ID: 1162446400

View in Genome Browser
Species Human (GRCh38)
Location 19:10725536-10725558
Sequence CAGAGGGATCTGTGGGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162446394_1162446400 -2 Left 1162446394 19:10725515-10725537 CCTGCTGGAATTGGTACAGTCCA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1162446400 19:10725536-10725558 CAGAGGGATCTGTGGGAATATGG 0: 1
1: 0
2: 0
3: 21
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162446400 Original CRISPR CAGAGGGATCTGTGGGAATA TGG Intronic
901002895 1:6157495-6157517 TAGAGGGATGTGTGGGATCAGGG - Intronic
903122810 1:21227335-21227357 CACAGGGCTCTGTGTGGATAAGG + Intronic
903534958 1:24060745-24060767 CCGAGTGATCTGTGGGGATGGGG - Intronic
907700324 1:56780308-56780330 CAGAGGGATCTGTGTGAGGGAGG - Intronic
910459850 1:87437126-87437148 TAGAGGAAACTGTGGGAGTAGGG + Intergenic
912947824 1:114099257-114099279 CATAGGGATCTGTGCCAATGGGG + Exonic
913330394 1:117662505-117662527 CCAAGGGATCTGTGGAAATTTGG + Intergenic
914317069 1:146523396-146523418 TAGAGGAAACTGTGGGAGTAGGG + Intergenic
914497286 1:148209964-148209986 TAGAGGAAACTGTGGGAGTAGGG - Intergenic
914900471 1:151708761-151708783 GAGAGGGATGTGAGGGAATTTGG + Intronic
915004233 1:152622145-152622167 CAGTGGGATCTGTGGGCCCATGG - Intergenic
916918804 1:169439794-169439816 CAGAGGGATAGGTGGGAAGCTGG + Intronic
919824671 1:201494797-201494819 CTGAGGGATCTGTAGCAAGATGG - Intronic
920117135 1:203628964-203628986 CAGACAAATCTGTGGGAATCAGG + Intronic
920461356 1:206143148-206143170 CCTAGGGATCTAGGGGAATAAGG + Intergenic
922370586 1:224906858-224906880 CAGAGTGGGCTGAGGGAATATGG + Intronic
922510324 1:226160741-226160763 AAGAGGGAGCTGTGGGTACAAGG - Intronic
923745889 1:236700001-236700023 CAGAGGCAGCTGTGGGAAGTAGG - Intronic
1063199148 10:3770807-3770829 GGGAGGGAGCTGTGGGAACAAGG - Intergenic
1063878598 10:10507672-10507694 GAGAGGAATTTGTGGGAAGATGG + Intergenic
1066603413 10:37134534-37134556 CTGAGGGATCTGTGTTAGTAAGG - Intronic
1067061957 10:43082195-43082217 CAGGAGGAGCTGTGGGAACAAGG - Intronic
1067449996 10:46376271-46376293 CAGAGGGAACTGTGTGCAGAGGG + Intronic
1067587248 10:47483492-47483514 CAGAGGGAACTGTGTGCAGAGGG - Intronic
1067634306 10:47991259-47991281 CAGAGGGAACTGTGTGCAGAGGG - Intergenic
1068544591 10:58331579-58331601 AACAGGGATCTAAGGGAATAAGG - Intergenic
1069802092 10:71088044-71088066 CAGAGAGATCTGTGAGAAGCTGG + Intergenic
1070757466 10:79002349-79002371 CAGAGGGACCTGTGGGCACAGGG - Intergenic
1070777158 10:79116406-79116428 GAGAGAGAACTGTGTGAATATGG + Intronic
1074661526 10:115663982-115664004 AAGTGGGAGCTGTGGGAAAATGG - Intronic
1074769921 10:116726575-116726597 CAGAAGGAACTGTGGGAAATTGG - Intronic
