ID: 1162456175

View in Genome Browser
Species Human (GRCh38)
Location 19:10786383-10786405
Sequence GACACACTCATGTCTGGGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162456175_1162456179 11 Left 1162456175 19:10786383-10786405 CCGTTCCCAGACATGAGTGTGTC 0: 1
1: 0
2: 2
3: 15
4: 180
Right 1162456179 19:10786417-10786439 TTATCTGTTGCTGTCTCTCAAGG 0: 1
1: 0
2: 1
3: 33
4: 293
1162456175_1162456181 24 Left 1162456175 19:10786383-10786405 CCGTTCCCAGACATGAGTGTGTC 0: 1
1: 0
2: 2
3: 15
4: 180
Right 1162456181 19:10786430-10786452 TCTCTCAAGGCTGTGTGGTGTGG 0: 1
1: 0
2: 1
3: 27
4: 280
1162456175_1162456180 19 Left 1162456175 19:10786383-10786405 CCGTTCCCAGACATGAGTGTGTC 0: 1
1: 0
2: 2
3: 15
4: 180
Right 1162456180 19:10786425-10786447 TGCTGTCTCTCAAGGCTGTGTGG 0: 1
1: 0
2: 4
3: 46
4: 334
1162456175_1162456182 27 Left 1162456175 19:10786383-10786405 CCGTTCCCAGACATGAGTGTGTC 0: 1
1: 0
2: 2
3: 15
4: 180
Right 1162456182 19:10786433-10786455 CTCAAGGCTGTGTGGTGTGGTGG 0: 1
1: 0
2: 2
3: 32
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162456175 Original CRISPR GACACACTCATGTCTGGGAA CGG (reversed) Intronic
901798307 1:11692738-11692760 GACACACTGGTGTCTGGAACCGG + Intronic
903718342 1:25385972-25385994 TACACATTCAAGTCTGAGAAGGG - Intronic
904283308 1:29436662-29436684 GACAAACTGATTTCTGGGGACGG + Intergenic
906130459 1:43452501-43452523 GACACTGAGATGTCTGGGAAAGG - Exonic
910031690 1:82733402-82733424 AAGACAGTCATGTCTGGGCATGG - Intergenic
910703795 1:90105008-90105030 AACACACTCATCTTTGGGGATGG - Intergenic
912368099 1:109151353-109151375 GTCACACTGAAGCCTGGGAAAGG - Intronic
913717849 1:121556147-121556169 CACACACTCATGGGTGAGAATGG - Intergenic
918888930 1:190238154-190238176 GAAACACTTATTTCTGGAAAAGG - Intronic
919210000 1:194469944-194469966 TACAGACTCAGGACTGGGAATGG + Intergenic
919334746 1:196218277-196218299 GACTAACTCATTTGTGGGAAGGG - Intergenic
920111567 1:203590954-203590976 TAGACAGTCATTTCTGGGAAGGG - Intergenic
920253361 1:204637607-204637629 GGCAGACTCTGGTCTGGGAAAGG - Intronic
920315774 1:205074750-205074772 GACTCACTCCTGCCTGGGAGGGG + Exonic
920564002 1:206959607-206959629 GACACCCTCAGGGCTGGGTAGGG - Intronic
921718416 1:218443520-218443542 CACACACTCAAATCTGGGATTGG - Exonic
923820341 1:237432498-237432520 GACTCAGTCTTCTCTGGGAAGGG + Intronic
924241489 1:242045214-242045236 GATACACTAATGCCTTGGAAAGG - Intergenic
1063461244 10:6216223-6216245 GACACCCTCATGGGTGGGACTGG - Intronic
1065687999 10:28305038-28305060 GACACACTTAATTTTGGGAAAGG + Intronic
1067211517 10:44263481-44263503 GCCACCCACATGTCAGGGAAGGG + Intergenic
1068725613 10:60298849-60298871 GAAATACTCATTGCTGGGAAGGG - Intronic
1070353997 10:75621366-75621388 GGCACACACATGTGTGGAAAAGG - Intronic
1071859388 10:89656685-89656707 GACACACTGATGCATGGGATGGG - Intergenic
1074555822 10:114488866-114488888 GACACATTCAAGTGTGGGGATGG + Intronic
1075027745 10:118998990-118999012 GACTAGCTCAAGTCTGGGAATGG - Intergenic
