGG - Intronic
923867110 1:237951275-237951297 GGATAAATATGGTGGAAAAGTGG + Intergenic
924418075 1:243880298-243880320 CTAAAAGTCTGATGGATAAAAGG - Intergenic
1065147207 10:22781526-22781548 CTGGAAATATGATGGAAAAAAGG + Intergenic
1065267178 10:23989411-23989433 GGAGAAGTATGAGGGACAAAGGG + Intronic
1066322402 10:34317204-34317226 TGATAAGACTGATAGAAAAAAGG - Exonic
1068295316 10:55063479-55063501 CAACTAGTATGAGGGAAAAATGG - Intronic
1068884912 10:62088249-62088271 CCAAAAGTATCAAGGAAAAATGG - Intronic
1071416150 10:85443867-85443889 AGAAAAGAATGAAGGAAAAAGGG + Intergenic
1071862731 10:89690879-89690901 GGGCAACTATGATGGAAAAATGG + Intergenic
1071922335 10:90365147-90365169 AGATAAAGATGATGGAAAAGAGG + Intergenic
1074505901 10:114070268-114070290 TGATGAGTATTATGGACAAAAGG + Intergenic
1074598782 10:114892206-114892228 TGATAAGTATGTTGGAAAAATGG - Intronic
1075877467 10:125819928-125819950 ACATAAGTATGAGGGTAAAATGG - Intronic
1079493766 11:21017819-21017841 AGATAAGGATGATAGAAAGATGG - Intronic
1079668968 11:23142256-23142278 CAATAAATATGATTAAAAAATGG + Intergenic
1079836117 11:25335094-25335116 CGATAAGTATGTTAAAATAAAGG - Intergenic
1080043760 11:27786741-27786763 GAAAAAGTATGATGAAAAAAGGG + Intergenic
1080487384 11:32724190-32724212 AGAAAAGTATGAGGGAAAACTGG - Intronic
1086417892 11:86607368-86607390 CAATGAGTATGGTGGGAAAAGGG - Intronic
1087280400 11:96203005-96203027 CAATAAATATGTTGAAAAAAAGG + Intronic
1087548202 11:99611736-99611758 CTATTAGAATGACGGAAAAAAGG - Intronic
1088627598 11:111741942-111741964 TGATAAGTATTATGGGAAACAGG - Intronic
1091425704 12:387474-387496 AGGTAATTATGATAGAAAAAAGG + Intronic
1093862366 12:24181838-24181860 CAATAACTATGATTCAAAAATGG + Intergenic
1093981695 12:25482077-25482099 GGATAAGTATGAGGATAAAATGG + Intronic
1098266882 12:68730585-68730607 CGATAAATATATTGGAAAATTGG - Intronic
1103976094 12:124703713-124703735 TGATGATTAAGATGGAAAAAGGG + Intergenic
1105965591 13:25381361-25381383 AAATAAGCATGTTGGAAAAATGG + Intronic
1106647257 13:31649824-31649846 CAATTAGTATGTTAGAAAAATGG + Intergenic
1106813505 13:33382803-33382825 CGATAAGCATTATAGAAAAATGG + Intergenic
1107526165 13:41233836-41233858 TGCTGAGTAAGATGGAAAAAGGG + Intronic
1109387247 13:61647213-61647235 CTATAAGTATAAAGGAATAAAGG - Intergenic
1110006284 13:70275245-70275267 GGTTAATTATGAAGGAAAAAGGG + Intergenic
1111570353 13:90076701-90076723 AAATAATTAAGATGGAAAAAAGG - Intergenic
1111588940 13:90318631-90318653 CTATAAGCATGATGAAAAAAAGG + Intergenic
1113445018 13:110359157-110359179 AGATAAGTAAGAGGAAAAAAGGG + Intronic
1114005760 14:18311676-18311698 TCATAAATATGATGTAAAAAAGG - Intergenic
1116727917 14:48586037-48586059 CGATAAGATGGATGGATAAAAGG + Intergenic
1117545689 14:56793469-56793491 CAATACATATGAAGGAAAAAAGG + Intergenic
1118629697 14:67691358-67691380 AAATAAATATGAAGGAAAAATGG - Intronic
1118643239 14:67813076-67813098 CGATAAATATCATGCAAAAGTGG + Intronic
1118683048 14:68262851-68262873 AGAGAAGTATGATTGGAAAAAGG - Intronic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1125065059 15:35472586-35472608 CAATGAGTATGAAGGCAAAAAGG + Intronic
1127495604 15:59509119-59509141 CAATAATTATGAAGGAAAAGTGG - Intronic
1128967466 15:72073776-72073798 TGATAAGTATTATGTAAATATGG + Intronic