1076608867 10:131707915-131707937 CAGGGGGATCAGTGGGCAGAGGG + Intergenic
1077328450 11:1973619-1973641 CAGAGGGGGCTGTGGGGAGAGGG + Intronic
1077427717 11:2492517-2492539 CACCGGGATCTGTGGGGAGATGG - Intronic
1078630976 11:13004069-13004091 CAGAGGGAACTGTGTGATTGAGG + Intergenic
1079117960 11:17652574-17652596 CAGAGGGAGCAGTGGAAAGAAGG + Intergenic
1079505269 11:21146294-21146316 CAGAGGCATAAGTGGGATTAAGG + Intronic
1084398115 11:68927911-68927933 CATAGGGATGGCTGGGAATAGGG + Intronic
1084741792 11:71144933-71144955 CAGAGGGACGTGTCGGAACAGGG + Intronic
1085344704 11:75761061-75761083 AAGAGGGTTCTGGGGGAATCAGG - Intronic
1085479443 11:76809210-76809232 GAGCGGGCTCTGTGGGGATAGGG - Intergenic
1086367549 11:86123018-86123040 AAGAGAGATCAGTGGGGATAGGG - Intergenic
1087794954 11:102446021-102446043 CAGAGGGATCTGAGAGGATTGGG - Intronic
1089175613 11:116546952-116546974 CAGAGGAAGATGTGGGAAAATGG + Intergenic
1089341755 11:117763037-117763059 CAGAGTGGTCTGTGGGAGGAAGG - Intronic
1090037266 11:123259885-123259907 CAGAGGGATGTGTGGGATGGAGG - Intergenic
1202811428 11_KI270721v1_random:28798-28820 CAGAGGGGGCTGTGGGGAGAGGG + Intergenic
1091638024 12:2213068-2213090 CAGAGGCATCTGTGGGAGTCAGG - Intronic
1092156489 12:6285172-6285194 CAGAGGGCACTGTGGCACTAGGG - Intergenic
1094488862 12:30946197-30946219 CAGGGGGATTTCTTGGAATATGG - Intronic
1095260420 12:40092914-40092936 CAGACAGATTTGTGGGAAGAGGG - Intronic
1095679606 12:44958750-44958772 CACAGGTATCTGGGGGAAGATGG + Intergenic
1099186363 12:79519839-79519861 CAGAGGATGCTATGGGAATAGGG + Intergenic
1099242204 12:80151564-80151586 AAAAAGGATCTGTGGGAATAGGG + Intergenic
1100250865 12:92822155-92822177 GAGAGGCAACTGAGGGAATAAGG - Intronic
1101411558 12:104472955-104472977 GAGAGTGATGTCTGGGAATACGG + Intronic
1102943135 12:116961580-116961602 TAGAGGGTTCTCTGGGTATATGG + Intronic
1104421719 12:128641509-128641531 CAGAGAGCACTGTGGGAAGAGGG + Intronic
1105611170 13:21970922-21970944 CTGAGGGATGTGTGTGTATATGG + Intergenic
1107668049 13:42713282-42713304 TACAGGGCTCAGTGGGAATATGG + Intergenic
1107790209 13:43994393-43994415 GACAGGGATCTCTGGGAATGTGG - Intergenic
1110439452 13:75511122-75511144 CAGAGACATCTGTGAGCATACGG - Intergenic
1110615439 13:77536455-77536477 CACAGGGATCTGTGGGCATCTGG + Intronic
1111322047 13:86644216-86644238 CAGAGGGATTGGTAGGAGTATGG + Intergenic
1113005589 13:105698446-105698468 CAGTGTGCTCTGTGGGAATATGG - Intergenic
1113420175 13:110164982-110165004 CCGGGAGACCTGTGGGAATAGGG + Exonic
1114008623 14:18342343-18342365 CTGAGGGATCTGTGTTAATAAGG - Intergenic
1117049811 14:51848687-51848709 CAGAGGTATGTGTGGGGATCAGG + Intronic
1121180827 14:91927292-91927314 CAGAGGGATTTGGGGGATTTGGG - Intronic
