ID: 1162459955

View in Genome Browser
Species Human (GRCh38)
Location 19:10808951-10808973
Sequence CATAGGAGATAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 650
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 598}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162459955_1162459961 17 Left 1162459955 19:10808951-10808973 CCCTCCTCCTTCTATCTCCTATG 0: 1
1: 0
2: 4
3: 47
4: 598
Right 1162459961 19:10808991-10809013 TCAGAGCATATTTTTCCACATGG 0: 1
1: 0
2: 1
3: 30
4: 240
1162459955_1162459959 -7 Left 1162459955 19:10808951-10808973 CCCTCCTCCTTCTATCTCCTATG 0: 1
1: 0
2: 4
3: 47
4: 598
Right 1162459959 19:10808967-10808989 TCCTATGCAGATGTCACTCATGG 0: 1
1: 0
2: 1
3: 9
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162459955 Original CRISPR CATAGGAGATAGAAGGAGGA GGG (reversed) Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900819892 1:4878625-4878647 CATGGGAGAAAGATGGAGGCTGG - Intergenic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
900932880 1:5747797-5747819 GAAAGGAGAAAGAGGGAGGAAGG + Intergenic
901161907 1:7184191-7184213 GCATGGAGATAGAAGGAGGATGG + Intronic
901269566 1:7941457-7941479 CATGGGTGACAGAGGGAGGAAGG + Intronic
901631392 1:10649857-10649879 CAAAGGAGAGAGAGGGAGGGAGG + Intronic
901928860 1:12584057-12584079 CATAGGAGCCAGAGGTAGGATGG - Intronic
902362798 1:15951290-15951312 GAAAGGAGAGAGAAGAAGGAAGG + Intronic
903382860 1:22909000-22909022 CCTGGGAGACAGAAAGAGGAGGG - Exonic
905715738 1:40148171-40148193 CAAAACAGAAAGAAGGAGGAGGG - Intergenic
905836541 1:41127797-41127819 CACAGGAGAAGGAAGAAGGAAGG - Intronic
905894003 1:41533650-41533672 CAAAGGAGACACAAGCAGGAGGG - Intronic
905913312 1:41668621-41668643 GATGGGGGATAGGAGGAGGAAGG - Intronic
906717472 1:47980793-47980815 TCTAGGAGATAGAATGAGGAGGG - Intronic
907998664 1:59658545-59658567 CATAGGATACAGAGTGAGGAGGG + Intronic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908574504 1:65444666-65444688 CAAAGGAGAGGAAAGGAGGAAGG + Intronic
909216479 1:72897242-72897264 CAAAGTAGATAGTGGGAGGAGGG - Intergenic
909364382 1:74802252-74802274 TATTGGAGAAAGAAGGAGAAAGG - Intergenic
909507750 1:76413130-76413152 CAGAGGAAATAGGAGAAGGAAGG - Intronic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910541086 1:88358052-88358074 CATAGTAGATAAAAGGAAAAAGG + Intergenic
910587739 1:88897875-88897897 CACAGGAGAAAGATGGAGGCTGG - Intergenic
910588555 1:88904325-88904347 CATGGGAGAAAGATGGAGGCTGG - Intergenic
910687152 1:89929081-89929103 CATAGGACAAAGAAGGAAGTGGG + Intronic
911176848 1:94825842-94825864 CAAAGAAGACAGGAGGAGGAAGG + Intronic
912467695 1:109885375-109885397 GACAGGAGATAGAAGGGGGCTGG - Intergenic
912507911 1:110168950-110168972 CAGAGAAGATAGAAAAAGGAAGG - Intronic
912921966 1:113877148-113877170 CATAGGGAACAGTAGGAGGAGGG + Intergenic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914679599 1:149929766-149929788 CAGAGGAGATAGCAGGTCGAGGG + Exonic
914839233 1:151234096-151234118 TATAGGAGATAAAGGGAGGATGG + Intronic
915128953 1:153683975-153683997 CAGAGGAGAAAGAAAGAGAAGGG + Intronic
915516525 1:156415948-156415970 GATAGGAGAGAGAAGGGGAAAGG - Intronic
915685615 1:157629868-157629890 TATTGGAGACAGAAAGAGGAGGG - Intergenic
916247959 1:162707245-162707267 CTTAGGAAAAAGAAGCAGGATGG - Intronic
916336255 1:163673991-163674013 ATCAGGAGTTAGAAGGAGGAGGG + Intergenic
916668173 1:166986400-166986422 CATGGGAGACAGAAGTGGGACGG + Intronic
917041242 1:170808474-170808496 CAGAGGAGAGACAGGGAGGAGGG + Intergenic
917392130 1:174549252-174549274 AAAAGGAGATAGAAGAAGCAGGG + Intronic
917539566 1:175899694-175899716 TAAAGGAGACAGAGGGAGGATGG + Intergenic
917703750 1:177610367-177610389 GATAGGAGATAGGATTAGGAGGG + Intergenic
918149132 1:181783012-181783034 CGGAGGAGACAGAACGAGGAAGG - Intronic
918595481 1:186287968-186287990 GAAAGGAGAGAGAGGGAGGAAGG - Intergenic
918682021 1:187367595-187367617 CAGAGGAGAGAGAGGCAGGAAGG + Intergenic
918711993 1:187742642-187742664 CACAGGAGAAAGATGGAGGCGGG - Intergenic
918831890 1:189408923-189408945 CAAAGGAGATTGATGTAGGAGGG - Intergenic
918887236 1:190210912-190210934 CACAGGAGAAAGATGGAGGCTGG - Intronic
919113933 1:193257558-193257580 CATAGGAGTGAGAAGAAAGATGG + Intergenic
919247806 1:195011634-195011656 AATAGGAGATAGTAGATGGAGGG + Intergenic
919543773 1:198885493-198885515 GACAGGAGATAGAAAGAGGCAGG + Intergenic
920048003 1:203146039-203146061 CAGAGGAGCTGGAAGGAGGAAGG - Intronic
920173041 1:204083453-204083475 GATGGGAGATAGAGAGAGGAAGG - Intronic
920523742 1:206649675-206649697 CATGGGAGAGGAAAGGAGGAGGG - Intronic
922113322 1:222584274-222584296 CATTGGAGGGAAAAGGAGGAAGG - Exonic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923600416 1:235397996-235398018 CAAAGCAGACAGAAGGAGCAAGG - Intronic
923946994 1:238899176-238899198 AATGGGAGAAAGAAGGAGGCTGG + Intergenic
1063421624 10:5916786-5916808 CATAGGAGGTTGAAGGTGGGAGG + Intronic
1063470837 10:6283530-6283552 CATGGGAGAAAGATGGAGGCTGG + Intergenic
1064376346 10:14799966-14799988 TAGAGGAGAAAGAAGGAGGCAGG + Intergenic
1064920016 10:20505777-20505799 CATAGAAATTAAAAGGAGGATGG + Intergenic
1065134666 10:22656081-22656103 CATAGGAGTTGAGAGGAGGATGG - Intronic
1065858621 10:29851310-29851332 GACAGGAGTTAGATGGAGGAAGG + Intergenic
1065942520 10:30577789-30577811 CATGGGAGAAAGATGGAGGCTGG + Intergenic
1067908608 10:50320757-50320779 AAGTGGAGATAGAGGGAGGAAGG - Intronic
1069060626 10:63891072-63891094 CAAAGGGGAAAGAAGGAGGAGGG - Intergenic
1069191978 10:65503761-65503783 CATAGGAGAAAGATGTAGGCTGG + Intergenic
1069642825 10:69967093-69967115 GGCAGGAGATAGAAGGAGGGAGG - Intergenic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069875407 10:71559975-71559997 TATAGGGGAGAGAAGCAGGAGGG - Intronic
