ID: 1162456131

View in Genome Browser
Species Human (GRCh38)
Location 19:10786135-10786157
Sequence CTGTAGATGCAGATGCAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 262}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162456128_1162456131 13 Left 1162456128 19:10786099-10786121 CCACATTTGTCTATTTTGAATCT 0: 1
1: 0
2: 7
3: 86
4: 809
Right 1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 262
1162456125_1162456131 24 Left 1162456125 19:10786088-10786110 CCATGCCTGGCCCACATTTGTCT 0: 1
1: 3
2: 39
3: 385
4: 3843
Right 1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 262
1162456127_1162456131 14 Left 1162456127 19:10786098-10786120 CCCACATTTGTCTATTTTGAATC 0: 1
1: 0
2: 3
3: 30
4: 512
Right 1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 262
1162456124_1162456131 27 Left 1162456124 19:10786085-10786107 CCACCATGCCTGGCCCACATTTG 0: 2
1: 39
2: 343
3: 3343
4: 34840
Right 1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 262
1162456126_1162456131 19 Left 1162456126 19:10786093-10786115 CCTGGCCCACATTTGTCTATTTT 0: 1
1: 1
2: 7
3: 149
4: 1480
Right 1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162456131 Original CRISPR CTGTAGATGCAGATGCAGCC GGG Intronic
900852057 1:5151693-5151715 CTGGGGAGGCAGCTGCAGCCAGG + Intergenic
900917685 1:5650150-5650172 CTGGAGATGCTGCTTCAGCCTGG - Intergenic
900922534 1:5682586-5682608 CTGTACTTGCAGACGCAACCTGG - Intergenic
901226325 1:7614841-7614863 AAGTGGATGCAGATGGAGCCAGG - Intronic
901775623 1:11558762-11558784 GTGGAGATGCTGATGCTGCCAGG - Intergenic
903424702 1:23245156-23245178 CTGAAGCTGCAGCTGTAGCCTGG - Intergenic
903931039 1:26862775-26862797 CTGTCGAGGCTGAAGCAGCCAGG + Intergenic
904035981 1:27558747-27558769 CTGGAGATGCTGATGAAGACAGG - Exonic
905901713 1:41585776-41585798 TTGGAGATGCAGATGCTGCTGGG + Intronic
905909217 1:41642297-41642319 GTGTTGATGCCGAGGCAGCCTGG - Intronic
905914922 1:41678194-41678216 CAGCAGATGCAGATGCTGCCAGG - Intronic
906058062 1:42931207-42931229 CTGCAGGGGGAGATGCAGCCTGG + Intronic
907194081 1:52672348-52672370 TTGTAGTTGCAGATGCATGCAGG + Intergenic
910427682 1:87132563-87132585 GGGTAAATGGAGATGCAGCCGGG - Intronic
911666543 1:100559283-100559305 CTTTATTTGCAGATGAAGCCTGG - Intergenic
913087747 1:115454952-115454974 CTGTAGAGGCTGATACACCCAGG - Intergenic
913556188 1:119969552-119969574 CGGTCGATGCAGGTGGAGCCTGG + Exonic
915346933 1:155202355-155202377 GTGTTGATGCAGCTGGAGCCCGG + Exonic
916873128 1:168938854-168938876 CTGAAGCTGGAGCTGCAGCCTGG - Intergenic
917615272 1:176737370-176737392 ATGTACATGCAGATTCAGGCTGG + Intronic
917708612 1:177660341-177660363 CTGTCAATGCAGATGCATGCTGG + Intergenic
918048643 1:180955981-180956003 CTGTTCATGCAGGTGCAGCAGGG - Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920615436 1:207487836-207487858 CTGCAGGTGCAGATGAAGGCAGG + Intronic