1122262637 14:100531909-100531931 CCGGGGGATCTGTGGGGAAAGGG - Intergenic
1122817068 14:104319145-104319167 CAGAGGGCTCTGGGGGAGGAAGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123391832 15:19882915-19882937 CTGAGGGATCTGTGTTAATAAGG - Intergenic
1124468815 15:29965029-29965051 GAGATGGAAGTGTGGGAATAAGG + Intronic
1125715883 15:41819694-41819716 CAAAGGGAGCTGTGAGAACAGGG + Intronic
1126358005 15:47816601-47816623 CAGAGGGGATTGTGGGAATCAGG + Intergenic
1127604706 15:60574701-60574723 CATAGGGATTTTTGGGAAGAAGG - Intronic
1127842981 15:62846539-62846561 CAGACGGAACTGTGTGCATATGG + Intergenic
1128207928 15:65869531-65869553 CAGTGGTATCTGTGGGACCAGGG - Exonic
1128564267 15:68689694-68689716 CAGAGGCATATGTGGGACTTGGG + Intronic
1133692947 16:8233961-8233983 CAAAGTCATCTGTGGGAGTATGG + Intergenic
1134675512 16:16087330-16087352 CAGAGGTGTCTGTGGGTAGAGGG + Intronic
1134787503 16:16958383-16958405 CAGAGAGATCTCGGGGAATCAGG + Intergenic
1135003205 16:18794477-18794499 GAAAAGGAACTGTGGGAATATGG - Intronic
1137466324 16:48713017-48713039 AAAATGGATCTGTGGGAATTTGG + Intergenic
1137596610 16:49728112-49728134 CAGAGGTATCTCTGGGGCTATGG - Intronic
1140576360 16:76174544-76174566 CTGAGGGATCTGGGGGAGGAAGG + Intergenic
1142115191 16:88352778-88352800 CACAGGGAGATGTGGGCATATGG + Intergenic
1142211047 16:88808591-88808613 AAGGGGGCTCTGTGGCAATATGG + Exonic
1142718660 17:1762293-1762315 CAGAGGGAGCTGGGGGGACAAGG + Intronic
1143574222 17:7780577-7780599 CAGAGGGATTTGTGGGGAGATGG + Intronic
1144169097 17:12641492-12641514 TAGAGGCATCTGTGGGAAGGGGG - Intergenic
1146172310 17:30643553-30643575 CATAGAGATCTGGGGGAAGAAGG + Intergenic
1146345763 17:32059574-32059596 CATAGAGATCTGGGGGAAGAAGG + Intergenic
1148054622 17:44786799-44786821 CAGAGGGGTCTGTGGGGGTGAGG - Intergenic
1148479912 17:47953287-47953309 CAAAGGGGTCAGTGGGAAAAGGG + Intronic
1148579319 17:48732968-48732990 CAAAGGCATCTGTGGGGTTAGGG - Intergenic
1148913958 17:50958840-50958862 CAGAGGGGTCTTTGGGAGAAAGG - Intergenic
1151606067 17:75136869-75136891 CAGTGGGACCTCTGGGAATAGGG - Intronic
1152282125 17:79390989-79391011 GGGAAGGATCTGTGGGAATCAGG - Intronic
1152568771 17:81112160-81112182 CAGAGGGACCTGGGGGAGTGGGG - Intronic
1153597424 18:6742023-6742045 CAGCTGGAATTGTGGGAATATGG + Intronic
1153951514 18:10061455-10061477 CAGGGGCATCTGTGGGACAAAGG + Intergenic
1154476002 18:14758485-14758507 CTGAGGGATCTGTGTTAGTAAGG - Intronic
1157716792 18:49893574-49893596 CAGAGGGTCCTGTGGGCAGAGGG + Intronic
1158013025 18:52750369-52750391 CAAAAGGATCTGTGGGGAGAAGG + Intronic
1158543768 18:58378858-58378880 CAGGGAGATGTGTGGGAATCGGG + Intronic
1159020776 18:63141512-63141534 CAGAGGGCTTTGTGGGCATATGG - Intronic