1070413921 10:76171475-76171497 CACAGGAGGTAGGAGGAGAAAGG - Intronic
1070873332 10:79777903-79777925 GATAGGAAATTGAAAGAGGAGGG - Intergenic
1071033076 10:81207423-81207445 CATGGGAGAAAGATGGAGGCTGG - Intergenic
1071160687 10:82742109-82742131 CAGACGAGAGAGAGGGAGGAAGG - Intronic
1071377962 10:85029924-85029946 CATAGGAGAAAGATGTAGGCTGG - Intergenic
1071378707 10:85035968-85035990 CATGGGAGAAAGATGTAGGATGG - Intergenic
1071387055 10:85131955-85131977 CATAGGAGAGAGAGGAATGATGG + Intergenic
1071412101 10:85407107-85407129 CAAATGAGAGAGAAGCAGGAGGG - Intergenic
1071640260 10:87300054-87300076 GATAGGAAATTGAAAGAGGAGGG - Intergenic
1071654971 10:87437892-87437914 GATAGGAAATTGAAAGAGGAGGG + Intergenic
1071752472 10:88496062-88496084 CAAAGGGGACAGAAGGAAGAGGG + Intronic
1073614636 10:104981190-104981212 CATGGGAGGTAGAAGGAGTGGGG - Intronic
1073677941 10:105670872-105670894 CAAAGGTGAGACAAGGAGGATGG + Intergenic
1073806629 10:107105617-107105639 CATGGGAGAAAGATGGAGGCCGG + Intronic
1074512432 10:114127954-114127976 CAAAGCAGAGAGGAGGAGGAAGG + Intronic
1074957834 10:118410032-118410054 CATAGGAGATAAAGGCAGGTAGG + Intergenic
1075064359 10:119279482-119279504 GAAAGAAGATGGAAGGAGGAGGG + Intronic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075121248 10:119666489-119666511 GACAGGAGAGAGAGGGAGGAAGG - Intronic
1075225068 10:120621356-120621378 TTTAGGGGATAGAAGGAGAAAGG - Intergenic
1075639769 10:124056342-124056364 CAAAGGAGATTGAAGGAGGTAGG - Intronic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1077465153 11:2730502-2730524 CATAAGAGAAAGAGGGAGGAAGG - Intronic
1077897007 11:6460584-6460606 CATAGGAGAGTGAAGGATGGAGG + Intronic
1078766235 11:14301110-14301132 CATAGGGTATAGAAAGGGGAAGG + Intronic
1079050621 11:17154823-17154845 AATAGCAGATAGAGGAAGGATGG - Intronic
1079187073 11:18247311-18247333 ACTAGGAAATCGAAGGAGGAAGG + Intronic
1079189731 11:18267566-18267588 ACTAGGAAATCGAAGGAGGAAGG - Intronic
1079771928 11:24473577-24473599 TATAGAGGATAGAATGAGGAAGG + Intergenic
1079961674 11:26931930-26931952 TATGGGACATAGAAGAAGGAGGG + Intergenic
1079991106 11:27248175-27248197 GATGGGAGAGAGAAGAAGGAAGG + Intergenic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080742276 11:35077631-35077653 GAGAGGAGATAAAAGGAGGTGGG - Intergenic
1081776014 11:45676412-45676434 CACAGGAGAAAGATGGAGGCCGG - Intergenic
1081896097 11:46588034-46588056 GAAAAGAAATAGAAGGAGGATGG + Intronic
1082043328 11:47705231-47705253 CAAAGAAGATGGAAAGAGGAAGG + Intronic
1082208543 11:49468687-49468709 CATAGGAGAAAGAGGTAGGCTGG - Intergenic
1082215968 11:49569967-49569989 AACAGGAGATAAAATGAGGAAGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083224630 11:61276989-61277011 GATAGGAGACAGAGGAAGGAAGG + Intronic
1083311930 11:61788183-61788205 CAAAGGAGAGAGAAGAAGGGAGG - Exonic
1083526809 11:63374911-63374933 CAAAGCTGATAGAAGGAAGATGG - Intronic
1083602127 11:63955312-63955334 CAGAGGAGAAAGAACGACGAGGG - Exonic
1084495601 11:69501418-69501440 GATAGAAGAGAGAGGGAGGAAGG + Intergenic
1085228374 11:74943116-74943138 CATAGCAGATAGAGGATGGAAGG - Intronic
1086199065 11:84178505-84178527 CACAGGAGATAGGAAAAGGAAGG + Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086541902 11:87922880-87922902 GATGGGAGATGGAAGGGGGAAGG + Intergenic
1086745187 11:90416840-90416862 AATAGGGGAGAAAAGGAGGAAGG - Intergenic
1088422548 11:109665505-109665527 CAAAGGATATAGAAGGAGTGGGG - Intergenic
1088650078 11:111949774-111949796 CAGAGGTGATGGAAGGAGGAAGG - Intronic
1088675502 11:112188613-112188635 CAGAGATGATGGAAGGAGGAAGG - Intronic
1089127473 11:116186844-116186866 CATAGGAGATAGATGGGAGATGG + Intergenic
1089705161 11:120272443-120272465 AATGGGAGGTAGAAGGAGTAGGG + Intronic
1089709322 11:120303509-120303531 GATTGGAGATGAAAGGAGGAGGG + Intronic
1089835228 11:121364658-121364680 CATAGGAGAAAGATGTAGGCTGG + Intergenic
1090212195 11:124929079-124929101 CACAGAAGATAGAAGGGAGAGGG - Intronic
1090442103 11:126732852-126732874 CAAAGGAGATAGCAAGAGGCTGG + Intronic
1090965811 11:131596963-131596985 CACAGGAGAAAGATGGAGGCTGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092443618 12:8532195-8532217 CAGAGGAGAAAGGAGGAAGAAGG + Intergenic
1092740407 12:11623258-11623280 TCTAGGTGATAGAAGGAGGACGG - Intergenic
1093195974 12:16129968-16129990 CAAAGGAGAAACAAGGAAGAAGG + Intergenic
1093272086 12:17076071-17076093 AATAGGAGATAGATGAAGGAGGG + Intergenic
1093671159 12:21877705-21877727 AAAAGGAGAGAGAAGGAGGTGGG + Intronic
1094715326 12:33008210-33008232 AAGAAGAGAAAGAAGGAGGAAGG - Intergenic
1095695481 12:45139013-45139035 CATGAGAGAAAGGAGGAGGAAGG - Intergenic
1095959214 12:47823502-47823524 CATAAGAGATATAAGAAGTACGG + Intronic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1097225174 12:57472818-57472840 CCAAGGAGATACAAGGAGAATGG + Intronic
1097811480 12:64023976-64023998 CAGAGGAGGTGGTAGGAGGAGGG + Intronic
1098394420 12:70003088-70003110 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1098824159 12:75271765-75271787 CATGGGAGAAAGATGGAGGCCGG + Intergenic
1098834372 12:75403675-75403697 CAAAGGTGGTATAAGGAGGAAGG - Intronic
1100049795 12:90434514-90434536 CATAGGAGACAGATGTAGGCTGG - Intergenic
1100449232 12:94689526-94689548 AATAGGAGCTAGAAAGAGAAGGG + Intergenic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101690686 12:107077350-107077372 CATTGGAGATACAAAGATGAAGG - Intronic
1102928555 12:116845134-116845156 CTTGGGAGATTGAAGCAGGAGGG + Intronic
1104325803 12:127796679-127796701 CATAGGAGAAAGATGTAGGGTGG - Intergenic
1104365471 12:128172742-128172764 CATGGGAGAAAGATGGAGGCTGG + Intergenic