921119547 1:212124926-212124948 ATCTAGATGCAGATGGAGTCAGG - Intergenic
922475781 1:225906157-225906179 CTGTAGATGGTGAGCCAGCCTGG + Intronic
922681619 1:227603107-227603129 GTGGAGATGCTGAGGCAGCCAGG - Intronic
1064969328 10:21048341-21048363 ATGTAAATACAGATGCAGTCTGG + Intronic
1065084856 10:22164216-22164238 CTGGAGCTGAAGCTGCAGCCTGG - Intergenic
1065968318 10:30786153-30786175 CTGGAGATGCAGTTTCAGGCTGG - Intergenic
1065968326 10:30786225-30786247 CTGGAGATGCAGTTTCAGGCTGG - Intergenic
1066005706 10:31144429-31144451 CTGGAGAGGCAGCTGCAGGCAGG - Intergenic
1066659026 10:37721362-37721384 CTGCAGCTGCAGAGGCATCCTGG + Intergenic
1067709548 10:48637178-48637200 CTGAAGCTGCAGATGGAGACAGG + Intronic
1070270553 10:74950406-74950428 CTGTTACTGCAGATGCAGACGGG + Intronic
1070284803 10:75075116-75075138 CTGAAGATGCAGCTTCAGCAGGG + Intergenic
1070359783 10:75676425-75676447 CTGTATTTTCAGATGCAACCTGG - Intronic
1072034631 10:91552671-91552693 CTGGGGATGCAGCTGGAGCCGGG - Intergenic
1076255738 10:129023101-129023123 CAGTGGATGCAAATGCAGCCAGG - Intergenic
1076310416 10:129502272-129502294 GTGTAGATGAAGAAGCAGACAGG - Intronic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1078089306 11:8254475-8254497 GCATATATGCAGATGCAGCCAGG - Intronic
1078574044 11:12483654-12483676 CTGTAGCTGCAGATGAATGCAGG + Intronic
1079054533 11:17194233-17194255 CTGAAGCTGGAGTTGCAGCCTGG - Intronic
1080880525 11:36315975-36315997 CTGTTCATGGAGATGGAGCCTGG + Intronic
1083501837 11:63115930-63115952 CTGAAGCTGGAGCTGCAGCCTGG + Intronic
1084269902 11:68023166-68023188 CTTAAGCTGCAGAGGCAGCCTGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1086720567 11:90116255-90116277 CTCTAGAAGCAGAGGGAGCCAGG - Intergenic
1089314745 11:117583747-117583769 CTGTGGATGAAGATGCAGAGAGG - Intronic
1091317281 11:134623476-134623498 CTGAAGATGGAGATGCTACCAGG - Intergenic
1091413771 12:262251-262273 CTGTAGAGTCAGATGAGGCCAGG + Intronic
1091697931 12:2640562-2640584 CTGCAGATGCAGATGCCAACTGG - Intronic
1091703802 12:2680431-2680453 CTGGAGCTGCTGATGCAGACAGG - Intronic
1091704364 12:2683884-2683906 CTGGAGCTGCCGATGCAGACAGG + Intronic
1091875469 12:3930009-3930031 CAGTAGACGCAGAGGCTGCCTGG - Intergenic
1092531936 12:9352142-9352164 CTGTAGAAGGAGAGGCTGCCGGG - Intergenic
1092883904 12:12909166-12909188 CTCAAGGTACAGATGCAGCCTGG + Exonic
1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG + Intergenic
1094266341 12:28564728-28564750 CTGAAGCTGGAGTTGCAGCCTGG + Intronic
1100531708 12:95467447-95467469 CTGAAGCTGGAGCTGCAGCCTGG + Intergenic
1100840974 12:98611500-98611522 CTGTAGATAGAGATGGAGACAGG - Intergenic
1102947251 12:117000449-117000471 CTGTAGATTCTGATGCATGCTGG - Intronic
1104679433 12:130739331-130739353 CTGTAGAAGCAGCTGCGCCCAGG + Intergenic
1104999883 12:132683361-132683383 CTGAAGATGAAGAAGCAGCAAGG + Intronic