1159770114 18:72539123-72539145 CAGGGAGGTCTGTGGGAATATGG + Intronic
1160039819 18:75335295-75335317 GAGAGGGAAATGTGGGAATGTGG - Intergenic
1160893817 19:1393526-1393548 CAGAGGGATCAGAGGGAGCAGGG + Intronic
1161794512 19:6378707-6378729 CTGGGGGCTCTGTGGGAATCCGG - Intronic
1162130189 19:8521596-8521618 CCGAGGGATCTGTGGGAGAGAGG + Exonic
1162446400 19:10725536-10725558 CAGAGGGATCTGTGGGAATATGG + Intronic
1162990117 19:14296492-14296514 CATAGAGATCTGGGGGAAGAAGG - Intergenic
1163765774 19:19162573-19162595 CAGAGGGACCTATGGAAAAAAGG - Intronic
926411232 2:12604784-12604806 CAGATGGAAGTGTGGGAAGAGGG + Intergenic
926899727 2:17737472-17737494 CAGAGGTATCTGGGGCAGTATGG + Intronic
927609198 2:24520597-24520619 CACAGGGAAGTGTGGGAATGAGG + Intronic
928296823 2:30090948-30090970 CAGAGGGATGTTTGAAAATACGG - Intergenic
928904744 2:36356721-36356743 AAGAGGGCTCTGCGGGAAGAGGG + Intronic
929582897 2:43094706-43094728 GACAGGGAGCTGTGGGAATGTGG - Intergenic
929618064 2:43327893-43327915 CAGTGGGATCTCTGGGAGAAGGG - Intronic
929667579 2:43845233-43845255 CCTGGGGAGCTGTGGGAATATGG - Intronic
935005103 2:99066815-99066837 CAGAGGGAGCTGTGGATACAGGG - Intronic
938365146 2:130728082-130728104 GACAGGGATCTGTGGGCAGAGGG + Intergenic
938816711 2:134912082-134912104 CGGAGGGACTTGTGGGGATATGG - Intergenic
939287999 2:140157309-140157331 CAGAGAGAGCTGTGGGGAAAAGG - Intergenic
940890919 2:159034472-159034494 AAACGGGATCTCTGGGAATAGGG - Intronic
940906545 2:159174897-159174919 CAGAAGGAGCTGTGTGAAGAGGG + Intronic
941621605 2:167785254-167785276 GTGAGGGATCTGTGGGAAGATGG + Intergenic
943334810 2:186600545-186600567 GAGAGAGATTTTTGGGAATAGGG - Intronic
943668142 2:190632210-190632232 CACAGGGCTCTGTGGAAGTATGG + Intergenic
943787287 2:191891978-191892000 GAAAGAGAACTGTGGGAATAAGG - Intergenic
947816506 2:233041069-233041091 CAGAAGGATCTGTGGTATTTTGG - Intergenic
947973705 2:234345937-234345959 CAGAAGGGTCTGTAGGAACAGGG - Intergenic
948883676 2:240872741-240872763 CAGAGGGAGCTGGGGGAGTGAGG - Intronic
949042526 2:241855893-241855915 CATAGGAATCTGTGGGGACACGG - Intronic
1169049377 20:2563037-2563059 CAGAGGGACCTTGGGGAAAACGG - Intronic
1169959069 20:11138697-11138719 CAGAGCTCTCTGTGGGATTAGGG - Intergenic
1170993555 20:21328872-21328894 AAGAGGGAGCCTTGGGAATAGGG + Intronic
1172093560 20:32449776-32449798 CAGAGGGATGCGGGGGAAGAGGG + Intronic
1172385581 20:34531902-34531924 CAGAGGGATCTGTGAGAAGGTGG + Intronic
1172533791 20:35654629-35654651 CAGAAGGAACTGGGGGAATCGGG + Exonic
1174192812 20:48752240-48752262 CAGAGGCATGCGTGGGAATGAGG - Intronic
1174706511 20:52661773-52661795 CAAAGGTATCTTTGTGAATAAGG - Intergenic
1175781282 20:61683903-61683925 CAGAGGGATGGGTGGGAGTTGGG + Intronic