1075170868 10:120112453-120112475 GACACTCACAAGTCTGGGAATGG + Intergenic
1075590816 10:123690075-123690097 CACACAGTCATGTCTGGCAGTGG - Exonic
1076023258 10:127091689-127091711 GACACGCTCTTCTCTGGGAAGGG - Intronic
1076478380 10:130768031-130768053 GACATAGGCATGGCTGGGAAAGG - Intergenic
1077660082 11:4060086-4060108 GACACACTCAGGCCTAAGAAAGG + Intronic
1077997325 11:7465217-7465239 CACACACACATCTCTGGGAAAGG - Intronic
1078679442 11:13462527-13462549 GACACCCTTATCTTTGGGAATGG - Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1079269771 11:18973082-18973104 GACACCCTCATGACTAGGACTGG + Intergenic
1080496081 11:32820719-32820741 GACACATTCAGTTCTGGGAAGGG - Intergenic
1081475143 11:43422255-43422277 GAGATACTCAGGTCTGAGAAAGG + Intronic
1082093253 11:48106575-48106597 GACACAGTCATGTCAGAGAGAGG + Intronic
1083954173 11:65973981-65974003 GGGACACTCAAGTCTGGGCAGGG + Intronic
1084557211 11:69882232-69882254 GACACACACAAGTCAGGGAGGGG - Intergenic
1084684194 11:70684272-70684294 GGCACACTCCTGGCTGGGCACGG + Intronic
1085141557 11:74148132-74148154 GAAATACTCATGTTTGTGAATGG + Intronic
1085236669 11:75020737-75020759 ACCACTCTCATGTCTGGGCAGGG + Intergenic
1086591941 11:88525121-88525143 GACACCCTCATGTGTAGTAATGG - Intronic
1088292180 11:108251376-108251398 GACACACTCATGTAGGGTGATGG + Intronic
1090683364 11:129086529-129086551 GACACACTGATGGCCGGGCATGG + Intronic
1091561659 12:1619024-1619046 GGCACACACATTTCTGGGGAAGG + Intronic
1093195633 12:16126621-16126643 GCCACATTCATGTCTGGAATAGG + Intergenic
1093411042 12:18867464-18867486 AGCACTCTCATGCCTGGGAAGGG - Intergenic
1094065510 12:26357369-26357391 GACACACTAATGTGTAGGGAGGG + Intronic
1094528413 12:31249295-31249317 GACCCACTCCTCTCTGGTAAAGG - Intergenic
1097693451 12:62755602-62755624 GACACCCCCATGTCTGTGATGGG + Intronic
1100863163 12:98828992-98829014 GAGACAGAAATGTCTGGGAATGG - Intronic
1102317771 12:111903855-111903877 GATTCACTCATTTCTGGGGAGGG - Intergenic
1102388440 12:112530229-112530251 AGCACTCTCATGCCTGGGAAGGG + Intergenic
1104758426 12:131282987-131283009 GGCACACTCCTGCCCGGGAAGGG - Intergenic
1105844000 13:24279400-24279422 GACACAATCCAGTCTAGGAATGG + Intronic
1110290035 13:73794695-73794717 GACACACTGACAGCTGGGAAGGG - Intronic
1111596313 13:90416080-90416102 TGAACACTTATGTCTGGGAATGG - Intergenic
1112624631 13:101090035-101090057 CCCACACTCATGACTGGAAAGGG - Intronic
1113626385 13:111850989-111851011 GACACCCTCCTCTCTGTGAAAGG + Intergenic
1114363195 14:21998597-21998619 GACCCACTGATGTCTTGGGAGGG - Intergenic
1115425724 14:33257089-33257111 AAAACAATCATGTCTGGGAGTGG - Intronic
1116308107 14:43283930-43283952 GACAGTCACATGTCAGGGAATGG - Intergenic
1120527519 14:85594408-85594430 CACACACACATCTCTGGGAGTGG - Intronic
1121342408 14:93113597-93113619 GATACACTCACTTGTGGGAAGGG - Intronic
1121939147 14:98052916-98052938 TACACACTGAAGTCTGAGAATGG + Intergenic
1122765985 14:104070528-104070550 GAGACACCCATGTCAGAGAATGG + Intergenic
1124185022 15:27517370-27517392 AAAGCACCCATGTCTGGGAAAGG + Intronic