1105458183 13:20560222-20560244 CTGGTGATGCAGTTGCAGCCAGG - Intergenic
1105896784 13:24723355-24723377 CTGTGGATGCTGCTGCAGCCTGG + Intergenic
1106671626 13:31912229-31912251 CTGAATCTGCAGATCCAGCCTGG - Intergenic
1107260701 13:38487377-38487399 CTCCAGATGAGGATGCAGCCTGG - Intergenic
1107276759 13:38687627-38687649 CTGGTGTTGCAGGTGCAGCCCGG + Exonic
1107352268 13:39528248-39528270 ATTCAGAGGCAGATGCAGCCTGG - Intronic
1108871680 13:54994558-54994580 GTGAAGAAGTAGATGCAGCCAGG + Intergenic
1110568273 13:76977914-76977936 ATGCAGATGCAGATACAGGCTGG + Intergenic
1111397099 13:87677819-87677841 CCGCAGCTGCAGCTGCAGCCCGG + Exonic
1113246433 13:108401879-108401901 CTGTACTTGCAGATGCAGTCAGG - Intergenic
1113681554 13:112248221-112248243 CTGGAGAGGCCGATGCAGCCAGG - Intergenic
1113999786 14:16403328-16403350 CTGTGGACTCAGATTCAGCCAGG - Intergenic
1114629373 14:24149344-24149366 CAGCAGATTCAGATGTAGCCTGG + Intronic
1117021497 14:51575441-51575463 CTGCAGATGCAGATGCTCCTTGG + Intronic
1118688849 14:68318683-68318705 CTCTAGCTACAGCTGCAGCCTGG - Intronic
1118833086 14:69453235-69453257 CTTTAGATCCAGAAGCAGCAAGG + Exonic
1119806320 14:77484720-77484742 CTGGAGCTGCAGAAGCTGCCGGG - Exonic
1122673926 14:103394366-103394388 CTGTACAAGCAGGTGCAGACGGG - Intronic
1122810543 14:104285550-104285572 CTGTCATTGCAGATGAAGCCTGG - Intergenic
1127503179 15:59573603-59573625 CTGGAGATGTAGATGGAGACAGG + Intergenic
1128783921 15:70380763-70380785 CTCTGGATGCAGATGAAGCTGGG - Intergenic
1129083326 15:73061374-73061396 CTGTAGATACAGTTGCTGTCTGG + Intronic
1130710471 15:86275804-86275826 ATCTAGATGGAGAAGCAGCCTGG - Intronic
1132590594 16:724735-724757 CTTGAGCTGCAGCTGCAGCCGGG + Exonic
1132598268 16:762915-762937 CTGGAGCTGGAGATCCAGCCAGG + Intronic
1132867984 16:2103282-2103304 GTTGAGCTGCAGATGCAGCCCGG + Exonic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134176904 16:12014356-12014378 GTCTAGATGCAAATGCTGCCTGG - Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134853018 16:17497374-17497396 TTGTATATGCAAATGCATCCTGG - Intergenic
1137445678 16:48530603-48530625 CTGCACAGGCAGATGCAGCAAGG - Intergenic
1137715545 16:50596087-50596109 CTGTACATGCATAGGAAGCCAGG - Intronic
1138601832 16:58060244-58060266 CTGAAAATGCAGGTGGAGCCAGG - Intergenic
1140067432 16:71623817-71623839 CTATGGATGCAGAGGAAGCCTGG - Intergenic
1141213995 16:82007554-82007576 CTGTAGAGTCAGATGCACCTGGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1142665896 17:1463653-1463675 CTGTAGAGGAAGGTTCAGCCAGG + Intergenic
1143116092 17:4582575-4582597 CAGTAGCTGGAGATGCACCCAGG - Intergenic
1143570451 17:7754778-7754800 CTGAAGCTGGAGCTGCAGCCTGG - Intronic
1147855497 17:43476590-43476612 CTGAAGCTGGAGCTGCAGCCTGG - Intergenic
1147906463 17:43826365-43826387 CAGGTGATGCTGATGCAGCCGGG - Intronic