1177751949 21:25295740-25295762 CTGAGGGATTTCTGGAAATATGG + Intergenic
1177773603 21:25544373-25544395 CTGGTGGATCTGTGGGAACAGGG - Intergenic
1178398339 21:32262167-32262189 AAGAGGGTTCTGTGAGAATGAGG + Intergenic
1178776346 21:35554613-35554635 AAGAGGGATTTGTGGGAAAATGG - Intronic
1180433128 22:15273160-15273182 CTGAGGGATCTGTGTTAATAAGG - Intergenic
1180515704 22:16141073-16141095 CTGAGGGATCTGTGTTAATAAGG - Intergenic
1180869228 22:19137126-19137148 CAGAGGGATTTGGGGGTGTAAGG - Intronic
1181475422 22:23164998-23165020 CAGAGGCCTCTCTGGGAGTAGGG - Intergenic
1183056551 22:35310151-35310173 CAGAGGGGTCGGTCAGAATAGGG + Intronic
1183980569 22:41537459-41537481 GAGAGGGAGCAGTGGGAACAGGG + Intronic
953886767 3:46718403-46718425 CAGATGGATCTGTGGGGCAAGGG - Intronic
954677025 3:52321772-52321794 TAGAGGGATCTGTGGGCCAATGG + Intronic
957571714 3:81955345-81955367 CAGAGGCTACTGTGAGAATATGG + Intergenic
959678195 3:109061226-109061248 CAAAGGGATAAGTAGGAATATGG - Intronic
960918092 3:122717588-122717610 CAGAGATATCTGGGAGAATAAGG + Intronic
961806098 3:129490431-129490453 CAGAGGGAAGCCTGGGAATAGGG - Intronic
961939407 3:130622118-130622140 CTGAGGGATCTCAGGGAACAAGG + Intronic
962361748 3:134748888-134748910 CAGTGGGTTCTGTGGGCAGATGG + Intronic
962646382 3:137444933-137444955 AAGAGGGAGCTGTGAGAAGAGGG - Intergenic
962888079 3:139646520-139646542 CAGAGAGGTCTGTGGGCAAATGG - Intronic
963763513 3:149309202-149309224 CTGAGGGATCTAGGGGAAAAAGG - Intergenic
964800063 3:160546525-160546547 AAGAAGAATCTGTGAGAATATGG + Intronic
965280604 3:166747483-166747505 CATAGGGATCTATAGGAGTATGG - Intergenic
966910982 3:184559885-184559907 CAGAGGCATGTGTGGGTACATGG - Intronic
967735493 3:192947548-192947570 CAGAGACATCTGTAGAAATATGG + Intergenic
968312970 3:197699399-197699421 CGGAAGGATCTGAGGAAATATGG - Intronic
969204733 4:5634915-5634937 CAAAGGGCTCTGCAGGAATACGG + Intronic
970157814 4:13159226-13159248 CAATGGGATCTGTGTAAATAGGG + Intergenic
970475183 4:16414951-16414973 AGGAGGGATCTATGGAAATAGGG + Intergenic
970999307 4:22304165-22304187 CTGAGGGAGCTGTGGGAAGAGGG + Intergenic
975217918 4:71778547-71778569 CACAGGAATGTGTGGTAATAAGG - Intronic
975659655 4:76675771-76675793 CAGAGGGATCCTTGGGCTTAAGG - Intronic
975950148 4:79760782-79760804 CAGAGAGATCAATAGGAATAAGG - Intergenic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
978148594 4:105407860-105407882 CACAGGGGTATGTGGGAATTTGG + Intronic
978515947 4:109568590-109568612 AAGAGGGGTCTGTGGGGAGATGG - Intronic
979787913 4:124739842-124739864 CGGTGGGATCTGTGGGAAAATGG + Intergenic
981107746 4:140900384-140900406 CAGAGGTTTCTCTGGAAATAAGG + Intronic
983502821 4:168519142-168519164 CAGAGAAATGTGTGGGAATGAGG + Intronic
