ID: 1162448497

View in Genome Browser
Species Human (GRCh38)
Location 19:10739207-10739229
Sequence ATGTCCCCATAGAAGAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162448497 Original CRISPR ATGTCCCCATAGAAGAACAA GGG (reversed) Intronic
901369917 1:8788326-8788348 ATGACTACATAGAAGCACAAAGG + Intronic
910293074 1:85617299-85617321 ATTTCCCCATAGAAGGGAAAGGG + Intergenic
910475527 1:87602212-87602234 ATGTCCCAGTAGAACAACTATGG - Intergenic
910572872 1:88725124-88725146 ATGTACCCGTTGAAGAACATTGG + Intronic
910582215 1:88841168-88841190 AAGTTCACATAGAAGAGCAAAGG + Intergenic
911037133 1:93562857-93562879 ATGTCCCCAAAGAAAAATATAGG + Intronic
912860573 1:113210549-113210571 CTTTCCCCATAGAGCAACAATGG + Intergenic
915115193 1:153594015-153594037 ATGTTCCTATAAAGGAACAAGGG + Intergenic
916910271 1:169338909-169338931 ATGTTCCCACAGTAGAACACTGG + Intronic
920276572 1:204809976-204809998 ATGTCCCTAGAGACAAACAAAGG - Intergenic
921222643 1:212984215-212984237 ATGTGCCAATAGCAGAACACAGG + Intronic
923969365 1:239182317-239182339 ATTTCCCTACAGAAGAGCAATGG - Intergenic
924946321 1:248849276-248849298 ATGTCCCCAGGGCAGATCAAGGG + Exonic
1063198791 10:3767826-3767848 ATGTCCCCATTTATGGACAAGGG - Intergenic
1064880305 10:20044655-20044677 ATTTCCCCATAGTAGCAAAATGG + Intronic
1065136746 10:22678460-22678482 TTTTCCCCATAGAACGACAAAGG - Intronic
1067859783 10:49833870-49833892 ATGTTCCCAGAGAAAAACCAAGG + Intronic
1067905190 10:50283260-50283282 ATGTCCCCAGAGAAGACTGATGG + Intergenic
1068017995 10:51542392-51542414 GTGTCCCCATTTAAAAACAAGGG - Intronic
1069311782 10:67046481-67046503 ATATCTTCCTAGAAGAACAAGGG + Intronic
1070462087 10:76680499-76680521 ATATTCCCATAGGTGAACAAGGG + Intergenic
1070795510 10:79214179-79214201 CTGTCCACATAGAAAAACCAAGG - Intronic
1071443815 10:85727830-85727852 AGGTCCCCATAGCAGATCCAGGG - Intronic
1074934231 10:118161925-118161947 AGGCCCTCATAAAAGAACAAGGG + Intergenic
1081736029 11:45404916-45404938 AGGTCCCCTAAGAAGGACAAGGG - Intergenic
1082612274 11:55314863-55314885 ATTTCTTCATAGAAAAACAAAGG - Intergenic
1082672698 11:56054959-56054981 ATGAGCCCAGAGAAGACCAAGGG - Intergenic
1083138134 11:60699370-60699392 ATGTCCCCACAGGAGAACAGAGG - Intergenic
1085942738 11:81224734-81224756 ATGTCCCCAAAGCACAACAGTGG + Intergenic
1090990301 11:131811268-131811290 GTGTCCTCATAGCAGAACAAAGG + Intronic
1092218709 12:6699276-6699298 ATCTTCCCAGAGAACAACAAGGG + Intronic
1093018023 12:14174174-14174196 TTGTCCCCAGAGAAGAGCACTGG + Intergenic
1093309716 12:17564234-17564256 ATGTCACCATCAAAGACCAAAGG - Intergenic
1093707244 12:22288093-22288115 ATTTCCCCATAGAACAAACATGG - Intronic
1095826419 12:46534645-46534667 ATCTCCCCAGAGTGGAACAAAGG - Intergenic
1096069658 12:48767940-48767962 CTGTCCCCAAAGGGGAACAAAGG - Exonic
1098164594 12:67681090-67681112 ATGTCAGCAAAGAAGAACTAAGG + Intergenic
1103111621 12:118285029-118285051 ATATTCCCATAGAAAGACAAGGG - Intronic
1104938973 12:132386076-132386098 ATGTCCCACAAGGAGAACAAAGG + Intergenic
1106388944 13:29316578-29316600 ACCTGCCCATAGAAGCACAATGG - Intronic
1108305982 13:49133379-49133401 ATATCCCTACAGAATAACAAGGG - Intronic
1109702555 13:66046624-66046646 ATAGCCTCGTAGAAGAACAAAGG + Intergenic