1149519752 17:57309871-57309893 CAATAGATTCAGAAGCAGCCTGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150959371 17:69897163-69897185 CTCCAGATGAAAATGCAGCCTGG - Intergenic
1151988206 17:77557525-77557547 CTGTGGGTGCTGATGCAGGCCGG - Intergenic
1153240777 18:3029653-3029675 GTCTGGAAGCAGATGCAGCCTGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155422204 18:25667589-25667611 CCTTAGGTGCAGATGCAGGCAGG - Intergenic
1157822179 18:50780364-50780386 CTCTAGAAGAGGATGCAGCCTGG - Intergenic
1158077363 18:53546150-53546172 CTGAAGATGCAGTTGAAGACAGG + Intergenic
1158989680 18:62855841-62855863 CACTAGATGCAGAGGCCGCCTGG + Intronic
1159568420 18:70083239-70083261 CTGTGGATGCAGAAGCATACTGG - Intronic
1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG + Intronic
1163484530 19:17577985-17578007 CTGGGGATCCAGATGCTGCCTGG + Exonic
1164526198 19:29015305-29015327 CTCAGGATGCAGATTCAGCCTGG - Intergenic
1164697381 19:30255979-30256001 CTGCAGATGCAGAGGCCTCCTGG - Intronic
1165437172 19:35802302-35802324 CTGTAGATGCAGCCACAGTCTGG - Intronic
925261277 2:2530553-2530575 CTCTGGCTGCCGATGCAGCCTGG + Intergenic
926460055 2:13117957-13117979 CTGTAGTTAGAGATGGAGCCTGG - Intergenic
927851953 2:26504859-26504881 CTGTAGGTCCAGGTGGAGCCAGG + Intronic
928531119 2:32192354-32192376 CTGTGGAGGCAAATACAGCCAGG - Exonic
928786216 2:34888920-34888942 GTGTAGATGCAGATTGAACCTGG + Intergenic
929161203 2:38833989-38834011 CTCTAGATGCAAATGGCGCCAGG - Intronic
929340681 2:40813201-40813223 CAGGTGATTCAGATGCAGCCGGG - Intergenic
931289706 2:60861810-60861832 CAGGGGATGCAGATGCATCCAGG - Intergenic
932293895 2:70608552-70608574 CTGTTACTGCAGATTCAGCCAGG - Intronic
932419059 2:71590746-71590768 CAGGAAATGCAGAGGCAGCCTGG - Intronic
932434068 2:71692840-71692862 TTGCAGATCCAGATGCAGCTAGG + Intergenic
932498847 2:72162434-72162456 CTGTAGATGGAGAAGCAGTTAGG - Intergenic
933902331 2:86859061-86859083 CTGTACATCCAGTGGCAGCCAGG - Intronic
935778214 2:106490207-106490229 CTGTACATCCAGTGGCAGCCAGG + Intergenic
936290271 2:111217459-111217481 CTGCAGCTGCAGCTGCACCCAGG + Intergenic
937307158 2:120879324-120879346 CTGGAGAGTCAGTTGCAGCCAGG + Intronic
942775364 2:179575130-179575152 CTGTATATGCAGATACCTCCTGG + Intronic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943470168 2:188285285-188285307 CTGTTGATGCAGAACCAGCATGG + Intergenic
944298238 2:198092036-198092058 CTGGAGATGCAGGTGCAGTTGGG - Intronic
946289338 2:218731813-218731835 CCGTAGCTGCTCATGCAGCCTGG + Intronic
946596484 2:221311007-221311029 GTGTAAATGCAAATACAGCCAGG + Intergenic
947233857 2:227919910-227919932 CTGTAGGTGCAGAAGCAGAAAGG - Intronic
947348260 2:229216255-229216277 CTGTAGATGCACGTGCCCCCGGG - Intronic
947945356 2:234097158-234097180 CTGAAGATGAAGTTGCCGCCTGG + Intergenic
948228547 2:236332885-236332907 CTGTGGATGCATAGGCATCCAGG + Intronic
948962393 2:241350115-241350137 ATGCAGATGCAGATGCAGGGCGG + Exonic