986372359 5:7092731-7092753 AAAAGTGATCTGTGGGAATTTGG + Intergenic
986975363 5:13387787-13387809 CAGAGGGATAGGAGGGAAAATGG + Intergenic
988153756 5:27422139-27422161 CAGAGGGAGCTGGAGGAAAATGG - Intergenic
988260645 5:28882577-28882599 CAGAGGGCTCTGGGGGCATTGGG - Intergenic
992565080 5:77988212-77988234 CAGAGAGATGTGTGGAAATCAGG - Intergenic
993473213 5:88332410-88332432 CAGAGGGATCTTTGTGTTTATGG - Intergenic
994839167 5:104899250-104899272 CAGAGTAATCTATGGCAATAGGG - Intergenic
995833470 5:116378136-116378158 CAGACTGCTCTGTGGCAATAAGG - Intronic
997386365 5:133475937-133475959 CAGAGGAGTCTGGGCGAATAAGG + Intronic
997727133 5:136131494-136131516 CATAGGGAAATGTGGGAATAAGG - Intergenic
999269429 5:150288062-150288084 CACAGGGTTATGTGGGAGTATGG - Intronic
999427558 5:151500887-151500909 CAGAGGGCTCTCTGGGATCAAGG - Intergenic
1001034383 5:168287150-168287172 CAGCGGTCTCTGTGGGAAGAGGG - Intergenic
1001204099 5:169745915-169745937 CAGAGGGAGCTATGGAACTAGGG + Intronic
1002467485 5:179414913-179414935 CAGAGGGTTCTGTGGACAGATGG - Intergenic
1002563582 5:180098216-180098238 CAGAGGGTGCTGTGGGTACATGG + Intergenic
1003107232 6:3226389-3226411 CAAAGGGCTCTGTTGGCATAAGG + Intronic
1004026968 6:11828240-11828262 CATAGGTATTTGTGGGAAAAGGG - Intergenic
1006442180 6:34059597-34059619 AAGAGGGAGCTGTGGGCAGAAGG - Intronic
1008131570 6:47725301-47725323 CAGAGGAAGTTGTGGGAATTGGG - Intergenic
1008441849 6:51540732-51540754 CACAGGGATGTGATGGAATATGG - Intergenic
1015638390 6:135303830-135303852 CTCAGGGATCTGGGGGCATAGGG - Intronic
1015997174 6:139007064-139007086 CAGAGGAACCTTTGGGAATCAGG + Intergenic
1018288779 6:162269043-162269065 CAGAGGAATCAGTGAGAGTATGG + Intronic
1019059224 6:169243217-169243239 CAGAGGGAGTGGTGGGAATGTGG - Intronic
1019492325 7:1321290-1321312 CTGAGGGGTCTGTGGGACCAGGG + Intergenic
1021570730 7:22062431-22062453 CAGAGGGAGCTGTGTGGAAAAGG + Intergenic
1021787186 7:24164022-24164044 CCTAGGGATCTGTGAGAATAGGG + Intergenic
1022425718 7:30266956-30266978 CTGACAGATCTGTGGGAATGAGG + Intergenic
1023885350 7:44349935-44349957 CAGAGGGATCTGTGAGGCCAGGG + Intergenic
1024243855 7:47454993-47455015 CAGGGGGATCTGTGTGAGTTTGG - Intronic
1025274323 7:57562729-57562751 TAGAGGAATGTGTGGGAATCAGG + Intergenic
1025818010 7:64936472-64936494 CAGAGGGATTACTGGGAACATGG + Intergenic
1030989536 7:116283495-116283517 AAGAGGAATATGTGGGAATTGGG + Intergenic
1032546894 7:132751349-132751371 CAGGGGGATGTGTGGGAAGGGGG - Intergenic
1032710214 7:134454624-134454646 CACGGGGATCTCTGGGAACAGGG + Intronic
1033424999 7:141236132-141236154 CACAGGGACCTGTGGGGGTAAGG - Intronic
1034277210 7:149829206-149829228 CTGAGGGGACTGTGGGAAGAGGG - Intergenic
1038893649 8:31756004-31756026 CAGAGGGGTATGTAGAAATAAGG - Intronic
1039014897 8:33136207-33136229 CACAGAGACCTGTGGGACTATGG - Intergenic
1039414809 8:37384856-37384878 CACAGGGTTCTGAGGGAATGGGG - Intergenic
1047498723 8:125426824-125426846 AAGAGGATTCTGTGGGAAGAGGG + Intergenic
1048205777 8:132414226-132414248 CAGAGGAACCTGTGGGACCAGGG - Intronic
1048831002 8:138477434-138477456 AAGAGGGATCTGTGGTGATTTGG - Intronic
1049702490 8:144021494-144021516 GAGAGGGATCTGAGGGAAGGAGG - Intronic
1049702697 8:144022341-144022363 GAGAGGGATCTGAGGGAAGGAGG - Intronic
1049702850 8:144022966-144022988 AAGAGGGTCCTGAGGGAATAGGG - Intronic
1049703073 8:144023778-144023800 TAGAGGGTTCTGAGGGAAGAGGG - Intronic
1049703307 8:144024588-144024610 GAGAGGGTTCTGAGGGAAGAGGG - Intronic
1049790526 8:144470290-144470312 CAGAGGGATGTGTGGGATGAAGG - Intronic
1049796170 8:144498199-144498221 CACAGGGAGCTGTGGGAAGGTGG + Intronic
1052089824 9:24314597-24314619 CAAACGGATCTGAGGGAATGGGG + Intergenic
1052917234 9:33932765-33932787 CACTGGGCTCTGTGGGGATAAGG - Intronic
1053046665 9:34926165-34926187 CAGAGGCATGTGTGTGCATATGG + Intergenic
1055524740 9:77120367-77120389 CAGAAGTATCTGGGGGAAGACGG - Intergenic
1055777964 9:79786806-79786828 CAGAGGGATCAATTGAAATATGG + Intergenic
1056155189 9:83827470-83827492 TAGAGGGTACTGTGGGAGTATGG - Intronic
1056355296 9:85795639-85795661 TAGAGGGTACTGTGGGAGTATGG + Intergenic
1056705996 9:88953186-88953208 CAGTGGGATCAGTGGGCATCGGG + Intergenic
1057043819 9:91868242-91868264 GAAAGGGATCAATGGGAATAAGG + Intronic
1057835006 9:98437650-98437672 CAGATGGATGTGTGGGTAGATGG - Intronic
1057993554 9:99798416-99798438 CAGAGGATTCTTTGGGAACACGG - Intergenic
1058743045 9:107963581-107963603 CAGTGGTTTGTGTGGGAATAAGG - Intergenic
1059685356 9:116629809-116629831 CAGAGGTAAGTGTGGCAATAGGG - Intronic
1059766080 9:117385433-117385455 GAGAGAGATCTGTGAGAACAAGG + Intronic
1059820643 9:117968612-117968634 CATAGGGTTCTGTGGGAGCATGG + Intergenic
1060207756 9:121692649-121692671 TAGAGGATTCTGTGGGCATAGGG + Intronic
1062015261 9:134288025-134288047 GAGACAGATCTGTGGGATTAAGG + Intergenic
1186808141 X:13160761-13160783 CAGAGAGTTGTGTGAGAATATGG + Intergenic
1189231212 X:39453876-39453898 CAGATGGTTCTATGGGAATCGGG + Intergenic
1190636116 X:52435702-52435724 CAGAAGGACATGGGGGAATAAGG + Intergenic
1191247378 X:58238575-58238597 CAGAGGCACCTGTGGGAACTTGG + Intergenic
1194146834 X:90276590-90276612 CAAAAGGCTCTCTGGGAATATGG - Intergenic
1196736018 X:118981691-118981713 CAGAAGGAGCTGGGGGAATGCGG + Intronic
1197034675 X:121859483-121859505 CTGTGGGCTCTGTGGGAGTAGGG - Intergenic
1200493240 Y:3853356-3853378 CAAAAGGCTCTCTGGGAATATGG - Intergenic
1201419604 Y:13783974-13783996 CAGAGGTATCTGTGGTAGTCAGG + Intergenic