1111440360 13:88274832-88274854 AATTGCCAATAGAAGAACAAAGG - Intergenic
1112631492 13:101165877-101165899 CTGTACCCATTGAACAACAATGG + Intronic
1113847042 13:113398164-113398186 ATCTTCTCCTAGAAGAACAAAGG - Intergenic
1114541208 14:23460836-23460858 ATGTTACCTTATAAGAACAAAGG + Intergenic
1114885251 14:26841962-26841984 ATGTGCCCAGAGTAGAGCAATGG - Intergenic
1115009743 14:28530767-28530789 ATGTGACCACAGAAGAATAATGG - Intergenic
1122121667 14:99557465-99557487 ATTTCCCCATATAGAAACAAGGG + Intronic
1202943166 14_KI270726v1_random:2300-2322 TTGTCCCCATTCTAGAACAAAGG + Intergenic
1125428229 15:39571085-39571107 AGGGCCCCAGAGAAGAACATCGG - Intergenic
1125861151 15:43001488-43001510 ATGTCCCCATAAAAGTTCAAAGG - Intronic
1126037678 15:44562235-44562257 TTGTCACCATAGAGCAACAAAGG + Exonic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1128032879 15:64497404-64497426 ATGTCACAGTAGAAGAGCAAAGG - Intronic
1131505490 15:93014629-93014651 AATTCCCCAGAGAAGAATAAAGG - Intronic
1133900491 16:9969410-9969432 ATGTACCCAGTGAGGAACAATGG - Intronic
1134814723 16:17196489-17196511 AAGTCCAGATACAAGAACAATGG + Intronic
1140168850 16:72581776-72581798 ATGTCACCATCAAAGACCAAAGG + Intergenic
1141292033 16:82727202-82727224 GTGTCCACAAAGGAGAACAATGG - Intronic
1142162301 16:88564318-88564340 ACTGCCCCATTGAAGAACAAGGG - Intergenic
1144025638 17:11273954-11273976 ATGTCCCAGGAGAAGAACACAGG - Intronic
1150534998 17:66028279-66028301 ATTTCTACACAGAAGAACAATGG - Intronic
1150702664 17:67461326-67461348 AGGTCCCCATAGAATAGCACGGG + Intronic
1151589313 17:75033029-75033051 AGGTCCCAAGAGAAGCACAATGG + Intronic
1151682405 17:75629006-75629028 ATGGCCCCAGAGAAGTACACAGG - Exonic
1152359611 17:79825532-79825554 CTTTCCCCATTGTAGAACAAAGG + Intergenic
1155073836 18:22338401-22338423 CTGTCCCCATCAAAGAGCAAAGG + Intergenic
1155284652 18:24275254-24275276 AGGTCCCCAGAGAAGCAGAATGG + Intronic
1155422944 18:25675291-25675313 TTGTCCCCAGAGAAGCAAAATGG - Intergenic
1156030638 18:32708319-32708341 ATGTCCCTATGGAATAAAAAGGG - Intronic
1158953155 18:62515820-62515842 ATGTCAAAATACAAGAACAAGGG + Intergenic
1162422273 19:10572641-10572663 ATGTCCCCAAACAAGCACATAGG + Intergenic
1162448497 19:10739207-10739229 ATGTCCCCATAGAAGAACAAGGG - Intronic
925242475 2:2344036-2344058 GTGTCCCCACTGAAGAAAAATGG - Intergenic
925497167 2:4464883-4464905 ATGTCACCATACAATAGCAAGGG + Intergenic
925640726 2:5983772-5983794 ATGGCCCCATAGAATAATAGAGG + Intergenic
926859451 2:17292737-17292759 AAGTCCCCATTAAAGAAAAATGG - Intergenic
928015611 2:27654111-27654133 ATGGCCCCATAAAAGAAGGAAGG - Intronic
931506611 2:62934743-62934765 ATATCCCTATTGAAAAACAAAGG - Intronic
932652771 2:73577278-73577300 ATTTCCCCAAAGAAAAACACAGG - Intronic
938184472 2:129217015-129217037 AATACACCATAGAAGAACAAAGG + Intergenic
938588901 2:132718627-132718649 GTGTCCTCAAAGAAGAAGAAAGG + Intronic
941443891 2:165575793-165575815 ATGTCCCCATAGAGTGATAAAGG - Intronic
942465577 2:176204373-176204395 ATGTCCCCACAGTAGAAAGAAGG + Intergenic
942874605 2:180779656-180779678 ATATTCCCAAAGAAGAGCAAGGG + Intergenic
946393257 2:219429347-219429369 TTGTCCCCAGAGAAGAAAGAAGG + Intergenic
1170971665 20:21122744-21122766 AAGTCCCCATAAAAGACCCAAGG + Intergenic