1130644176 15:85709231-85709253 TGATAAGTACTATGGAAAAAAGG - Intronic
1131933083 15:97467785-97467807 TGATAATGATGATGCAAAAATGG + Intergenic
1133553568 16:6882884-6882906 TGGTAAGTATAATGGAAAATAGG - Intronic
1133593002 16:7264221-7264243 AGGTAAATATGAAGGAAAAAGGG + Intronic
1135632910 16:24049876-24049898 CTATAAGCATCATGGAATAAGGG + Intronic
1138699832 16:58850841-58850863 AGATAAGATTGATGGAAAAGTGG + Intergenic
1141308847 16:82893819-82893841 CGATAAGTCACATGGAAAGAAGG - Intronic
1141773029 16:86102350-86102372 AGAAAAGGAGGATGGAAAAAAGG - Intergenic
1149126208 17:53236656-53236678 AGAAAATTCTGATGGAAAAAAGG - Intergenic
1150384988 17:64751723-64751745 TTAAAAGTATGAGGGAAAAAAGG + Intergenic
1151100937 17:71554669-71554691 CCATAAGTATGATGGACTTAAGG + Intergenic
1151132151 17:71908349-71908371 CAATAATTATGATTGATAAAAGG + Intergenic
1154531668 18:15352205-15352227 TCATAAATATGATGTAAAAAAGG + Intergenic
1156864621 18:41874949-41874971 CTATATTTATCATGGAAAAAGGG - Intergenic
1157090142 18:44627304-44627326 CCATCAGTATCATGGAATAAAGG + Intergenic
1157275144 18:46304947-46304969 TGATGAGTATGATGGGGAAAGGG - Intergenic
1157399341 18:47373975-47373997 CAGTAAGTTTGATGAAAAAAAGG + Intergenic
1159243522 18:65775056-65775078 AGAAAAGTAAGATGGAAAGATGG + Intronic
1162446155 19:10724101-10724123 CGATAAGTATGATGGAAAAAAGG + Intronic
1163210298 19:15835313-15835335 CTATTCGTATGATGGAAAATGGG + Intergenic
1163353831 19:16796740-16796762 TGATAACTATGATGGAAGGAAGG - Intronic
1163717802 19:18882108-18882130 TGATAAGAATTATGGAGAAAAGG - Intronic
925199328 2:1953360-1953382 GGATGAGAATGATGGAAAATGGG - Intronic
929822205 2:45282698-45282720 GGAGAAGGAAGATGGAAAAAAGG - Intergenic
935657912 2:105440810-105440832 TGATATGTATGATGGAAGAGGGG + Intergenic
936851447 2:116903542-116903564 CAGTAAGTAAGGTGGAAAAAAGG - Intergenic
937452312 2:122011643-122011665 GGAAATGTATGATGGAGAAAAGG - Intergenic
940182819 2:150954482-150954504 AGATAATTCTTATGGAAAAATGG + Intergenic
941331610 2:164184475-164184497 TGATGAGTAAGAGGGAAAAAAGG + Intergenic
942417960 2:175778436-175778458 TGAAAATCATGATGGAAAAAGGG + Intergenic
945734352 2:213580250-213580272 GGAGAAGTATGATGGACAAGGGG - Intronic
947646502 2:231745732-231745754 CCATAAATATTATGGAAGAATGG + Intronic
1170129577 20:13004520-13004542 AGAGATGTATGATGGAAGAAAGG + Intergenic
1173131557 20:40398684-40398706 CGATAATTACCATGGAAAGAAGG + Intergenic
1173805959 20:45925533-45925555 CGATAAGTAAGACGGACAGACGG - Intergenic
1176765689 21:13015963-13015985 TCATAAATATGATGTAAAAAAGG - Intergenic
1176892934 21:14340458-14340480 AGAAAAGTATGATGTAACAAAGG + Intergenic
1177064788 21:16416852-16416874 AAATAAGTATCATGGAAAAGTGG + Intergenic
1177298056 21:19202605-19202627 CATGAAGTATGATGGAAAAATGG - Intergenic
1178000870 21:28161174-28161196 CTATCAAAATGATGGAAAAAAGG - Intergenic
1178797556 21:35759031-35759053 TGATAAATATGGTGGAAACAGGG + Intronic
1180430268 22:15242483-15242505 TCATAAATATGATGTAAAAAAGG - Intergenic
1180512873 22:16110712-16110734 TCATAAATATGATGTAAAAAAGG - Intergenic
1182530273 22:30950307-30950329 CAATAAGTATTTTGTAAAAATGG + Intronic
1182977207 22:34634641-34634663 TGATCTGTATGATAGAAAAAGGG + Intergenic
949685003 3:6559032-6559054 CGATATGAAAGATTGAAAAATGG - Intergenic
950152863 3:10701769-10701791 TGTTATGTATGATGGAAGAAAGG + Intronic