1170852989 20:20020893-20020915 TTGAAGATGCAGATGCAGGAGGG + Intronic
1171727206 20:28635479-28635501 CTGTGGACTCAGATTCAGCCAGG - Intergenic
1171791925 20:29534792-29534814 CTGTGGACTCAGATTCAGCCAGG - Intergenic
1171856416 20:30348092-30348114 CTGTGGACTCAGATTCAGCCAGG + Intergenic
1172288623 20:33758909-33758931 CTGAACATGCAAGTGCAGCCTGG - Intronic
1172631601 20:36382116-36382138 CTGGAGGTGGAGAAGCAGCCTGG + Intronic
1175485054 20:59339743-59339765 CTTTAGTTGCACATGCAGGCTGG + Intergenic
1176313725 21:5221792-5221814 CTGTGGACTCAGATTCAGCCAGG - Intergenic
1176368129 21:6045833-6045855 CTGGAGCTGCAGCTGCTGCCCGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179086457 21:38222603-38222625 CTGCTGATGCAGAAGCAGACAGG + Intronic
1179755390 21:43492709-43492731 CTGGAGCTGCAGCTGCTGCCCGG + Intergenic
1180391546 22:12287901-12287923 CTGTGGACTCAGATTCAGCCAGG - Intergenic
1180408199 22:12576853-12576875 CTGTGGACTCAGATTCAGCCAGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182066643 22:27435855-27435877 CTGTGGCTGCAAATACAGCCGGG - Intergenic
1182160375 22:28115522-28115544 CTCTAGATACAGATTTAGCCAGG - Intronic
1182558510 22:31141665-31141687 CTGTAGCTTCAGAACCAGCCTGG + Intergenic
1184808580 22:46812689-46812711 TTTTAGTTGAAGATGCAGCCAGG + Intronic
1184857580 22:47154815-47154837 CTTTAGGAGCAGAAGCAGCCTGG + Intronic
950418154 3:12880390-12880412 GTGCAGATGCAGAGGCAGCTGGG + Intergenic
950544139 3:13628943-13628965 GTGTTGATGCAGCTGAAGCCTGG - Exonic
950689395 3:14643654-14643676 AGGTAGATGCAGAAGCTGCCTGG - Intergenic
952772658 3:37016573-37016595 CTGAAGGTGGAGCTGCAGCCTGG + Intronic
953848103 3:46444806-46444828 CTGCAGAAGCAGGTGGAGCCAGG + Intronic
954160197 3:48716146-48716168 CTGTATTTGCAGTTGTAGCCAGG - Intronic
955317597 3:57951799-57951821 CTGGAGGGGCAGAGGCAGCCTGG - Intergenic
957710187 3:83847295-83847317 CTCTAGATGAATATGCAGCATGG - Intergenic
958958961 3:100491240-100491262 CTGCAGATGACAATGCAGCCCGG + Intergenic
960846572 3:122009368-122009390 CTTTAGATTCAGATACAGCTGGG + Intronic
961885128 3:130091971-130091993 CTGGTGCTGCTGATGCAGCCGGG + Intronic
965629178 3:170713344-170713366 CTGTGGATGAAGAGCCAGCCTGG + Intronic
968422448 4:497159-497181 CTGTCGATGCAGAAGCAGGCAGG + Intronic
968759504 4:2434774-2434796 CTGTGGATGTGGGTGCAGCCTGG - Intronic
973801823 4:54485852-54485874 CTGTAGATGTATATGGGGCCTGG + Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974078393 4:57188769-57188791 CAGTTGATGCTGATGCTGCCAGG + Intergenic
974091505 4:57316026-57316048 CTGTAGAGGTAGATGGGGCCAGG + Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
979973166 4:127162893-127162915 CTGTAGAGTCATATGCACCCTGG - Intergenic
980267629 4:130539091-130539113 CTGTAGTTTCAGAGGCAGCAAGG + Intergenic
980988244 4:139716240-139716262 CTGTGGGTGCAGGTGAAGCCAGG + Intronic