1172225887 20:33304984-33305006 AGGTCCCCACAGAAGCACCATGG + Intronic
1173466080 20:43282442-43282464 AGGTGACCAGAGAAGAACAAAGG + Intergenic
1173529082 20:43754728-43754750 ATGAGCCCAGAGAAGAACCAGGG - Intergenic
1174271917 20:49375814-49375836 CTGTCTCTATAGAAGAACAAAGG + Intronic
1174462654 20:50693732-50693754 ATGTCCCCAAAGAAGATAGATGG - Intergenic
1182523096 22:30895982-30896004 ATGTCACAATAGATGAATAAAGG + Intronic
949794258 3:7829678-7829700 ATGTATCAATAGAAGAAAAAAGG + Intergenic
953109056 3:39915033-39915055 ATTTCTACATGGAAGAACAAAGG + Intronic
956108602 3:65848042-65848064 CTTCCCCGATAGAAGAACAAAGG + Intronic
957714813 3:83913346-83913368 ATCTCCCCATCAAAGAATAAAGG - Intergenic
958203454 3:90354719-90354741 ATTTCACCATAGAACATCAAGGG + Intergenic
958930473 3:100202537-100202559 ATGTACCCATATAGGAGCAAGGG - Intergenic
961143430 3:124574709-124574731 CTTTCCCCCTAGAAGAACACGGG + Intronic
962907379 3:139816920-139816942 AAGTCCCCAGAGAAGAGAAAAGG + Intergenic
963342139 3:144049174-144049196 ATATTCCTTTAGAAGAACAAAGG + Intergenic
964689747 3:159437153-159437175 ATGTCTCAAAAGAAGAACAAGGG - Intronic
965238842 3:166165791-166165813 ATTTGCCAATAAAAGAACAAAGG - Intergenic
966266286 3:178048378-178048400 ATGTCCCTAGAAAAGACCAAAGG - Intergenic
968930201 4:3574914-3574936 CAGTCCCCTTAGAAGATCAAGGG - Intergenic
971482157 4:27124513-27124535 ATGTGCTAATAGAAGAACATTGG - Intergenic
971575515 4:28268105-28268127 CTATCCCCACAGAAGTACAAAGG + Intergenic
975729758 4:77326762-77326784 ATGTCACCATCAAAGACCAAAGG - Intronic
976275528 4:83273540-83273562 CTGTCCCCCAAGAAAAACAAAGG + Exonic
978267370 4:106842492-106842514 TTGCCCCCAAAGCAGAACAAGGG + Intergenic
978682601 4:111399976-111399998 ATGTCCCTAAAGAATAAGAAGGG + Intergenic
978768888 4:112433046-112433068 ATGTCCCCATAGAATTCTAATGG - Intronic
980617526 4:135250430-135250452 ATTTCTCCACAGGAGAACAACGG - Intergenic
981639604 4:146925542-146925564 ATGGCCACACAGAAGTACAAAGG - Intronic
982514804 4:156331715-156331737 ATGACCCCATTGAAAACCAAAGG - Intergenic
983696409 4:170537963-170537985 AAGTCCACAGAGCAGAACAAGGG + Intergenic
985434085 4:189911957-189911979 ATGGCCACATTGCAGAACAAAGG + Intergenic
987697480 5:21350729-21350751 ATGTCCACATTCAAGAACATAGG - Intergenic
987745353 5:21964080-21964102 AAATCCCCATAGGAGAAAAATGG + Intronic
988754758 5:34235958-34235980 ATGTCCGCATTCAAGAACATAGG + Intergenic
989665578 5:43850304-43850326 TTTTCCCCTTAGAAGAACAGAGG + Intergenic
991273324 5:64813229-64813251 ATGTCCAAACAGAAGAAAAATGG - Intronic
991742972 5:69701650-69701672 ATGTCCGCATTCAAGAACATAGG + Intergenic
991754724 5:69853552-69853574 ATGTCCGCATTCAAGAACATAGG - Intergenic
991765557 5:69974194-69974216 AAATCCCCATAGGAGAAAAAAGG + Intergenic
991781765 5:70143967-70143989 AAATCCCCATAGGAGAAAAAAGG - Intergenic
991794545 5:70281387-70281409 ATGTCCGCATTCAAGAACATAGG + Intergenic
991822359 5:70576962-70576984 ATGTCCGCATTCAAGAACATAGG + Intergenic
991834051 5:70728701-70728723 ATGTCCGCATTCAAGAACATAGG - Intergenic
991886925 5:71280930-71280952 ATGTCCGCATTCAAGAACATAGG + Intergenic
992412115 5:76515843-76515865 ATGTCCTCATTGAGGAACAAGGG + Intronic
996390501 5:122955697-122955719 ATGCCACCATAGAAGAGAAAGGG + Intronic