951634911 3:24763208-24763230 TGATCAGTATTATGGACAAAAGG + Intergenic
952015413 3:28951004-28951026 GGATAAGTATGATTGGACAAAGG + Intergenic
952996312 3:38886045-38886067 GGATAGTTATTATGGAAAAATGG - Intronic
953278950 3:41533346-41533368 GGAGATGTATGAAGGAAAAAGGG - Intronic
954562172 3:51566231-51566253 CAATAAGTAAGACGAAAAAAAGG - Intronic
956969548 3:74506766-74506788 CAATAAGTATAATAGAAAGAGGG - Intronic
957298579 3:78362362-78362384 TGATAGGTATGGGGGAAAAAAGG + Intergenic
957582922 3:82099197-82099219 AGATAGGTTTGATGGAAAATAGG - Intergenic
958870028 3:99547505-99547527 CCATTAGTCTGATGGAGAAATGG + Intergenic
959414757 3:106070803-106070825 AGAAAAGTGTGATGGAATAAAGG - Intergenic
959874114 3:111361614-111361636 CGAGAAGTATATTGAAAAAAAGG + Intronic
962178914 3:133184801-133184823 CAGTAAGTATGATGTAGAAAAGG + Intronic
964350134 3:155794450-155794472 AGATAGGAAGGATGGAAAAAAGG + Intronic
964731358 3:159869460-159869482 CAATAAATATGATAAAAAAATGG - Intronic
964825423 3:160821735-160821757 CCACAAATATAATGGAAAAAAGG - Intronic
965116799 3:164500728-164500750 CTTAAAGTATGATTGAAAAAAGG - Intergenic
965666085 3:171094800-171094822 TGAGAACTATGAAGGAAAAAGGG - Intronic
967677762 3:192319913-192319935 AGATAAGAAAGAAGGAAAAAAGG + Intronic
971677436 4:29651432-29651454 TGTTAAGAATGATGAAAAAATGG + Intergenic
975497722 4:75053043-75053065 AGATATGGAAGATGGAAAAAAGG - Intergenic
975630851 4:76400633-76400655 AAATAAGTATTATGGAAAACTGG + Intronic
976269008 4:83211828-83211850 AAATAAGTTTGAGGGAAAAAAGG - Intergenic
977964038 4:103121977-103121999 AGACAAGTTTGATGCAAAAATGG - Intronic
978730102 4:112015711-112015733 TGACAAGTATGATGAAAACAAGG + Intergenic
979384671 4:120050386-120050408 CTATGTGAATGATGGAAAAAAGG - Intergenic
980177049 4:129358893-129358915 GGTTAATTTTGATGGAAAAAAGG + Intergenic
982135207 4:152268638-152268660 AAATAAAGATGATGGAAAAATGG + Intergenic
983466182 4:168094758-168094780 AGACAAGAATCATGGAAAAATGG + Intronic
983539564 4:168894722-168894744 CCATAAGGAAGATGGAAAAGGGG - Intronic
983880927 4:172931657-172931679 TAATAAGTCAGATGGAAAAAGGG + Intronic
983918377 4:173316413-173316435 TGATAAGTGTGGTGAAAAAAAGG - Intronic
984082809 4:175270179-175270201 TAGTAAGTGTGATGGAAAAAAGG + Intergenic
985339471 4:188933979-188934001 GGCTAAGGAAGATGGAAAAAGGG - Intergenic
987022441 5:13888493-13888515 TGAAAAGGATGATGGAGAAAAGG - Intronic
993546106 5:89215564-89215586 TGATAAGCAAGAAGGAAAAATGG + Intergenic
993946381 5:94121379-94121401 CCACAAGTATGCTGGAAAGAAGG - Intergenic
995386473 5:111595324-111595346 GGATAAGGGTGATGGCAAAATGG + Intergenic
997144946 5:131422610-131422632 AAATAAGTATAATTGAAAAACGG - Intergenic
998083510 5:139296281-139296303 TGAAGAGTATGATGGGAAAATGG + Intronic
998587308 5:143440529-143440551 AGATAAGGAAGAAGGAAAAAGGG - Intergenic
998992462 5:147832978-147833000 AGATAAATATTATGGAGAAAAGG + Intergenic
999601221 5:153267689-153267711 GCATAAATATGCTGGAAAAAGGG - Intergenic
1002870217 6:1160331-1160353 CCATCAGTGTGATGGCAAAAAGG + Intergenic
1005445979 6:25923674-25923696 AGGTAAGTATGATGGAAAATAGG - Exonic
1006724399 6:36186477-36186499 CAATAAGTAGAATGGACAAAAGG - Intergenic
1007974100 6:46082807-46082829 TGATAAATATTATGGAAAAGGGG - Intergenic
1009544235 6:65003970-65003992 GGAAAAGTAAGATGGAAACATGG - Intronic
1010544659 6:77137534-77137556 AAATAAGTATGATGGATGAATGG + Intergenic
1011167790 6:84469193-84469215 CTATCATGATGATGGAAAAAAGG - Intergenic
1011278350 6:85651699-85651721 CTATAAGTATTATGAAATAAAGG + Intergenic
1012527010 6:100189984-100190006 CCATAAGTATGATGGAAGATTGG - Intergenic
1014678499 6:124398471-124398493 TGAAAGGTATGATGGAAAATAGG + Intronic
1016154728 6:140791245-140791267 CGGTAAGTCTTATGGAACAAAGG + Intergenic
1017248581 6:152255395-152255417 GTGTAAGTATGAGGGAAAAATGG - Intronic
1017542827 6:155420721-155420743 TGATAAGTATGACGAAAAGATGG + Intronic
1018991597 6:168677990-168678012 CTATTCGTATGATGGAAAATAGG - Intergenic
1020994991 7:15252193-15252215 TGGTAAGTATTATGGAGAAAAGG + Intronic
1021541630 7:21765781-21765803 CAGTATGTATGGTGGAAAAAAGG - Intronic
1022069653 7:26900071-26900093 CCATAATTATGTTGGAAAGATGG - Intronic
1022256598 7:28664539-28664561 CAGGAACTATGATGGAAAAACGG - Intronic
1023076765 7:36490957-36490979 GGATAATTAGGATGCAAAAAAGG - Intergenic
1023076781 7:36491104-36491126 GGATAATTAGGATGCAAAAAAGG - Intergenic
1024713632 7:52047181-52047203 CTATAAGAATGATGTAAGAACGG + Intergenic
1027530052 7:79319200-79319222 GGATGTGTATGAAGGAAAAATGG - Intronic
1028301018 7:89200882-89200904 TGAGAAGTATGATGAAAACATGG - Intronic
1033286080 7:140041623-140041645 AGGTAAGTGTGATGGAAAGAGGG - Exonic
1033914797 7:146310761-146310783 AGAAAAGTAGGATGGATAAATGG - Intronic
1033991130 7:147288175-147288197 AGATAAGAATGATTGACAAAAGG - Intronic
1036451810 8:8874833-8874855 CCTTAAGTATGATAGACAAAAGG + Intronic
1037148412 8:15603371-15603393 TGATAAGTATGTGGGAAAATGGG + Intronic
1037344893 8:17887861-17887883 GGATAACTTTAATGGAAAAATGG - Intronic
1038198022 8:25385775-25385797 CAGTAAGTATCATGGAGAAAAGG + Intronic
1038350543 8:26772227-26772249 TGATAAGAGTGATGGATAAAGGG + Intronic
1038490070 8:27964541-27964563 CGTCCAGTATGATGAAAAAAAGG - Intronic
1038653895 8:29431076-29431098 CTATTAGGATAATGGAAAAACGG + Intergenic
1042643496 8:70960365-70960387 CAAAATGGATGATGGAAAAATGG - Intergenic
1042939118 8:74089728-74089750 TGATAAGCATGATGGATAAATGG + Intergenic
1043089389 8:75878206-75878228 CCAATAGTATTATGGAAAAAAGG + Intergenic
1044675171 8:94720724-94720746 TGATAAGTATGAGACAAAAATGG + Intronic
1046175019 8:110564155-110564177 CTATAAGTATTAAGGAAACATGG - Intergenic
1046677638 8:117128772-117128794 CCTTTAGTATGAAGGAAAAAGGG + Intronic
1046695631 8:117336142-117336164 CGATAACTATGAAGAAAAATGGG + Intergenic
1047566220 8:126046969-126046991 CCCTGAGTATGAAGGAAAAAGGG + Intergenic
1055991780 9:82114141-82114163 CTATCAGTATAATGGAAAAAAGG - Intergenic
1058128364 9:101222319-101222341 TGAGACATATGATGGAAAAATGG - Intronic
1059687209 9:116649170-116649192 CAATAAATATGATTTAAAAAGGG - Intronic
1059857544 9:118416596-118416618 CCATAAGGATGATGGCAGAAGGG + Intergenic
1188411977 X:29884381-29884403 AGATGAGTATCATGGAGAAATGG - Intronic
1193470342 X:81893527-81893549 GGTTGAGTATGGTGGAAAAAGGG + Intergenic
1194702333 X:97129470-97129492 TCATAAGTATGAATGAAAAATGG - Intronic
1197716428 X:129710570-129710592 AGATAAGTATCAAGGAATAACGG - Intergenic
1200453009 Y:3353907-3353929 CTTTAAGGATGCTGGAAAAAAGG + Intergenic
1201574796 Y:15451317-15451339 CAATAAATATGATGGAAGGAGGG + Intergenic