983491740 4:168397892-168397914 CTGCAGCTGCAGCTGCAGCTTGG - Intronic
984222580 4:176995705-176995727 TTCTAGAAGCAGATGCAGACTGG - Intergenic
985516313 5:346747-346769 CTGCAGATGCAGCATCAGCCAGG + Intronic
985741713 5:1621217-1621239 CTGCAGCTGGAGATGCAGACAGG - Intergenic
986998796 5:13637968-13637990 CTGAAGCTGGAGCTGCAGCCAGG + Intergenic
989648988 5:43666818-43666840 CTGAAGCTGGAGCTGCAGCCTGG + Intronic
992506394 5:77391367-77391389 CGGCAGATGCTGCTGCAGCCAGG + Intronic
992715861 5:79510822-79510844 CTGAAGCTGGAGCTGCAGCCTGG - Intronic
992839026 5:80668748-80668770 CTGTGGCTGCAGCTGCACCCAGG + Intronic
994291763 5:98034890-98034912 CAGTAGCTGCAGCTGAAGCCAGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994753331 5:103764801-103764823 CTGTAGCTGCAGCTGCGCCCAGG + Intergenic
994844697 5:104973589-104973611 GTGTGGATGTAGAAGCAGCCCGG - Intergenic
995597443 5:113763170-113763192 CTGGACATGCAGTTGCAGGCTGG + Intergenic
995808988 5:116084382-116084404 CTGCAGATGCAGATACAGGAGGG + Intergenic
999165429 5:149545439-149545461 CTGAAGCTGGAGCTGCAGCCTGG + Intronic
999740013 5:154542738-154542760 CTCTGGATCCAGAGGCAGCCAGG + Intergenic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004712712 6:18187723-18187745 ATGTACATGCAGATTCTGCCAGG - Intronic
1004765173 6:18718278-18718300 CTTTAGATGCAGATAAAGCTTGG + Intergenic
1004884961 6:20042508-20042530 CTGAAGCTGGAGCTGCAGCCTGG + Intergenic
1005852655 6:29833352-29833374 CTGTAGCTGCAGAGGCATCTGGG - Intergenic
1005876244 6:30011869-30011891 CTGTAGCTGCAGAGGCATCTGGG - Intergenic
1007754346 6:44089295-44089317 CTGAAGCTGGAGCTGCAGCCTGG + Intergenic
1012257662 6:97052252-97052274 ATGCACATGCAGATGCAGACTGG + Intronic
1013130121 6:107224568-107224590 CTGTATATGCAGAGGTAGTCAGG - Intronic
1014146070 6:117999373-117999395 CTGAAGCTGGAGCTGCAGCCTGG - Intronic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1017675635 6:156810998-156811020 CTCTAGATGAGAATGCAGCCCGG - Intronic
1017700111 6:157061225-157061247 ATGTAAATTCAAATGCAGCCAGG - Intronic
1017764767 6:157597629-157597651 CTCTGGAGGCAGCTGCAGCCTGG + Intronic
1018672950 6:166194631-166194653 CTGTGGAAGCAGATGCCTCCCGG + Intergenic
1018926015 6:168207574-168207596 CGGGAGGTGCAGCTGCAGCCAGG + Intergenic
1019087045 6:169488260-169488282 CTGTTGCTGGAGAGGCAGCCAGG + Intronic
1019317010 7:391484-391506 CTGTGTGTGCAGAAGCAGCCAGG + Intergenic
1022613147 7:31897216-31897238 CTGCTGATGCAGGTGCAGTCAGG + Intronic
1024934891 7:54702074-54702096 CTGTAGAGGCAGAGACAGGCGGG + Intergenic
1025023210 7:55496032-55496054 CTGTAGCTGCACTGGCAGCCAGG - Intronic
1025716797 7:63964795-63964817 CCGTCAATGCAGATGCAGTCAGG + Intergenic
1026091929 7:67307658-67307680 CTGAAGCTGGAGCTGCAGCCTGG + Intergenic
1027144316 7:75683498-75683520 CTGTGTGTGCAGATGCACCCTGG + Intronic
1028455457 7:91033527-91033549 CTGTAGATTCTGATTCAGCAGGG + Intronic
1028456460 7:91043229-91043251 TTGTAGAAACAGAGGCAGCCAGG + Intronic
1029377358 7:100187542-100187564 CTGAAGGTGGAGGTGCAGCCTGG + Intronic
1029540124 7:101177926-101177948 CTGGAGCTGCAGATGGAGTCAGG - Intronic
1031057586 7:117010483-117010505 ATGCTGATGCAGATGCAGGCTGG + Intronic
1033273702 7:139955606-139955628 CTGTAAGTGCGGCTGCAGCCCGG + Exonic
1034140110 7:148807696-148807718 CTGTTGTTTCAGATACAGCCAGG - Exonic
1034272145 7:149808521-149808543 CTGTAGCTGCAGCTGCAACGTGG + Intergenic
1034325066 7:150222256-150222278 CTGTGGATGCAGATGCTGGTTGG + Intergenic
1034768135 7:153746993-153747015 CTGTAGATGCAGATGCTGGTTGG - Intergenic
1035363298 7:158328555-158328577 CTGTGGGTGCAGGTGCTGCCCGG - Intronic
1036637061 8:10558433-10558455 ATGAAGATGGAGATGCAACCAGG - Intergenic
1039705946 8:40007607-40007629 CTATAGATGCAGAAACAGACTGG + Intronic
1041477101 8:58278799-58278821 CTGGAGCTCCAGATGCAGGCAGG - Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1043120905 8:76322415-76322437 ATGTATATGTAGATACAGCCAGG + Intergenic
1044828769 8:96224575-96224597 CTGTTGAGGGTGATGCAGCCTGG - Intergenic
1045713283 8:105011493-105011515 CTGTAGCTGGAGCTGCAGCCTGG - Intronic
1045911870 8:107419398-107419420 CTGTTTATGCAGATTCATCCTGG - Intronic
1048766688 8:137852279-137852301 CTTCAGAGGCAGATGCAGGCTGG - Intergenic
1049425099 8:142534422-142534444 CTGAAGATGGGGATGCCGCCTGG + Intronic
1050946247 9:11523125-11523147 CTGTAGAGGGAGATATAGCCTGG - Intergenic
1051161748 9:14216445-14216467 CTGTGGATACAGATGCACCTTGG - Intronic
1052820615 9:33135498-33135520 CTGCAGCTGCAGCTGCAGCCTGG - Intronic
1053156173 9:35781258-35781280 CTGGAGAGGAAGATGGAGCCAGG + Intergenic
1053722542 9:40961623-40961645 CTGTGGACTCAGATTCAGCCAGG + Intergenic
1056688061 9:88783028-88783050 CTGTAAATCCAGTCGCAGCCTGG - Intergenic
1057466746 9:95321148-95321170 CTGTAAATGGAGTTGAAGCCAGG - Intergenic
1059405643 9:114097202-114097224 CTGAAGCTGCAGCTGCAGTCTGG + Intronic
1059465999 9:114469287-114469309 CTGTAGATGGAACTCCAGCCTGG - Intronic
1061175779 9:128995797-128995819 CACAAGAGGCAGATGCAGCCAGG - Intronic
1062494896 9:136827041-136827063 CTGTGGGTGCAGAGGCCGCCTGG + Intronic
1062538068 9:137029494-137029516 CTGGGGATGCGGCTGCAGCCAGG - Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186595326 X:10975162-10975184 CTTTAGAAGCAGGTGCAACCAGG - Intergenic
1187313921 X:18174204-18174226 CTGCAGATGCCGATGCAACACGG + Exonic
1189623027 X:42864057-42864079 TTGTAGATGCAGATGCTATCTGG + Intergenic
1195016363 X:100785588-100785610 CTGCATATGCAGAAGCAGACAGG - Intergenic
1196921679 X:120591734-120591756 CCTTAGAGGCAGCTGCAGCCTGG - Intergenic
1196949908 X:120867007-120867029 CTGTAGATGCAAACCCAACCAGG + Intergenic
1198130752 X:133692423-133692445 CTATGGCTGCAGATGTAGCCAGG + Exonic
1201386299 Y:13443035-13443057 CTGATGATGCACATGCAGCTAGG - Intronic