1104700331 12:130898243-130898265 CACAGGAGAAAGAAGGAAGCCGG + Intergenic
1105814106 13:24017734-24017756 TAAAGGAGAAAGAAGGAGGAAGG - Intronic
1106140547 13:27007279-27007301 GAGAGGAGATAGGAGGAGGTGGG + Intergenic
1106380951 13:29238560-29238582 CATAGGAGAAAGATGAAGGCTGG + Intronic
1106422740 13:29596665-29596687 CCTATAAGATAGAAGAAGGATGG - Intergenic
1106470696 13:30051727-30051749 TCTAGGAGGAAGAAGGAGGAAGG + Intergenic
1106602424 13:31199725-31199747 CAGAGGAGAAAGGAAGAGGAGGG + Intergenic
1106862910 13:33930426-33930448 CACAGGAGAAAGATGGAGGCTGG + Intronic
1107946303 13:45420012-45420034 GAAAGGAGAAAGAGGGAGGAAGG + Intergenic
1110492710 13:76127594-76127616 CATAGAAGATAGAAAGAAAAGGG - Intergenic
1110948116 13:81450152-81450174 CACAGGAGATAGATGTAGGGTGG - Intergenic
1111182412 13:84686584-84686606 CACAGGAGAAAGAAGGAGGCTGG - Intergenic
1111319993 13:86614678-86614700 CATGGGAGTTAGAAGGTGGAAGG - Intergenic
1111571470 13:90092887-90092909 CACAGGAGAAAGATGGAGGCTGG + Intergenic
1111695264 13:91615310-91615332 CATACTAGTTAGAAGAAGGAGGG + Intronic
1112620637 13:101050715-101050737 CATGGGACATGGAAGGAGGGTGG - Intergenic
1113149987 13:107252481-107252503 GAGAGGAGAAGGAAGGAGGAGGG + Intronic
1113159217 13:107360851-107360873 AATAAGAGAGAGAGGGAGGAGGG - Intronic
1113167236 13:107455461-107455483 CATAGCAGATAGAGGCAGGGTGG - Intronic
1113331846 13:109334905-109334927 CATAGGAGACAGAACGGGGCGGG + Intergenic
1113422519 13:110181600-110181622 GAAAGGAGAGAGAAAGAGGAGGG - Intronic
1113452614 13:110422345-110422367 CATTGGAGATAGAATGAGTCTGG + Intronic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114379883 14:22191274-22191296 CATGGGAGAAAGATGAAGGATGG + Intergenic
1114879035 14:26760965-26760987 CACAGGAGAAAGAAGGGGGGAGG - Intergenic
1115060028 14:29176462-29176484 CATAGGAGAAAGATGTAGGATGG - Intergenic
1116377411 14:44221195-44221217 AATAGTAGAAAGAAGAAGGAAGG + Intergenic
1117834341 14:59786624-59786646 TATAGGATAAAGAGGGAGGATGG + Intronic
1118826329 14:69385890-69385912 CTTAGGAGATTGGAGGAGCAGGG - Intronic
1118880532 14:69822075-69822097 CATAGGAGAAAGATGTAGGCTGG + Intergenic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1119885739 14:78139870-78139892 CCCAGCAGAAAGAAGGAGGAAGG + Intergenic
1120235589 14:81886993-81887015 CATATGAGACAGACAGAGGATGG - Intergenic
1120858020 14:89229767-89229789 AATAAGAGATAAAAGGAGGTAGG + Intronic
1121726179 14:96152125-96152147 CAAAGGAAATAGAAGAAAGAAGG + Intergenic
1121799661 14:96764045-96764067 GGAAGGAGACAGAAGGAGGAAGG + Intergenic
1121926544 14:97932312-97932334 CATAGGAGAAAGATGAAGGCTGG + Intronic
1122617344 14:103028693-103028715 CACAGAATATAGAAGGAGGCAGG - Intronic
1123184593 14:106504836-106504858 CATGGGAGAAAGATGGAGGCTGG - Intergenic
1123695421 15:22875720-22875742 CACAGGAGATGGAAGGAGTAGGG + Intronic
1123963092 15:25427348-25427370 CCTATAAGATAGAAGGAAGATGG + Intronic
1124843024 15:33262526-33262548 CAGAGGAGATAGCAAGAGGCAGG - Intergenic
1125021552 15:34991488-34991510 CATGGGAGACAGTAGGAGGCAGG + Intergenic
1125169168 15:36746277-36746299 AATAGTAGAGAGAAAGAGGAAGG + Intronic
1127568276 15:60214914-60214936 AAAAGGAGAGAGAAGGAGGAAGG + Intergenic
1128148351 15:65345250-65345272 CCTAAGAAATAGAAGGATGATGG + Intronic
1128332187 15:66763149-66763171 ACTAGGAGATGGAAGGTGGAGGG + Intronic
1129194463 15:73955804-73955826 AATGGGAGGTAGAAGGAGGCTGG + Intergenic
1129260514 15:74364816-74364838 CCTAGGAGAGAGGGGGAGGAAGG + Intronic
1129894154 15:79091188-79091210 AATACGAGGTGGAAGGAGGAAGG + Intergenic
1130149503 15:81300338-81300360 CACAGGAGATAGAAGATGGAAGG - Exonic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131101030 15:89690463-89690485 CCTAGTAGATGGAAGCAGGAAGG - Intronic
1131361181 15:91792068-91792090 CAAAGGGGATGGAGGGAGGAGGG - Intergenic
1133680878 16:8118673-8118695 CATGGGAGAAAGATGGAGGCTGG + Intergenic
1135060608 16:19268360-19268382 CACAGGACATAGAAGGTGGGAGG + Intergenic
1135870097 16:26141838-26141860 CATAGGTGGTAGAAGGAGCCTGG - Intergenic
1137244111 16:46688969-46688991 GATAGGGGACAGCAGGAGGAAGG - Intronic
1137372873 16:47924996-47925018 CATAGTAGACAGAAGGCTGAAGG - Intergenic
1137611875 16:49823672-49823694 CAGAGGAGACAGTAAGAGGAAGG + Intronic
1137979265 16:53055692-53055714 CACATGAGAAAGGAGGAGGAGGG - Intronic
1138292793 16:55862126-55862148 TATAGGAGATTGGATGAGGAAGG - Intronic
1138332525 16:56226486-56226508 CATGGAAGATAGAAGCAAGAAGG + Intronic
1138505343 16:57475715-57475737 AGGAGGAGAGAGAAGGAGGAGGG - Intronic
1139391078 16:66606342-66606364 CATAGGAGACAGGAAGGGGAGGG + Intronic
1139948020 16:70654845-70654867 CCCAGGAGATGGCAGGAGGAGGG - Intronic
1140137700 16:72222391-72222413 AATAAGAGATAGAAGGAGGAAGG - Intergenic
1140376116 16:74446665-74446687 TAGAGGAGGAAGAAGGAGGAGGG - Intergenic
1140420053 16:74812151-74812173 GGTAGCAGATAGAAGGAGCAAGG - Intergenic
1140857477 16:78990687-78990709 CATAGAGGAAAGAAGGAAGAAGG + Intronic
1141394388 16:83691744-83691766 GACAGGAGATGGAAGGAGGCAGG - Intronic
1141753520 16:85975692-85975714 TATAGAGGTTAGAAGGAGGAAGG - Intergenic
1141844519 16:86598251-86598273 CACAGGAGAAAGATGGAGGCTGG + Intergenic
1142231661 16:88902971-88902993 CATAGGTGTTAACAGGAGGAGGG - Intronic
1142931088 17:3284551-3284573 CCTAGGAGAGAGAAGGATGGGGG + Intergenic
1142944324 17:3411956-3411978 CCTAGGAGAGAGAAGGATGGGGG - Intergenic
1143706620 17:8702350-8702372 CAAAGAAGAAAGAAAGAGGAAGG - Intergenic
1143964096 17:10743968-10743990 AAAAAGAGAAAGAAGGAGGAAGG - Intergenic
1143986029 17:10915208-10915230 CATAGTCAATAGAAGGAGAAAGG + Intergenic
1144155216 17:12493821-12493843 CACGGGAGAAAGAAGGAGGCCGG - Intergenic
1145270458 17:21401939-21401961 CATAGGAGTTTGAGGGAGAATGG + Intronic