998632602 5:143916451-143916473 ATCTCCCTATACAAAAACAAAGG - Intergenic
1003237469 6:4309373-4309395 ATGTCCCTAGAGAGGAGCAATGG - Intergenic
1005170348 6:22978238-22978260 TTGTCTGCATAGAAGATCAAAGG - Intergenic
1005553380 6:26947670-26947692 ATGTCCGCATTCAAGAACATAGG + Intergenic
1008219508 6:48838360-48838382 ATATCCCAATATCAGAACAAAGG - Intergenic
1012450482 6:99349248-99349270 ATGTCCCCATAAAAGGAGAAGGG + Exonic
1012637817 6:101568298-101568320 AAGTGCCCAAAGAAGCACAAAGG - Intronic
1013722417 6:113046459-113046481 AGGTTCTCATGGAAGAACAAAGG + Intergenic
1016190541 6:141260464-141260486 ATGTCTCAATAGATGAACATAGG - Intergenic
1020856851 7:13437924-13437946 ATGTTACCATAGAAATACAAAGG + Intergenic
1021871077 7:25006804-25006826 GTGTCCCCAGAGAACAAAAATGG + Intergenic
1022380253 7:29852942-29852964 ATCTCCCCATAGAATATCACTGG + Intronic
1026152142 7:67796830-67796852 ATTTCCCCAAAGAAGAACCTGGG - Intergenic
1032423702 7:131803396-131803418 ATGTCCCCACAGAATGACAGAGG - Intergenic
1033237378 7:139649028-139649050 ACTTCCCCTTAGAAGAACAGAGG - Intronic
1033479341 7:141723825-141723847 ATGTCCACACAAAAGAAGAAAGG + Intronic
1036101385 8:5790149-5790171 ATATACGCATAGATGAACAACGG + Intergenic
1039268022 8:35848893-35848915 ATGTCCACATTGATGTACAATGG - Intergenic
1042213318 8:66403392-66403414 ATGTGGCCAAAGAAGAACATTGG + Intergenic
1042218376 8:66449706-66449728 ATGTGCACATAGATGAACAAGGG - Intronic
1042354162 8:67807980-67808002 TTGTCCCCATTGAAGACCACTGG + Intergenic
1047119831 8:121889270-121889292 AAGTCCCTATAAAAGATCAATGG - Intergenic
1048161194 8:132023647-132023669 GTGTCCCCATAGAATATTAAGGG + Intergenic
1050453817 9:5812662-5812684 CTTTCCCCATAGAAGAACAGGGG - Intronic
1053570911 9:39306005-39306027 ATGACCTCATAGAATAACTAGGG - Intergenic
1053836856 9:42146930-42146952 ATGACCTCATAGAATAACTAGGG - Intergenic
1054092528 9:60865024-60865046 ATGACCTCATAGAATAACTAGGG - Intergenic
1054113947 9:61140615-61140637 ATGACCTCATAGAATAACTAGGG - Intergenic
1054126234 9:61313007-61313029 ATGACCTCATAGAATAACTAGGG + Intergenic
1054459897 9:65456999-65457021 CAGTCCCCTTAGAAGATCAAGGG + Intergenic
1054593752 9:67041573-67041595 ATGACCTCATAGAATAACTAGGG + Intergenic
1058171755 9:101689680-101689702 TTCTCCCCATATAAGGACAAAGG + Intronic
1058693855 9:107542486-107542508 ATGTCCCCAAAGAGCAAGAATGG - Intergenic
1058862753 9:109132622-109132644 GTGTCCCTATCTAAGAACAAGGG + Exonic
1058979985 9:110160145-110160167 ATATCTTCATAGAGGAACAAGGG - Intronic
1058984833 9:110200884-110200906 ATGGCCTTATAGAAGAACCAAGG - Exonic
1061434825 9:130554620-130554642 TTGTCCCCAGAGAAGTTCAAAGG + Intergenic
1062244535 9:135558195-135558217 ATCTCCCCAGAGAAGATCTATGG - Intergenic
1186238727 X:7543386-7543408 ACTTACCCATAGAAGATCAAAGG + Intergenic
1192589963 X:72351507-72351529 ATGTCACCTCAGAAGGACAAAGG - Intronic
1193069955 X:77296811-77296833 CTGTCCCCCAAGAAGAAAAATGG + Intergenic
1193449512 X:81648193-81648215 ATGTTCCCATAGAAAAACTTTGG - Intergenic
1197067058 X:122245963-122245985 CTGTCCCCAGAAATGAACAAGGG + Intergenic
1199031181 X:143002348-143002370 ATGTCCCCAAAGGAAAAGAAAGG + Intergenic
1201340443 Y:12927175-12927197 ATGTCACCATTGAGGAACATTGG + Intergenic