1124829343 15:33132939-33132961 GAAACATACATGCCTGGGAAAGG + Intronic
1126393221 15:48181453-48181475 GACACACTCATCTGTGGGGGAGG + Intergenic
1127111924 15:55683467-55683489 TACACTCTCATTGCTGGGAAGGG - Intronic
1127775328 15:62260162-62260184 AACAAACTGATGTCTGAGAAAGG - Intergenic
1128481365 15:68042606-68042628 GCAACACACATGTCTGGGACAGG - Intergenic
1131051974 15:89354334-89354356 TCCACACACAGGTCTGGGAAGGG + Intergenic
1131347447 15:91663618-91663640 CACACACACACGACTGGGAACGG - Intergenic
1132580462 16:682448-682470 GACGCATTCATCTCTGAGAATGG + Exonic
1132929077 16:2449474-2449496 GACACAGGCATCCCTGGGAAGGG - Intronic
1134379815 16:13713409-13713431 GACATACTGATGTCTGGGGAAGG - Intergenic
1135833366 16:25798875-25798897 GACAAACTCATGGCTGGAACAGG - Intronic
1135965791 16:27033900-27033922 GACACAATCATGTCTGGCTGTGG - Intergenic
1138056344 16:53838117-53838139 GACATTCCCATGTCTGGGATGGG - Intronic
1139415842 16:66809169-66809191 CACATTCTCATGTCTGAGAAGGG - Intronic
1139880356 16:70175847-70175869 GAGCCACTCAGGGCTGGGAATGG - Intronic
1140137157 16:72217038-72217060 GACACACTCATCTCTGCCCAGGG - Intergenic
1140372154 16:74419670-74419692 GAGCCACTCAGGGCTGGGAATGG + Intronic
1140473466 16:75227282-75227304 GACACACCCACCTCTGGGAGAGG + Intergenic
1142143860 16:88484556-88484578 GACACACTCAGGAGTGGGAGGGG - Intronic
1144520883 17:15951599-15951621 GACACACACATGGCTAGGCAGGG + Intronic
1145296713 17:21598606-21598628 GACACAGTCAGCTCTAGGAAGGG + Intergenic
1147552880 17:41457027-41457049 GAGACACACAGGTGTGGGAATGG + Intergenic
1147993544 17:44349540-44349562 GGCACGCTCACCTCTGGGAAGGG - Exonic
1149677730 17:58481224-58481246 GAGCCACTGATATCTGGGAAAGG - Intronic
1150524270 17:65905637-65905659 GACACATGCATGGCTGGGTACGG + Intronic
1152265213 17:79290158-79290180 GAGACACACATGTCTGGAAGGGG + Intronic
1155062446 18:22240849-22240871 GTCACAGTCATGACTGGGAGCGG - Intergenic
1157411916 18:47470079-47470101 CAGCCACTCCTGTCTGGGAAGGG - Intergenic
1162456175 19:10786383-10786405 GACACACTCATGTCTGGGAACGG - Intronic
1163223008 19:15935128-15935150 GCCACACTCTTGCCTTGGAAGGG - Intergenic
1163991313 19:21001614-21001636 GACACACTGATGTATGGAAATGG + Intergenic
1165156195 19:33790079-33790101 GACACAGTTCTTTCTGGGAAGGG + Intergenic
1165755926 19:38292972-38292994 AACACACCCCTGTGTGGGAACGG + Intronic
1166617172 19:44260557-44260579 GACACACTCATGCCTTAAAAGGG - Intronic
929228798 2:39538419-39538441 AACACACACATGGCTGGGCATGG + Intergenic
931448617 2:62348453-62348475 GACAGAGTCCTGTCTGGAAAGGG - Intergenic
932571841 2:72942354-72942376 CTCACACTGCTGTCTGGGAATGG + Exonic
932864292 2:75325350-75325372 AACAGCCTCATGTGTGGGAAGGG + Intergenic
934122723 2:88855704-88855726 AACACTCACATGTTTGGGAAGGG - Intergenic
937333217 2:121044931-121044953 GGCACACTCAGGGCTGGGATGGG - Intergenic
938409958 2:131055519-131055541 TACACACTGCTGTGTGGGAAGGG - Intronic
940439294 2:153695297-153695319 GACTCACTCTTATCAGGGAATGG + Intergenic
940450143 2:153826690-153826712 GACAAATGAATGTCTGGGAAAGG + Intergenic
942556595 2:177178220-177178242 GACGCATTCATCTCTGAGAACGG + Intergenic
943145711 2:184042644-184042666 GAGACAGTCATTTCTGGGAAGGG - Intergenic
945020398 2:205565160-205565182 GACACTATCATTTCTGGAAAAGG - Intronic
945999220 2:216466981-216467003 GACGCACCCATGGCTGGCAATGG + Intronic
948053970 2:234997653-234997675 GTCCCACTGATGGCTGGGAAGGG + Intronic
1170746553 20:19104425-19104447 GACACACTCAGCTGTGGGGATGG - Intergenic
1173284714 20:41659760-41659782 GACACACTCAAATTTGAGAAAGG - Intergenic
1174695775 20:52556207-52556229 GAAACACTCATTTGGGGGAAAGG - Intergenic
1175752006 20:61505104-61505126 CTTTCACTCATGTCTGGGAAGGG + Intronic
1175936088 20:62514752-62514774 GACAAAAGCAAGTCTGGGAATGG - Intergenic
1176044338 20:63084511-63084533 GACACACGAATGTTTGGAAATGG - Intergenic
1177406514 21:20674569-20674591 GACACACTCTTGTCTGTAAAGGG + Intergenic
1177415940 21:20793655-20793677 GATACAAATATGTCTGGGAATGG - Intergenic
1178935702 21:36859797-36859819 CCCACAAACATGTCTGGGAATGG - Intronic
1179298025 21:40080714-40080736 GACACTCGAATCTCTGGGAAAGG + Intronic
1180788479 22:18560013-18560035 CACACAGTCAAGTCTGAGAAGGG + Intergenic
1180839849 22:18954207-18954229 GACACCCTAAGGGCTGGGAATGG + Intergenic
1181062046 22:20286272-20286294 GACACCCTAAGGGCTGGGAATGG - Intergenic
1181233258 22:21435305-21435327 CACACAGTCAAGTCTGAGAAGGG - Intronic
1181245392 22:21499538-21499560 CACACAGTCAAGTCTGAGAAGGG + Intergenic
1182142736 22:27975832-27975854 AATACACTGATTTCTGGGAATGG - Intergenic
1183303414 22:37069559-37069581 GGCACACCCATGTCTAGGGAGGG - Intronic
1185247214 22:49779566-49779588 GTCATACTCATTTCTGGCAAGGG + Intronic
952064829 3:29556705-29556727 AATACACTCAAGTCTGGGGAGGG - Intronic
952151301 3:30595632-30595654 AACACACTTATGGCTGGGCATGG + Intergenic
952983189 3:38755104-38755126 GACACAATCCAGCCTGGGAATGG - Intronic
954353848 3:50068336-50068358 GAGTGACTCATGTCTGGGAATGG + Intronic
954451270 3:50572985-50573007 CACACAAACATTTCTGGGAAAGG + Intronic
955804810 3:62722941-62722963 AACTCACACATGTCTGGGAGAGG + Intronic
956113456 3:65894807-65894829 GAGACACTCATAGCTGGGATTGG - Intronic
960197496 3:114787267-114787289 GACTCATTCATGGCTGGGTATGG - Intronic
960672822 3:120168734-120168756 GACCCTCTCAGTTCTGGGAAAGG - Intronic
961824246 3:129590486-129590508 GACACACACATGTGTCGGATGGG + Intronic
964212857 3:154247260-154247282 GACACACACATTTCTGTAAATGG + Intronic
964292360 3:155195272-155195294 GTCACATTCAAGACTGGGAAAGG + Intergenic
964712629 3:159687346-159687368 GACAGACTCATTTCTGAGATGGG - Intronic
965743580 3:171901949-171901971 GACACTCTCTTGACTAGGAAGGG + Intronic
968599232 4:1501369-1501391 GGCACACTCATGTCAGGGGCTGG + Intergenic
972267244 4:37473681-37473703 GACACACTACTGCTTGGGAATGG - Intronic
973886335 4:55325677-55325699 GACACACTGAGGTCTGAGAGAGG - Intergenic
974273140 4:59678984-59679006 GAGACATTAATTTCTGGGAATGG + Intergenic
975599574 4:76085345-76085367 GAGACATTGATGTCTGGGTAGGG + Intronic
978041199 4:104064877-104064899 GACACACCTATGTCTAGGCAGGG + Intergenic
980720106 4:136684583-136684605 GATACACTATTGTCTGGAAAGGG - Intergenic
983164798 4:164462000-164462022 GACACACTTCTTTCAGGGAAAGG - Intergenic
983376692 4:166938080-166938102 TACAAACTCATGGCTGGGCACGG - Intronic
983581654 4:169315675-169315697 GACTTAATCATCTCTGGGAAAGG + Intergenic
984041602 4:174741483-174741505 GCCAATCTCATGTCTGGCAAAGG - Intronic
985022305 4:185704733-185704755 GAAACATTCAGCTCTGGGAAGGG + Intronic
989960719 5:50411728-50411750 CACACACTCATGGGTGAGAATGG + Intronic
990494438 5:56333466-56333488 AACACACTCATGACTGGGAGTGG - Intergenic
991625385 5:68595517-68595539 GAAACACTCATTTGTGAGAAAGG + Intergenic
998383425 5:141742137-141742159 GACCCACTCAAGTCTGGGGTGGG + Intergenic
999896037 5:156034445-156034467 GCCACATTCATATGTGGGAAAGG - Intronic
1002022454 5:176372481-176372503 CACACTCCCATGGCTGGGAAAGG - Exonic
1008906877 6:56687526-56687548 TACACACACATGGCTGAGAACGG + Intronic
1009537549 6:64908389-64908411 AACACACTGCTGTCTGTGAATGG - Intronic
1016555523 6:145332215-145332237 GACACACCCATGCCTGGGGCGGG + Intergenic
1020714492 7:11653436-11653458 CACACACACATATCTGGGAGTGG - Intronic
1025991758 7:66502883-66502905 GACACCCTCATGTCAGGGAAGGG - Intergenic
1029434638 7:100555887-100555909 GACACATTCTTGTCAGGGAGAGG + Intronic
1034974751 7:155441504-155441526 GTCCCACACATGTCTGGGAAGGG + Intergenic
1039931020 8:41989158-41989180 TACACAATCAGGTTTGGGAAGGG + Intronic
1042105329 8:65320217-65320239 GAGACACTAATGTCTGGGAAGGG - Intergenic
1043708265 8:83380142-83380164 GATACACTCAGGTTTGGGAGAGG - Intergenic
1046557186 8:115789892-115789914 TACACACAAATGCCTGGGAATGG - Intronic
1047410045 8:124617109-124617131 GACACACTCATGTGTGGTAGCGG - Intronic
1048459819 8:134612198-134612220 TCCACACTCATGGCTGAGAAAGG - Intronic
1049144452 8:140988437-140988459 GACACCCACATGGCTGGGCATGG + Intronic
1050909836 9:11054971-11054993 GACATACCCAAGGCTGGGAAGGG - Intergenic
1051331005 9:16024947-16024969 GAAAGTCCCATGTCTGGGAATGG - Intronic
1051522961 9:18011440-18011462 CACACACTCATGCCTAGGAGAGG + Intergenic
1052535089 9:29736221-29736243 AACTCAATCATGTCTGGAAATGG + Intergenic
1053356485 9:37450221-37450243 GACACACTCGAGTTTAGGAATGG - Intronic
1055837762 9:80464765-80464787 AACATACTCATGTCTGTGAAAGG - Intergenic
1056870461 9:90272696-90272718 CACACACACATGACTGGTAAAGG - Intergenic
1057146584 9:92763355-92763377 GACACACTCAAGTGGGGGAAGGG + Intronic
1058072846 9:100619303-100619325 GACTCCCTCCTCTCTGGGAAAGG - Intergenic
1058439817 9:104996313-104996335 GACACATTCATATCTCAGAAAGG - Intergenic
1058754884 9:108075055-108075077 GCCACAGTCTGGTCTGGGAATGG - Intergenic
1059244887 9:112841484-112841506 TACACAGTCTTGTCTGGGGAAGG + Intronic
1060715022 9:125917705-125917727 AACACACTCACCTCTGGGATAGG - Intronic
1061656291 9:132093085-132093107 AACACACACATGTCTGGGCATGG - Intergenic
1193175523 X:78388302-78388324 GACACACTAATGTAAGGGATGGG + Intergenic
1195283593 X:103360388-103360410 GCCACACTCCTGTCTAGGATAGG + Intergenic