1145308668 17:21689336-21689358 CATAGGAGTTTGAGGGAGAATGG + Intergenic
1145398884 17:22515553-22515575 AAGAGGAGAAAGAAGGAAGAAGG + Intergenic
1145727161 17:27140809-27140831 AAGAGGAGAAAGGAGGAGGAAGG - Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1148134802 17:45285263-45285285 CTCAGGAGCTAGAAGGTGGAGGG + Intronic
1148193300 17:45695207-45695229 TAAAGGAGTCAGAAGGAGGAGGG + Intergenic
1150736826 17:67747799-67747821 CATAGCTGAAGGAAGGAGGAGGG + Intergenic
1151345736 17:73500251-73500273 TGGAGGAGATGGAAGGAGGATGG - Intronic
1151345743 17:73500281-73500303 TGGAGGAGATGGAAGGAGGATGG - Intronic
1151345819 17:73500594-73500616 TGGAGGAGATAGAAGGAGGATGG - Intronic
1151429424 17:74052473-74052495 TTTAGGAGATGGAAGGAGGGAGG + Intergenic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1151941779 17:77297003-77297025 GATAGAAGATAGATGGTGGATGG + Intronic
1151965442 17:77428809-77428831 CAAAGGAGCTGGAAGGAGGGAGG + Intronic
1152092747 17:78256205-78256227 CATAGGAGAAAGATCCAGGAGGG + Intergenic
1153847807 18:9065522-9065544 AATAGAAGACAAAAGGAGGAAGG - Intergenic
1153919475 18:9775570-9775592 CTTAGGAGGTAGCATGAGGAAGG - Intronic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1156446255 18:37239314-37239336 CAGAGGAGATGGAAGGATTAGGG - Intergenic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156573306 18:38282942-38282964 CATAGGAGAAAGATGGAGGCTGG - Intergenic
1156896566 18:42253497-42253519 CACAGGAGAAAGATGGAGGCTGG + Intergenic
1157249256 18:46080030-46080052 CCTAGGAGTAAGGAGGAGGAGGG - Intergenic
1157960749 18:52151015-52151037 AATAGGGGAGAGAGGGAGGAGGG - Intergenic
1158327793 18:56329195-56329217 AAAGGGAGATAGAAGGAGGTGGG - Intergenic
1158399397 18:57107681-57107703 AATAGGAGATAGTAGCAGCAAGG + Intergenic
1159058749 18:63492732-63492754 CAGAGGAGAATGAAGGAGCAGGG - Intronic
1159693523 18:71522892-71522914 CACAGGAGATAGATGTAGGCTGG - Intergenic
1161414749 19:4139716-4139738 CAAGGGGGAGAGAAGGAGGAGGG + Intergenic
1162062721 19:8106764-8106786 GATGGGAGATAGAAGATGGATGG + Intronic
1162424775 19:10588005-10588027 CAGAGGAGAAAGAAGGTGAATGG - Intergenic
1162459955 19:10808951-10808973 CATAGGAGATAGAAGGAGGAGGG - Intronic
1162783122 19:13017507-13017529 CACAGGAGAGACAAGGAGCAAGG - Intronic
1163332905 19:16652660-16652682 CATAGGAGATCTGGGGAGGATGG - Intronic
1163387269 19:17007562-17007584 GGCAGGAGACAGAAGGAGGAAGG + Intronic
1163637721 19:18445163-18445185 CATGGGAGCTGGAGGGAGGAGGG - Intronic
1164521316 19:28982268-28982290 CGGAGGAGATGGGAGGAGGATGG + Intergenic
1166274922 19:41746681-41746703 CACAGGAGAAAGAAGGAAAATGG + Intronic
1166382787 19:42363358-42363380 CCAGGGAGATGGAAGGAGGAGGG - Intronic
1166876727 19:45902152-45902174 GATAGGAAATGGAGGGAGGATGG + Intronic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1168446306 19:56417903-56417925 GATAGGTGATAGAATTAGGAAGG - Intronic
925245912 2:2382780-2382802 CACAGGAGAAAGATGGAGGCTGG - Intergenic
925280288 2:2679448-2679470 CACAGGAGAAAGATGGAGGCTGG - Intergenic
925498819 2:4482126-4482148 CATGGGAGAAAGATGGAGGCTGG - Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925758523 2:7159586-7159608 AATAAGAAATAGATGGAGGATGG - Intergenic
925806656 2:7657771-7657793 CATAGGAGAAAGATGGAGGCTGG - Intergenic
925853004 2:8101808-8101830 CATAGTAGACAGAATGAGCATGG + Intergenic
925900222 2:8503971-8503993 CACAGGAGAAAGATGGAGGCTGG - Intergenic
925910415 2:8570005-8570027 GTTAGGAGAGAGGAGGAGGAGGG + Intergenic
925924536 2:8660521-8660543 TATCTGGGATAGAAGGAGGAGGG + Intergenic
926578222 2:14606382-14606404 CACAGGAGAAAGATGGAGGCTGG - Intergenic
927061458 2:19426488-19426510 CATGGGAGATAGATGAAAGACGG - Intergenic
927243949 2:20942018-20942040 CATAGGAGCTAGCACAAGGAAGG - Intergenic
927840404 2:26438296-26438318 CATAGGAGAAAGAAGCTGCAAGG - Intronic
928164191 2:28957760-28957782 CATAGGATAGGGAAGGAGTAGGG + Intronic
929270403 2:39965258-39965280 CATGGGAGAAAGATGGAGGCTGG + Intergenic
929743706 2:44632815-44632837 CATAGGAGAAAGATGTAGGCTGG - Intronic
929823520 2:45292115-45292137 CATAGGAGAAAGATGTAGGCTGG - Intergenic
930225685 2:48790198-48790220 CACAGCAGATGGAAGAAGGAAGG + Intergenic
930909717 2:56617133-56617155 CATAGGAGAAAGATGTAGGCTGG - Intergenic
931077693 2:58734988-58735010 GAGAGGAGAGAGAAGGAGGGAGG - Intergenic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931341216 2:61402386-61402408 AATAGGAAAGAGAAGAAGGAAGG + Intronic
932606523 2:73169398-73169420 GAGAGGAGATAGGAGGCGGAAGG + Intergenic
932683121 2:73844374-73844396 CATAAGAGCTAGAAGGAGTAAGG + Intronic
932859080 2:75269793-75269815 CATGGGAGAAAGATGTAGGATGG + Intergenic
933925903 2:87091037-87091059 GAGAGGAGATAGGAGGTGGAAGG - Intergenic
934535341 2:95128704-95128726 AGAAGGAGAAAGAAGGAGGAGGG + Intronic
934982281 2:98852931-98852953 AAAAGGAGAGAGAAGAAGGAAGG + Intronic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
935277025 2:101483936-101483958 CATAAGGGACAGAAGGTGGAAGG - Intergenic
935338906 2:102042373-102042395 GAAAGGAGAGGGAAGGAGGAAGG + Intergenic
935370625 2:102342878-102342900 GAGAGGACATAGAAAGAGGAAGG + Intronic
935431491 2:102980656-102980678 ATTTGGAGATAAAAGGAGGATGG - Intergenic
935892369 2:107692676-107692698 CAAAGGAGATAGAAGGATCAAGG - Intergenic
936731666 2:115388502-115388524 CAGTGGAGATAGAAGAGGGATGG + Intronic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937211548 2:120275851-120275873 AATAGGAGAAAGAAAGAGAACGG + Intronic
937284759 2:120743293-120743315 CAAAGGACAAAGAAGCAGGAAGG - Intronic
937414239 2:121701700-121701722 CTTAGAAGTTAGAAGGAAGATGG - Intergenic
937814046 2:126231616-126231638 AGGAGGAGATGGAAGGAGGAAGG - Intergenic
938886442 2:135654157-135654179 CATAGGAGACAGAAGCAGATTGG - Intronic
939089699 2:137765216-137765238 CCTAGGAGAAAGAAGGAAGATGG - Intergenic
939298184 2:140297164-140297186 CATAGGAGAAAGAAGCTGGGGGG + Intronic
939361423 2:141177177-141177199 CATAGGAGTCACAAGAAGGAAGG + Intronic
939579196 2:143928277-143928299 GAAAGGAGAGAGAAGGAGGGAGG + Intergenic
939629322 2:144515092-144515114 CGAAGGAGGTGGAAGGAGGAAGG + Intronic
940078971 2:149778445-149778467 CATATGAGATATATGGGGGAGGG + Intergenic
940985778 2:160050769-160050791 CATAGGAGATATAAGCAAAAGGG + Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941117529 2:161488806-161488828 CATGGGAGCTGGATGGAGGATGG + Intronic
942627948 2:177923474-177923496 CAGCTGAGATAAAAGGAGGATGG - Intronic
943383754 2:187178505-187178527 CATAGGGGAGAGATGGAGGCTGG + Intergenic
943509047 2:188801823-188801845 CATGGGAGAAAGATGGAGGCTGG - Intergenic
943509354 2:188804592-188804614 CAAAGGAGAAAGATGGAGGCTGG - Intergenic
944301509 2:198129738-198129760 GCGAGGAGATAGAAAGAGGAAGG - Intronic
944508463 2:200440214-200440236 CAAATGAGATAGAGAGAGGATGG - Intronic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
945489183 2:210434775-210434797 CATAGGATGCCGAAGGAGGAGGG - Intronic
945725520 2:213468903-213468925 CATAGGAGAAAGATGTAGGCTGG + Intronic
946023830 2:216659975-216659997 CAAAGGAGTGAGAAGGTGGAAGG - Intronic
947225435 2:227835427-227835449 CATACCATATAGAAAGAGGAAGG - Intergenic
947654678 2:231816873-231816895 CAGAGGAGATGGAAAAAGGATGG - Intergenic
948113600 2:235477038-235477060 CCCAGGAGATGGACGGAGGATGG + Intergenic
948169157 2:235887386-235887408 CAGAGGAGAGAAAAGGAGGCAGG - Intronic
948672650 2:239578354-239578376 AATACGGGAGAGAAGGAGGAGGG - Exonic
948860553 2:240750728-240750750 CACAGGAGACAGGAGGTGGAGGG + Intronic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170057277 20:12220352-12220374 CCTAGGAGGTAGAAAGAGGTGGG + Intergenic
1170414171 20:16122372-16122394 CTTAGGAAATAGAGGCAGGAGGG - Intergenic
1171415718 20:24979306-24979328 CAGAGAAGATGGAAGGAGCAAGG + Intronic
1175229589 20:57465339-57465361 CATAGGAGAGATAAGGAGCCAGG - Intergenic
1175287350 20:57845753-57845775 CTTAGAAGAGAAAAGGAGGAGGG + Intergenic
1177244249 21:18502219-18502241 CAGAGGAGATAGAGGGATGGAGG + Intergenic
1177677273 21:24316893-24316915 CATAGGAGAAAAAAGGAAGAAGG + Intergenic
1177777713 21:25587757-25587779 CGTAGTAAATAGAAGGAGAATGG + Exonic
1178220556 21:30653125-30653147 CATTGGAGAAAGAAGGGAGAAGG + Intergenic
1178370685 21:32024816-32024838 CACAGGAGAAAGATGGAGGCTGG + Intronic
1178444235 21:32623973-32623995 GATAGTGGATAGAAGGGGGATGG + Intergenic
1178781787 21:35610386-35610408 CATAGGTGAAAGGAGGAGGAAGG - Intronic
1179084021 21:38201388-38201410 CACAGGAGAAAGATGGAGGCTGG - Intronic
1179713351 21:43275409-43275431 CAGAGCAGATGGAGGGAGGAGGG - Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181507452 22:23369495-23369517 TATAGGAGATTGGATGAGGAAGG - Intergenic
1182059689 22:27388136-27388158 CATAAGAGAAAGAAGGAGAAAGG + Intergenic
1182540625 22:31039209-31039231 CTTACGGGATGGAAGGAGGAGGG - Intergenic
1184401682 22:44278209-44278231 CACAGGAGAAAGATGGAGGCTGG - Intronic
949169704 3:984008-984030 CATAGGAGAAAGATGAAGGCTGG + Intergenic
949195188 3:1296904-1296926 TAGAGGGGATAGAAGAAGGAAGG - Intronic
949337419 3:2991214-2991236 AATAGGTGAGAGAACGAGGAGGG + Intronic
950313955 3:11984000-11984022 CATAGCAGAGAGATGGAGAAAGG + Intergenic
950342861 3:12263016-12263038 CAGAGGAGAGAGAAGGACAAAGG + Intergenic
950405246 3:12800203-12800225 GCTAGGAGAGAGAAGGAGGCTGG - Intronic
950826948 3:15833310-15833332 CACAGGAGAAAGATGTAGGATGG - Intronic
951126526 3:18991005-18991027 CCTAAGAGAATGAAGGAGGAAGG - Intergenic
951760984 3:26147206-26147228 AATAGGAGCGAAAAGGAGGAAGG - Intergenic
952258886 3:31720334-31720356 CTTGGGAGATACAGGGAGGAAGG + Intronic
952559486 3:34573970-34573992 GAAAGAAGAAAGAAGGAGGAAGG - Intergenic
953295349 3:41710339-41710361 CATTGGAGATTCAAGGAGAAAGG + Intronic
953475416 3:43201891-43201913 CCTAGGAGATAGAAGACAGATGG - Intergenic
953845983 3:46426790-46426812 CAAAAGAGATAGCAGGAAGAGGG - Intergenic
954747477 3:52795297-52795319 AATGGGAGATAGAATGAGGTGGG + Intronic
955671810 3:61410274-61410296 AAAAGGAGAAAGAAGGAGGGAGG + Intergenic
955723826 3:61911108-61911130 CATAGGAGAGAGGAGTATGAAGG - Intronic
955774482 3:62418764-62418786 CAAAAGAGATAGAGGGGGGAAGG - Intronic
955902298 3:63770056-63770078 CCTAGGAGGTAGAAGGGGCAAGG - Intergenic
956168809 3:66416754-66416776 CAGAGGAGATTCAGGGAGGATGG - Intronic
956631487 3:71320990-71321012 CAAAGGAAATAGAATGAGCAAGG + Intronic
956647925 3:71475139-71475161 CATTGGAAATAGAAGCAGGGGGG - Intronic
957847123 3:85752442-85752464 CATATGAGACATAAGGAGAAGGG - Intronic
959456839 3:106573187-106573209 CATGGGAGAAAGATGTAGGATGG + Intergenic
959663971 3:108901206-108901228 GCTAGGAGATAGAATGTGGATGG + Intergenic
960267830 3:115640974-115640996 AATAGAAGAAAGAAGAAGGAAGG - Intronic
961014513 3:123457290-123457312 CCTGGGAGCTAGAAGGAGGAGGG + Intergenic
961551007 3:127670739-127670761 CTTAGCAGAGAGAAGCAGGAGGG - Intronic
962376396 3:134862124-134862146 CATAGGTGAGGGAAGGGGGATGG + Intronic
962505246 3:136040113-136040135 CAAAGGAGAGAGAAGGAGATAGG + Intronic
962739988 3:138356627-138356649 CAGAGATGATAGAAGGAGGGTGG + Intronic
963339043 3:144012210-144012232 CAGAGGAGATAGAAGGGAAAAGG + Intronic
965261013 3:166485194-166485216 CAAAGAAGATAGAAGGATAAGGG - Intergenic
965291439 3:166886992-166887014 CATGGGAGAAAGATGGAGGCTGG + Intergenic
965614991 3:170585067-170585089 CACAGGAGAGAGAAGGAGGGTGG + Intronic
967746474 3:193061374-193061396 TGGAGGAGATAGGAGGAGGAGGG - Intergenic
967840037 3:193997831-193997853 CTTAGGAGATGGAAGGAGCTTGG - Intergenic
967853689 3:194100761-194100783 AAAAGGAGAGAGAGGGAGGAAGG + Intergenic
968476429 4:811770-811792 CAAAGGACAGAGAAGCAGGAAGG - Intronic
969450645 4:7271147-7271169 CAGAGGAGATAGAAGCAGCAGGG - Intronic
969637347 4:8377008-8377030 CATGGAAGGTGGAAGGAGGAAGG - Intronic
970172595 4:13304642-13304664 AATAGTAGAGAGAAAGAGGAAGG - Intergenic
971051464 4:22867259-22867281 CACAGGAGAAAGATGGAGGCCGG - Intergenic
971153789 4:24061431-24061453 CAAAGGAAGTAGAAGCAGGATGG - Intergenic
971189139 4:24410728-24410750 CACAGGAGAAAGATGGAGGCTGG - Intergenic
971417809 4:26449602-26449624 CATTGGAGACAGAAGCAGGGAGG + Intergenic
971637408 4:29079270-29079292 CATTGGAGACAGAATGAGTATGG + Intergenic
971727548 4:30333142-30333164 CATGGGAGAAAGATGCAGGATGG - Intergenic
972554890 4:40171874-40171896 CACAGGAGAAAGATGGAGGCCGG + Intergenic
972574930 4:40342987-40343009 CATTGGAGATGGAACGAGGAAGG + Intronic
972891962 4:43568222-43568244 CATAGGAGAAAGAGGAAGGTCGG + Intergenic
972919875 4:43925455-43925477 CATGGGAGAAAGATGGAGGCTGG - Intergenic
973286076 4:48418114-48418136 GGAAGGAGAAAGAAGGAGGAAGG - Intronic
973286079 4:48418131-48418153 GGAAGGAGAAAGAAGGAGGAAGG - Intronic
973669365 4:53199908-53199930 CATGGCAGAGAGAAGGAGGGAGG + Intronic
973692868 4:53456747-53456769 AAAAGGGGATGGAAGGAGGAGGG + Intronic
973926167 4:55740078-55740100 CTTTGGATATAGTAGGAGGAGGG + Intergenic
974845794 4:67350224-67350246 AAAAAGAGAAAGAAGGAGGATGG + Intergenic
976713169 4:88094921-88094943 AATTGGGGAGAGAAGGAGGAAGG - Intronic
976909268 4:90280376-90280398 AACAGGAGATGGAAGGAGGGAGG - Intronic
977099376 4:92790757-92790779 CATAGGATTTAGGAGGAGAAAGG - Intronic
977242246 4:94586920-94586942 CATAAGAAATAGAAGGAAAAAGG - Intronic
978872307 4:113594125-113594147 AACAAGAGAGAGAAGGAGGAAGG + Intronic
979363203 4:119788876-119788898 CATAAGAGAGAGAAAAAGGAGGG + Intergenic
979363799 4:119796262-119796284 CTTAAGAGAGAGTAGGAGGAAGG + Intergenic
979545602 4:121936707-121936729 CATAGGAGGTAGCAGGGTGAGGG - Intronic
979771057 4:124525400-124525422 CATGGGAGCTAGAAGGGGGATGG - Intergenic
979977649 4:127216938-127216960 CATAGGAGACAGAAAGAAAATGG - Intergenic
979999426 4:127470823-127470845 CATAGGTGATAAAAAGTGGAGGG - Intergenic
981272781 4:142864073-142864095 CATAAGAGACAGAAGGTAGAAGG - Intergenic
981280938 4:142957799-142957821 CAGAGGAGATGGAGGGCGGATGG - Intergenic
982194708 4:152899300-152899322 CATAGGGAATAGAAAGAGGAGGG - Intronic
982348158 4:154384666-154384688 CACAAGAGATAGACAGAGGAAGG + Intronic
982904506 4:161050502-161050524 CATGGGAGAAAGATGAAGGACGG + Intergenic
983658713 4:170110101-170110123 AATAGGAAAGAGTAGGAGGAAGG + Intergenic
983671408 4:170241850-170241872 CCAAGGAAATAGAAGGAGGCTGG - Intergenic
984059964 4:174979452-174979474 CATAGGAGAAAGATGTAGGCTGG + Intergenic
984182874 4:176506968-176506990 CAAAGGAGAGAGAGAGAGGAAGG - Intergenic
984403664 4:179299674-179299696 CACAGGAGAGAGATGTAGGATGG + Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
986816593 5:11419185-11419207 CATTGGAGATAAAAGAGGGAGGG - Intronic
986854385 5:11851990-11852012 AACAGGAGATAGAAGGTGAAGGG - Intronic
986955965 5:13149680-13149702 CATAGGAGAAAGATGTAGGCTGG + Intergenic
986986488 5:13506325-13506347 CAGAGGAGAGAGAATCAGGAGGG + Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988189094 5:27903821-27903843 CATAGGAGAAAGATGTAGGCTGG - Intergenic
988960231 5:36363522-36363544 CATCCCAGATTGAAGGAGGAGGG + Intergenic
989138834 5:38182141-38182163 CCCAAGAGAAAGAAGGAGGATGG - Intergenic
989214277 5:38888062-38888084 CATGCGAGACAGACGGAGGAGGG + Intronic
990144669 5:52745479-52745501 CATGGGAGATAGATGTAGGCTGG + Intergenic
991506508 5:67329510-67329532 GATAGGGGATAGAGGGAGAAAGG - Intergenic
991581624 5:68161500-68161522 CACAGGAGAAAAAAGGAAGATGG + Intergenic
991615165 5:68489461-68489483 AGGAGGAGATAGAAGGAGGAAGG + Intergenic
992047456 5:72908529-72908551 CATAGGAGAAGGAAGCAGCATGG + Intronic
992258583 5:74947434-74947456 CGTAGGAGAGAGAGGGAAGAAGG - Intergenic
992457908 5:76933137-76933159 CAAAGGAGAGAGAAAGAGGAAGG + Intergenic
992826055 5:80551084-80551106 AATAGGAGCTACAAGGAGCATGG - Intergenic
993425908 5:87764064-87764086 TTTAGGAGATAGCAGAAGGAAGG - Intergenic
993592197 5:89808050-89808072 CATGAGACATAGAGGGAGGAGGG - Intergenic
994291819 5:98035480-98035502 CACAGGAGATAGATGTAGGCTGG + Intergenic
994831727 5:104792234-104792256 CATAGGAGAAAGAAGGAGGGGGG + Intergenic
995154809 5:108898491-108898513 GAAAGGAGAGAGAAAGAGGAAGG - Intronic
996438731 5:123465086-123465108 CAAAAAAGATAGAAGGAGGATGG + Intergenic
997183262 5:131855522-131855544 CAAAAGAGAGAGAGGGAGGAAGG + Intronic
997880801 5:137587734-137587756 TACAGGAGACAGAAGAAGGAAGG - Intronic
998429950 5:142062213-142062235 CATAGTAGGTAGTAGGGGGAAGG + Intergenic
999477342 5:151912664-151912686 CAGAGCCAATAGAAGGAGGATGG + Intronic
1000731399 5:164838651-164838673 AATAGGAAAGAAAAGGAGGAAGG - Intergenic
1000876604 5:166646889-166646911 CATAGGAGAAAGCAGAAGGCAGG - Intergenic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1002905903 6:1449070-1449092 CAAAGGAGACAGCAGAAGGATGG - Intergenic
1003047405 6:2746376-2746398 CATAGAGGAAAGAAGGAAGATGG + Intronic
1003375813 6:5576379-5576401 CATGGGAGATAGATGTAGGCTGG - Intronic
1003491943 6:6630438-6630460 CAGAGGAGACAGAAGGACCAAGG - Intronic
1004833819 6:19507852-19507874 CACAGGAGAAAGATGGAGGCTGG + Intergenic
1005205378 6:23397119-23397141 CATTGGAGACAAAATGAGGAGGG - Intergenic
1006073013 6:31510323-31510345 TATAGGAGATAGCAAGAAGAGGG - Exonic
1007322833 6:41039543-41039565 AATAGCAGATAGGAGGAGGAGGG + Intronic
1007623935 6:43231875-43231897 GAAAGAAGAAAGAAGGAGGAAGG - Intergenic
1007941378 6:45784834-45784856 GATAGGAGAAAGAAGGAGGAAGG - Intergenic
1008044197 6:46835146-46835168 GATGGGAGATAGAAGCAGGCTGG + Intronic
1008300444 6:49831487-49831509 CAGAGGACGTAGATGGAGGAGGG + Intergenic
1010497053 6:76546819-76546841 CATAGGAGAAAGATGTAGGCTGG - Intergenic
1010527271 6:76917414-76917436 CATAGTAGATATAAAGATGAAGG + Intergenic
1012366389 6:98445753-98445775 CACAGGAGAAAGATGGAGGCTGG - Intergenic
1012431600 6:99169984-99170006 CAGAGTAGATAGAATAAGGAGGG - Intergenic
1012811079 6:103959059-103959081 CACAGCAGAGAGAAAGAGGAAGG + Intergenic
1013812498 6:114060762-114060784 GGTAGAAGATAGAAAGAGGAAGG - Intronic
1014294914 6:119606219-119606241 CATGGGACAGAGAAGTAGGAGGG - Intergenic
1015170388 6:130245901-130245923 CATAGGAGAAGGTAGGAGGATGG + Intronic
1015547470 6:134376196-134376218 CATAGCATAGAGAAGGAGCATGG - Intergenic
1015577806 6:134691180-134691202 AAGAGGAGAAAGAAGGAGGGAGG + Intergenic
1016597442 6:145817168-145817190 CATAGGAGAAAGATGTAGGCTGG + Intergenic
1016685089 6:146871728-146871750 GGTAGGTGATAGAAGGAGAAGGG - Intergenic
1017624783 6:156337514-156337536 AACAGGAGCTAGAATGAGGAAGG - Intergenic
1018758346 6:166868848-166868870 CACAGGAGAAAGATGGAGGCTGG - Intronic
1019313419 7:373810-373832 CCTAAGAGATAAAAGGGGGAAGG - Intergenic
1019428307 7:987547-987569 CAGAGGAGATGGAAGGGGCAAGG - Intronic
1019546586 7:1580238-1580260 CATGGGAGACAGAAGGAGACAGG - Intergenic
1019815619 7:3197734-3197756 GATAGGAAATGAAAGGAGGAAGG - Intergenic
1020620550 7:10513671-10513693 TATAGGAGTTAAAAAGAGGAGGG - Intergenic
1020918338 7:14227582-14227604 CACAGAAAATAGAAGAAGGAAGG + Intronic
1021313246 7:19117433-19117455 CGGAGGAGAGAGCAGGAGGACGG + Exonic
1021942442 7:25691130-25691152 CACAGGAGAAAGATGGAGGCTGG + Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022389809 7:29933708-29933730 CCTAGCACATAGTAGGAGGAGGG + Intronic
1023198952 7:37672790-37672812 CATGGGAGAAAGATGGAGGCTGG - Intergenic
1023576850 7:41636931-41636953 CACAGGAGAAAGATGGAGGCTGG + Intergenic
1023942537 7:44779083-44779105 CATGGGAGAAAGATGAAGGAGGG + Intergenic
1024017347 7:45329159-45329181 CATAGGAGGAAGGAGAAGGAAGG + Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024310101 7:47961382-47961404 CATAGGAGATAGTAGAATGGTGG + Intronic
1024471360 7:49771011-49771033 AAAAGGAGAGAGACGGAGGAGGG + Intergenic
1024515661 7:50252670-50252692 AACAGAAGATAGAAGGAAGAGGG - Intergenic
1026080158 7:67210850-67210872 GATAGATGATAGAAGGTGGATGG - Intronic
1026242617 7:68590097-68590119 CACAGGAGAAAGACTGAGGACGG + Intergenic
1026927360 7:74203916-74203938 AAAAAGAGATAGAAGAAGGAAGG + Intronic
1027121406 7:75524844-75524866 CAGAGGAGAAGGAAGAAGGAGGG - Intergenic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1029368611 7:100132906-100132928 CAGAGGAGATAGGAGGGGAAAGG - Intergenic
1030583093 7:111384289-111384311 GAGAGGAGAAAGGAGGAGGAGGG + Intronic
1030713513 7:112782452-112782474 GAAAGGAGCTAGCAGGAGGAGGG + Intronic
1030883815 7:114914895-114914917 AGTAGGAGAGAGAAGAAGGATGG + Intergenic
1030960066 7:115907961-115907983 CACAGGAGAATGAAGGAGAAAGG + Intergenic
1031386365 7:121156679-121156701 CAGAAATGATAGAAGGAGGATGG + Intronic
1031558891 7:123212311-123212333 CATAGGAGAAAGATGTAGGCTGG - Intergenic
1031923508 7:127618174-127618196 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1032375190 7:131407851-131407873 AATAGGAGTTAAGAGGAGGAAGG - Intronic
1034136984 7:148779950-148779972 CATAGGAGAAAGATGTAGGCTGG - Intronic
1034194655 7:149237173-149237195 CATGGGAGAAAGAAGTAGGCTGG - Intergenic
1034708409 7:153169251-153169273 CATAGGAGAAAGATGTAGGATGG - Intergenic
1034732552 7:153400553-153400575 TAGAGGGGAGAGAAGGAGGAAGG + Intergenic
1034744032 7:153505324-153505346 CATGGGAGAAAGATGGAGGCTGG - Intergenic
1034865600 7:154638814-154638836 AATAGGGGAGGGAAGGAGGAGGG - Intronic
1035778285 8:2207421-2207443 CACAGGAGAAAGACGGAGGCTGG - Intergenic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036200773 8:6769849-6769871 CCCTGGAGATAGAAGAAGGATGG - Intergenic
1036291029 8:7490765-7490787 AATGGGAGATTGAAGAAGGAAGG + Intergenic
1036330461 8:7820771-7820793 AATGGGAGATTGAAGAAGGAAGG - Intergenic
1036673328 8:10807807-10807829 CAGAGGAGCTAAAAGGAGCAAGG + Intronic
1037083294 8:14814356-14814378 GAGAGGAGGTAGAAGAAGGAAGG + Intronic
1037485041 8:19339161-19339183 CACAGGAGAAAGATGGAGGGTGG + Intronic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1037621854 8:20570897-20570919 CATAGGAGAAAGATGTAGGCTGG - Intergenic
1037675407 8:21046627-21046649 CACAGGAGAAAGATGGAGGCCGG + Intergenic
1038694598 8:29795148-29795170 TAGAGGAGGAAGAAGGAGGATGG - Intergenic
1039249917 8:35651336-35651358 CATAAAAGATAAAAGGATGAAGG + Intronic
1040646375 8:49401821-49401843 CATAGGAGAAAGGAGGGGCAAGG + Intergenic
1040982689 8:53260466-53260488 TATATGAGATAGGAGTAGGATGG - Intergenic
1041512401 8:58666434-58666456 CTGAGGAGAAATAAGGAGGAAGG + Intergenic
1043284181 8:78509183-78509205 AAAAGGGGTTAGAAGGAGGAGGG - Intergenic
1044531221 8:93309936-93309958 CATGGGAGAAGGAAGGAGGCAGG - Intergenic
1045791867 8:105993031-105993053 GAGAGGAGAAAGCAGGAGGAAGG - Intergenic
1046400285 8:113696567-113696589 CATGGGAGAAAGATGTAGGATGG - Intergenic
1047009687 8:120658288-120658310 AAGAGGAGATAGAAGCTGGATGG + Intronic
1047042175 8:121008144-121008166 CTTAGAAGTTAGAAGGAAGATGG + Intergenic
1047169415 8:122476653-122476675 AATAGAAGATAGAAGGAGGTGGG - Intergenic
1047415817 8:124663661-124663683 CAGAGGAGGTGGGAGGAGGATGG - Intronic
1047456305 8:125016199-125016221 AAAAGGAGATAGAAAGATGAGGG - Intronic
1048151668 8:131900901-131900923 CAGAGGGGATAGAAAGGGGAAGG + Intergenic
1048176050 8:132153804-132153826 ACTCAGAGATAGAAGGAGGAAGG + Intronic
1048199401 8:132359365-132359387 CCTATGAGAGAGAAGGAGCAAGG - Intronic
1048337263 8:133512320-133512342 CACAGGAGAAAGATGGAGGCCGG + Intronic
1048634817 8:136284455-136284477 CATACGAGAAAGACGGAGGCTGG + Intergenic
1048663413 8:136633229-136633251 CATAGGAGAAAGATGAAGGCCGG - Intergenic
1048846751 8:138609676-138609698 GATTAGAGAAAGAAGGAGGAGGG - Intronic
1048895117 8:138985262-138985284 CATAGGAGAAAGATGAAGGCTGG - Intergenic
1049274739 8:141714527-141714549 TATAGGAGGTAGAAGGAAGATGG + Intergenic
1050222532 9:3409956-3409978 AATAGGAGAAGAAAGGAGGAAGG + Intronic
1050241254 9:3638008-3638030 TATAAGTGAAAGAAGGAGGAGGG - Intergenic
1050630947 9:7558062-7558084 CATATGAGAAAGAATTAGGATGG + Intergenic
1050929736 9:11308165-11308187 CAGAGGAGGAAGAAGGAGAAAGG - Intergenic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1051708071 9:19901476-19901498 CAAAGGAGGTCAAAGGAGGAGGG + Intergenic
1051893481 9:21966015-21966037 CACAGGAGATATATGGAGGCAGG + Intronic
1052484064 9:29072977-29072999 CATGGGAGATAGGAGGAGAGAGG - Intergenic
1052809810 9:33047511-33047533 CATAGGAGAAAGATGGAGGAGGG + Intronic
1053003343 9:34589786-34589808 CATGGGCGAGAGAAGGAGGGAGG - Intronic
1053049321 9:34945669-34945691 TACAGGAGACAGAGGGAGGAAGG - Intergenic
1053942584 9:43267618-43267640 CATGGGAGATAGATGTAGGCTGG - Intergenic
1054851221 9:69848636-69848658 CCAAGGAGATAGAGGGAGGTGGG + Intronic
1055528566 9:77159862-77159884 CACAGGAGAAAGATGGAGGCTGG + Intergenic
1057194797 9:93110951-93110973 CATGAGAGAGAGACGGAGGAAGG - Intronic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057706887 9:97401056-97401078 CATAGGAGAAAGATGCAGGCTGG + Intergenic
1057832306 9:98416815-98416837 AATAGGTGATGGGAGGAGGAAGG - Intronic
1057895085 9:98902944-98902966 CATAGAAGATAGAAGAAAGAAGG - Intergenic
1058386698 9:104444809-104444831 CATAGGAGAGAGATGGAGGCTGG - Intergenic
1059690992 9:116686449-116686471 CAAAGGAGTTTGAAGTAGGATGG - Intronic
1060518617 9:124281283-124281305 CATAGGAGAATGGAGGAGGCCGG + Intronic
1060555781 9:124506620-124506642 GATTGGAGATAGAGGGAGAAGGG - Intronic
1060741729 9:126103201-126103223 CAGAGGAGAGAGCAGGTGGAAGG - Intergenic
1060877001 9:127090698-127090720 CATAGGAAATGGAGGCAGGAGGG + Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061185820 9:129052597-129052619 CAGCGGAGGTAGAAGGAGGAGGG + Intronic
1061244636 9:129395121-129395143 GATAAAAGATAGATGGAGGATGG + Intergenic
1061763078 9:132863849-132863871 CATAGGAGAGGGAAGGACCAGGG - Intronic
1061982060 9:134111349-134111371 CACAGGAGAAAGATGGAGGCCGG - Intergenic
1062245941 9:135566093-135566115 TATAGGAGGAGGAAGGAGGATGG + Intronic
1062469757 9:136697107-136697129 GATAGGAGGGGGAAGGAGGAGGG - Intergenic
1185545940 X:944309-944331 CATGGGAGAAAGATGGAGGCTGG - Intergenic
1185558394 X:1039416-1039438 TATAGGAGATAGACAGTGGAAGG + Intergenic
1185564067 X:1082664-1082686 CACAGGAGAAAGATGGAGGCTGG + Intergenic
1185622507 X:1461264-1461286 CATGGGAGAAAGATGGAGGCTGG - Intergenic
1185837632 X:3360210-3360232 CGTAGAAGAGGGAAGGAGGAGGG - Intergenic
1185966470 X:4610683-4610705 GAAAGGAAAAAGAAGGAGGAAGG + Intergenic
1186844201 X:13514960-13514982 CATTGAAGATTGAAGTAGGAAGG - Intergenic
1186953969 X:14659681-14659703 CCTGGGAGAAAGAAGGAGAAAGG + Intronic
1187339130 X:18405717-18405739 CACAGGAGAAAGATGGAGGCCGG + Intergenic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1189382916 X:40514464-40514486 CTTAGAAGAGAAAAGGAGGAAGG + Intergenic
1189512204 X:41674071-41674093 CAGAGGAGGAAGAAAGAGGAAGG + Intronic
1189561201 X:42193031-42193053 CATATAAGAGAGAGGGAGGACGG + Intergenic
1189571415 X:42301924-42301946 GAGAGGAGAAAGAGGGAGGAGGG - Intergenic
1189938619 X:46097165-46097187 CATAGGAGAAAGATGTAGGCTGG - Intergenic
1190006920 X:46749154-46749176 CATAAGAACTTGAAGGAGGAGGG + Intronic
1190012333 X:46796165-46796187 CATAGGAGAAAGAAGGGAGGAGG - Intergenic
1190885760 X:54530034-54530056 CGGAGGAGGGAGAAGGAGGACGG - Intergenic
1190913423 X:54792110-54792132 CACATGAGGTAGAAAGAGGAGGG + Intronic
1190923139 X:54876348-54876370 CAAAGGAGGTAGAGGGAGAATGG - Intergenic
1190930784 X:54948252-54948274 CATCGGAGATGGAATGAAGAAGG - Intronic
1193367016 X:80646809-80646831 CACAGGAGAAAGAAGGAGTTGGG - Intergenic
1193461745 X:81798327-81798349 CATGGGAGAAAGAAGAAGGCTGG - Intergenic
1193713570 X:84908237-84908259 CATATGAGGGAGAGGGAGGAGGG + Intergenic
1193742982 X:85241274-85241296 GAGAGGAGAGAGAAGGAGGGCGG + Intergenic
1194572430 X:95569489-95569511 TAATGGAGATAGAAGAAGGATGG + Intergenic
1194910874 X:99643093-99643115 TATTGGAGAAAGAAGAAGGATGG - Intergenic
1195504124 X:105637134-105637156 GAGAGGAGCTAGAAGAAGGAAGG + Intronic
1196674987 X:118410261-118410283 CATAGGAGAAAGGAGAAGAAAGG + Intronic
1196999401 X:121422028-121422050 CATAGGATACTGAAGTAGGAAGG - Intergenic
1197105042 X:122703485-122703507 CATGGGAGAAAGATGGAGGCTGG - Intergenic
1197346988 X:125336191-125336213 CATGGGAGAAAGAAGAAGGCTGG - Intergenic
1198401747 X:136275302-136275324 AATAGAAGAGAAAAGGAGGAGGG + Intergenic
1199547025 X:149017297-149017319 CAGAGGAGATGGAACCAGGAGGG + Intergenic
1200326434 X:155245176-155245198 CATTGGATACATAAGGAGGAGGG - Intergenic
1201193402 Y:11468882-11468904 CATAGGAGAAAGATGTAGGCTGG + Intergenic
1201238193 Y:11931525-11931547 CGTAGAAGAGGGAAGGAGGAGGG + Intergenic
1201481345 Y:14442880-14442902 CATGGGAGTTAGAAGCAAGATGG - Intergenic
1201731639 Y:17210850-17210872 CAAAGGAGCTGGAAGGGGGATGG - Intergenic
1202273667 Y:23094715-23094737 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202292360 Y:23325966-23325988 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202426663 Y:24728460-24728482 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202444126 Y:24941626-24941648 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic