ID: 1162461328

View in Genome Browser
Species Human (GRCh38)
Location 19:10815913-10815935
Sequence AGGGAGAAGCAAAGAGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1785
Summary {0: 1, 1: 1, 2: 46, 3: 191, 4: 1546}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162461310_1162461328 21 Left 1162461310 19:10815869-10815891 CCAGACTTAGAGAGAAGGCAGGC 0: 1
1: 0
2: 3
3: 12
4: 195
Right 1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG 0: 1
1: 1
2: 46
3: 191
4: 1546
1162461321_1162461328 -10 Left 1162461321 19:10815900-10815922 CCCGGCTGGCCCCAGGGAGAAGC 0: 1
1: 0
2: 2
3: 56
4: 402
Right 1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG 0: 1
1: 1
2: 46
3: 191
4: 1546
1162461320_1162461328 -9 Left 1162461320 19:10815899-10815921 CCCCGGCTGGCCCCAGGGAGAAG 0: 1
1: 0
2: 2
3: 32
4: 314
Right 1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG 0: 1
1: 1
2: 46
3: 191
4: 1546
1162461308_1162461328 22 Left 1162461308 19:10815868-10815890 CCCAGACTTAGAGAGAAGGCAGG No data
Right 1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG 0: 1
1: 1
2: 46
3: 191
4: 1546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162461328 Original CRISPR AGGGAGAAGCAAAGAGAGGC GGG Intronic
900356821 1:2268922-2268944 GGAGAGAAGGAAAGAGAGGGAGG - Intronic
900385577 1:2409112-2409134 GGGGAGAAGCCAAGAGAGGGAGG - Intronic
900391583 1:2436187-2436209 AGGGAGGAGGAAACAGAGGAAGG - Intronic
900681769 1:3920409-3920431 AGGGAGAGAAAAAGAGAGGGAGG - Intergenic
900681835 1:3920607-3920629 AGGGAGAGAAAAAGAGAGGGAGG - Intergenic
900722368 1:4185662-4185684 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
900725875 1:4216120-4216142 GGGGAGGTGCAAAGAGAGGAGGG - Intergenic
900748090 1:4374869-4374891 AGGGAGAGGGGAAGAAAGGCTGG + Intergenic
900847659 1:5116411-5116433 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
900870786 1:5301222-5301244 AGAGAGGAGGAAAGAGAGGGGGG + Intergenic
900932829 1:5747619-5747641 AGGGAGGAGCAGAGGGAGGGAGG + Intergenic
901556111 1:10032788-10032810 GGGGAGGGGCAAAGGGAGGCTGG - Intergenic
901560586 1:10067126-10067148 AGGCAGAAGCTAAGACAGGATGG - Intronic
901677217 1:10892649-10892671 AGAAAGAAGGAAAGAGAGGGAGG - Intergenic
902287124 1:15413940-15413962 CTGGAGGAGCAAAGAGAGGGAGG - Intronic
902435144 1:16393566-16393588 AGTGAGAAGCAAGCAGAGTCAGG + Intronic
902492588 1:16795368-16795390 AGGGAGAAGCCAAGCCAGGGAGG - Intronic
902790657 1:18765647-18765669 TGGAAGAAGAAAAGAGAGCCAGG + Intergenic
902884057 1:19392418-19392440 AGAGAGGAGCAAAGCGCGGCTGG + Intronic
902933883 1:19750560-19750582 AGGGAAGAGGAGAGAGAGGCAGG - Intronic
902970232 1:20043107-20043129 AAGTAAAAGCAAAGAGGGGCTGG + Intronic
902990573 1:20184855-20184877 ATTGAGAAGAAAGGAGAGGCTGG + Intergenic
903395841 1:23001369-23001391 AAGTAAAAGCAAAGAGAGGCGGG + Intergenic
903607574 1:24586011-24586033 AGGGAGAAGCGAAGAAGGGCTGG + Intronic
903679728 1:25088961-25088983 AGGGAGAAGGGAGGACAGGCAGG + Intergenic
903814818 1:26057333-26057355 GGGGAGACAGAAAGAGAGGCAGG + Intronic
904382908 1:30123597-30123619 AGGGAGAAGGAAAGAAAGAGAGG + Intergenic
904453553 1:30632470-30632492 AGGGAGAGGCAAAGGGAGTGGGG - Intergenic
904567372 1:31435746-31435768 AGGGAGAAGCCAAGATGGCCAGG + Intergenic
904576251 1:31506915-31506937 AATGAGAAGCAAAGGGAGGCAGG + Intergenic
904996309 1:34634377-34634399 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
905010414 1:34743179-34743201 AGTGAGAAGCCTGGAGAGGCTGG - Intronic
905053484 1:35073324-35073346 AGGGAGAAAGAAAGAAAGGAAGG + Intronic
905289639 1:36912496-36912518 AGGGAGCAGGGAAGAGAGACCGG - Intronic
905961666 1:42047793-42047815 AAAGAGAAGCACAGAGAGGTTGG + Intergenic
906076550 1:43056249-43056271 AGGGAGAAAGAAACAGAGGGGGG - Intergenic
906180172 1:43811237-43811259 AGGGAAGAGGAAAGACAGGCAGG - Intronic
906378877 1:45318839-45318861 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
906508656 1:46398288-46398310 AGGCAGAAGGGAGGAGAGGCGGG - Intronic
906526681 1:46497534-46497556 AGGGAGAGGCAAAGAGTTGGTGG + Intergenic
906637258 1:47417496-47417518 AGGGAGAAGAAATGAGAGGCTGG - Exonic
906663536 1:47599859-47599881 ATAAAGAAGCAAAGAGAAGCAGG + Intergenic
906693172 1:47806361-47806383 AGGGTGAGTGAAAGAGAGGCAGG - Intronic
906744343 1:48211402-48211424 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
906771488 1:48489136-48489158 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
907281034 1:53347129-53347151 AGGGAGAAGCAAACTGGGGGAGG + Intergenic
907376949 1:54052257-54052279 GGGGGGAAGCATAGAGAGGAGGG + Intronic
907503399 1:54900288-54900310 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
907743048 1:57185484-57185506 AGGGAGAAAAAGAGAGAGGCAGG + Intronic
907915100 1:58861210-58861232 AGGGAGAAGGAAGGAAAGGAGGG + Intergenic
907915124 1:58861308-58861330 AGGGAGAAGGAAGGAAAGGAGGG + Intergenic
908182381 1:61618855-61618877 AGGGAGAAGGAAGGAGAGAAAGG + Intergenic
908251453 1:62269077-62269099 AGGCTGCAGCAAAGACAGGCAGG - Intronic
908390374 1:63678395-63678417 AGGGAGGAGGGAAGAAAGGCAGG - Intergenic
908848167 1:68346195-68346217 AGGGAAAAGGAGAGTGAGGCAGG - Intergenic
908902842 1:68976100-68976122 AGAGAGAAAGAAAGAGAGGAGGG - Intergenic
909035645 1:70591586-70591608 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
909085812 1:71169168-71169190 AAGGAGAAGCACACAGTGGCAGG + Intergenic
909099941 1:71337536-71337558 AGGGAGATGGAAAGAGAGAGGGG - Intergenic
909222492 1:72982261-72982283 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
909362549 1:74780747-74780769 AGGGAGAAGCACAGAGAGTGGGG - Intergenic
909550855 1:76897194-76897216 AGGTGAAAGCAAAGAAAGGCTGG + Intronic
909716592 1:78715339-78715361 GGGGAGAAGAGAAGAGAGGCAGG - Intergenic
909729613 1:78875579-78875601 AGGTAAAAGCAAAGAGAGGCTGG - Intergenic
909776507 1:79490987-79491009 AGGTGAAAGCGAAGAGAGGCTGG + Intergenic
909837713 1:80277360-80277382 CAGAAGAAGCAAAGAGAGGTGGG - Intergenic
910013554 1:82494711-82494733 AGGGAGAAAGAAAGAGAGACGGG - Intergenic
910447252 1:87311117-87311139 AGGTTGAAGCAATGGGAGGCTGG + Intergenic
910798724 1:91123901-91123923 AGGAAGAAGGAAAAAGAGCCTGG + Intergenic
911127395 1:94353228-94353250 AGGGTGATGCAAAAAGAGTCAGG - Intergenic
911157027 1:94646935-94646957 AGAGAGAAGGAAAGAAAGGAAGG - Intergenic
911406669 1:97449362-97449384 AGGGAGGGGAAAAGAGAGGAAGG + Intronic
911504641 1:98733487-98733509 AAGGAAAAGGACAGAGAGGCAGG - Intronic
911661751 1:100509169-100509191 GGTGAGAAGCAAAGGGAGGGAGG - Intronic
912050258 1:105520966-105520988 AGAAAGAAGTAAAGAGTGGCAGG + Intergenic
912252403 1:108025062-108025084 AGAGAGGAGCAAAGAGAAGCAGG + Intergenic
912752794 1:112299404-112299426 GGGGATAAGAGAAGAGAGGCAGG + Intergenic
912813744 1:112812721-112812743 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
913008873 1:114662983-114663005 AGGGAAAAGGAAAGGGAGGAAGG + Intronic
913288500 1:117250170-117250192 AGGGAGCAAGAGAGAGAGGCAGG + Intergenic
913463616 1:119116350-119116372 AGGGAGAAAAAAAGAATGGCAGG + Intronic
914676049 1:149908362-149908384 AGGGAGGAGCAGGGAGAAGCTGG - Intronic
914960121 1:152197567-152197589 AGGGAGAAGAAAGGAGGGGAAGG - Intergenic
915095445 1:153459292-153459314 AGGGAGAAGCAGGGAGAGTCGGG + Intronic
915151725 1:153838498-153838520 AGGGGGAAAAAAAAAGAGGCAGG - Intronic
915265206 1:154711907-154711929 AGGGAGAGGAAGAGAGAGACAGG + Intronic
915265211 1:154711933-154711955 AGGGAGAGGAAGAGAGAGACAGG + Intronic
915265216 1:154711959-154711981 AGGGAGAGGAAGAGAGAGACAGG + Intronic
915265229 1:154712035-154712057 AGGGAGAGGAAGAGAGAGACAGG + Intronic
915528064 1:156488217-156488239 TGGGAGAAGCAAAGATGGGCAGG + Intronic
915552074 1:156641211-156641233 AGGGAAAAGCAAAGAGAGCCTGG + Intergenic
915849382 1:159304636-159304658 GGGTAGAAGAAAAGAGATGCAGG - Intronic
915878326 1:159637370-159637392 AGGAAGAGGAAAAGAGAGGGAGG - Intergenic
915898131 1:159827101-159827123 AGGCAGATACAAAGAGATGCAGG + Intronic
916007328 1:160674472-160674494 AGAGAGGAGGAAAGACAGGCAGG + Intergenic
916077355 1:161209587-161209609 AGGGAGAAGGTAAGAGTGGGAGG + Exonic
916409106 1:164527264-164527286 AGGGATAAAAAAAAAGAGGCAGG - Intergenic
917124719 1:171676922-171676944 AGGGGGAAGGAAGGAGAGGAGGG + Intergenic
917232909 1:172857151-172857173 AGGGAGAAGGAGGGAGAGGGAGG + Intergenic
917268615 1:173248660-173248682 AGAGAAAAGACAAGAGAGGCAGG + Intergenic
917645308 1:177023722-177023744 AGGGATCAGCAGACAGAGGCTGG + Intronic
917678201 1:177340229-177340251 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
918347295 1:183616938-183616960 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
918393465 1:184090569-184090591 AAGGAGAAGAAAAGAGAGTTAGG - Intergenic
919476578 1:198038066-198038088 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
919501322 1:198341314-198341336 AGGGAGAAACAAAGAGGGCAAGG + Intergenic
919829310 1:201529180-201529202 ATGGAGGGGGAAAGAGAGGCGGG - Intergenic
919887392 1:201944764-201944786 GGGGTGAAGCAAAGAGGAGCTGG - Intronic
920072992 1:203316555-203316577 ATGGAGAAGCTAAGAAGGGCAGG + Intergenic
920308282 1:205032756-205032778 AGGCAGAAGGAACGTGAGGCTGG - Intergenic
920371512 1:205482113-205482135 CTGGACAAGGAAAGAGAGGCAGG - Intergenic
920425579 1:205872512-205872534 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
920434588 1:205939771-205939793 AGGGAGCAAGAAAGAGAGCCAGG + Intronic
920440729 1:205978929-205978951 CTGGGGAAGGAAAGAGAGGCCGG + Intronic
920521130 1:206627568-206627590 AGTGAAAAACAAAGACAGGCAGG + Intergenic
920908179 1:210190563-210190585 AGGTAAAAGCAAAGAGAGGTTGG - Intergenic
921022822 1:211252009-211252031 AGAGAGATGCAAAGAGAAACAGG - Intergenic
921023745 1:211259333-211259355 AGGGAGGAGGGGAGAGAGGCGGG + Intronic
921172437 1:212561251-212561273 AGGGAGAAGCAAAGAGGAAGTGG - Intergenic
921459598 1:215412365-215412387 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
921509435 1:216011287-216011309 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
921840744 1:219825722-219825744 AGGGAGAAGGCCAGAGAGGTGGG + Intronic
922012596 1:221606224-221606246 AGGGAGACCCAAGGAGAGGGAGG - Intergenic
922048584 1:221969231-221969253 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
922049359 1:221975525-221975547 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
922153884 1:223026829-223026851 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
922244023 1:223777325-223777347 AAGCAGCAGCAAAGAGAGGTAGG - Intergenic
922297724 1:224266232-224266254 AGAAAGAAGCAGAGAGAGGGGGG - Intronic
922363362 1:224842879-224842901 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
922551688 1:226498765-226498787 GGGGAAGAGCAAAGAGAGGCAGG + Intergenic
922577433 1:226671649-226671671 AGGGAGAACCCCAGGGAGGCGGG + Intronic
922727914 1:227933263-227933285 AGGTGGAAGCAAACAGAGGTTGG - Intronic
922739068 1:228005667-228005689 AGGGAGGTGCATGGAGAGGCAGG - Intergenic
922784450 1:228276149-228276171 AGGGAGCGGAAAAGAGAGGAGGG + Intronic
922831614 1:228557295-228557317 AGGGAGGTGCCAAGAAAGGCAGG - Intergenic
922832091 1:228609277-228609299 AGGGAGGTGCCAAGAAAGGCAGG - Intergenic
922832651 1:228611518-228611540 AGGGAGGTGCCAAGAAAGGCAGG - Intergenic
922833212 1:228613759-228613781 AGGGAGGTGCCAAGAAAGGCAGG - Intergenic
922833772 1:228616000-228616022 AGGGAGGTGCCAAGAAAGGCAGG - Intergenic
922834330 1:228618241-228618263 AGGGAGCTGCCAAGAAAGGCAGG - Intergenic
922834891 1:228620472-228620494 AGGGAGGTGCCAAGAAAGGCAGG - Intergenic
922835441 1:228622675-228622697 AGGGAGGTGCCAAGAAAGGCAGG - Intergenic
922835999 1:228624917-228624939 AGGGAGGTGCCAAGAAAGGCAGG - Intergenic
922836557 1:228627157-228627179 AGGGAGCTGCCAAGAAAGGCAGG - Intergenic
922837116 1:228629398-228629420 AGGGAGGTGCCAAGAAAGGCAGG - Intergenic
922837676 1:228631640-228631662 AGGGAGGTGCCAAGAAAGGCAGG - Intergenic
922838234 1:228633880-228633902 AGGGAGGTGCCAAGAAAGGCAGG - Intergenic
922838793 1:228636105-228636127 AGGGAGGTGCCAAGAAAGGCAGG - Intergenic
922839352 1:228638346-228638368 AGGGAGGTGCCAAGAAAGGCAGG - Intergenic
922839913 1:228640577-228640599 AGGGAGGTGCCAAGAAAGGCAGG - Intergenic
922840473 1:228642818-228642840 AGGGAGGTGCCAAGAAAGGCAGG - Intergenic
922841036 1:228645049-228645071 AGGGAGGTGCCAAGAAAGGCAGG - Intergenic
923010010 1:230081170-230081192 AGGAAGAAGCAAAGGGCTGCAGG - Intronic
923037181 1:230292442-230292464 AGGGAGAAGGAAAGAGAGAGAGG - Intergenic
923075387 1:230604506-230604528 AGGTGACAGCAAAGAGAGGCTGG - Intergenic
923103587 1:230837223-230837245 AGGGAGACGCAAAGAAAGGGAGG + Exonic
923123113 1:231012507-231012529 AGAAAGAAGCAGAGGGAGGCTGG - Intergenic
923244928 1:232121469-232121491 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
923257163 1:232232055-232232077 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
923370188 1:233302618-233302640 AAGGAGAAGCAAAAAAATGCAGG - Intergenic
923408448 1:233685855-233685877 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
923527858 1:234787164-234787186 AGGGAGAAGCCAAGCCAGGGAGG + Intergenic
923770565 1:236934686-236934708 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
923846322 1:237736648-237736670 AGAGAGAAGCAAAGGAAGGCTGG + Intronic
923962957 1:239104652-239104674 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
924012827 1:239684795-239684817 AAGGAAAAGAAAAGAGAGGATGG + Intronic
924200200 1:241650533-241650555 AGAGAGAAGGCAAGAGAGTCAGG - Intronic
924260787 1:242228663-242228685 AGGGAGAGGGAGAGAGAGGAAGG + Intronic
924861604 1:247929401-247929423 AGGGAGAGGAAAAGAGGGGCAGG - Intergenic
1062902627 10:1157429-1157451 AGGGAGATACAGAGAGAGACAGG + Intergenic
1063155522 10:3375814-3375836 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
1063182912 10:3622115-3622137 AAGCAGAAGCAAATACAGGCAGG + Intergenic
1063363333 10:5474397-5474419 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1063796114 10:9515729-9515751 AGGGAGGAGGAAAGAAAGGAAGG + Intergenic
1063847545 10:10147988-10148010 AGGGAGAAGAAGAGAGAGTTGGG - Intergenic
1064420562 10:15187031-15187053 CAGGAGTAGCAAGGAGAGGCAGG + Intergenic
1064724940 10:18269747-18269769 AGGGAGGAGCAGAGAGAGGGAGG - Intronic
1065184244 10:23156825-23156847 AAGGAGAAGGAAAGAAAGGAAGG + Intergenic
1065184252 10:23156865-23156887 AAGGAGAAGGAAAGAGAGGGAGG + Intergenic
1065184260 10:23156894-23156916 AGGGAGAAGGAGCGGGAGGCAGG + Intergenic
1065602929 10:27388102-27388124 AGGGAGAAATAAAAAGAGGAGGG + Intergenic
1065699216 10:28408618-28408640 AGGGAGAGACAGAGAGAGACAGG - Intergenic
1065797755 10:29322800-29322822 AGAAAGAAGGAAAGAGAGGGAGG + Intergenic
1065928435 10:30457135-30457157 AGAAAGAAACAAAGAGAGGTGGG - Intronic
1065946735 10:30611620-30611642 AGAAAGAAGGAAAGAGAGGGAGG + Intergenic
1066116024 10:32241033-32241055 AGGAAGAAAGAAAGAGAGGAAGG - Intergenic
1066172557 10:32866649-32866671 AGGGAGAAGGAAGCAGAGGGAGG + Intronic
1066192588 10:33069520-33069542 AGAGAGAAGGAGAGAGAGGAAGG - Intergenic
1066336231 10:34481233-34481255 AGGGAGAGGGAAAGGGAGGAGGG - Intronic
1066660695 10:37736483-37736505 AGGGAGAGGAAGAGAGAGGGGGG + Intergenic
1067251598 10:44591362-44591384 AAGGAGAAGCAAGGGGTGGCTGG - Intergenic
1067252616 10:44600692-44600714 AGGAATAAGCAAGGACAGGCTGG - Intergenic
1067343129 10:45419918-45419940 ATGGCGGAGGAAAGAGAGGCCGG + Intronic
1067460062 10:46451607-46451629 AGAGAGAGACAGAGAGAGGCAGG - Intergenic
1067543797 10:47177336-47177358 AGGGAGAAGCCAAGAGAACCTGG + Intergenic
1067545521 10:47189927-47189949 AGGGAGGAGCAACAACAGGCAGG + Intergenic
1067627128 10:47933006-47933028 AGAGAGAGACAGAGAGAGGCAGG + Intergenic
1067744366 10:48924193-48924215 AGGGAGAAGCGCAGAAAGGGTGG - Intronic
1067748316 10:48953079-48953101 AGGGGGAAGTGAGGAGAGGCGGG - Intronic
1067853470 10:49769850-49769872 AGGGAGAAGGGGAGAGAGGGAGG + Intergenic
1067878384 10:50024073-50024095 TGGGAGAAGGAAAAAGAGGGTGG - Intergenic
1067893338 10:50153855-50153877 TGGGAGAAGGAAAAAGAGGGTGG + Intergenic
1068129433 10:52879098-52879120 AAGCAGAAGCAAAGAGATGCTGG + Intergenic
1068271762 10:54736812-54736834 AGGGAAAAGGAGAGTGAGGCAGG + Intronic
1068603529 10:58980261-58980283 AGGGTGAAGAATAGAGAGGCTGG + Intergenic
1068889179 10:62131069-62131091 AGGGAGCAGGAAAGTGAGTCAGG + Intergenic
1069009563 10:63356709-63356731 AGAAGGAAGCAAAGTGAGGCAGG + Intronic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1069282788 10:66676585-66676607 AGGGAGAAAGAGAGAGAGGCAGG - Intronic
1069449226 10:68502767-68502789 GGGGAGAAGAAAAGAGGGGAGGG + Intronic
1069728519 10:70596503-70596525 AGGGAGTTTCAAAGAGAGTCGGG + Intergenic
1069729535 10:70601924-70601946 AGGGAGTGGCAAAGAGGGGAGGG - Intronic
1069864067 10:71490151-71490173 AGGAAGAAACTCAGAGAGGCTGG - Intronic
1069920193 10:71811688-71811710 GGAGAGAAGCAGAGAGGGGCTGG - Intronic
1069982073 10:72259846-72259868 AAGTAGAAGCAAGGAGAGCCTGG - Intergenic
1070154046 10:73822650-73822672 AGGGAAGAGCAAAGTGAGACGGG - Intronic
1070369008 10:75764114-75764136 AGGGAGAGGCTAAGACAGGTAGG - Intronic
1070480828 10:76881172-76881194 ATGAAGAAGCAAGGAGATGCGGG + Intronic
1070523247 10:77273217-77273239 AGGGAGAATAAGAGAGAGGCAGG - Intronic
1070694035 10:78548590-78548612 AGGAAGGAGGAAAGAAAGGCAGG + Intergenic
1070953162 10:80446894-80446916 AGGGAGAAGGCAAGAGAAGAGGG - Intergenic
1071368187 10:84922980-84923002 AGTGAGAAGGAAAAAGAGCCTGG + Intergenic
1071468460 10:85961756-85961778 AGGAAGAAGGGAAGAGAGGGAGG - Intronic
1071854984 10:89614953-89614975 AGGGAGAAGAGAAGAAAGGTAGG + Intronic
1071897564 10:90083462-90083484 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1071916374 10:90298282-90298304 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1072077778 10:91995279-91995301 AGGGAGAATCTATGAGAGGGTGG + Intronic
1072146667 10:92646246-92646268 AGTAAAAAGCAAAGATAGGCCGG - Intronic
1072222317 10:93336855-93336877 AGGAAGAAGGAAAGAAAGGAAGG + Intronic
1072232682 10:93426269-93426291 AGGGAGTAGGTAAGCGAGGCTGG + Intronic
1072271275 10:93779491-93779513 AGGGAGAAAGAAAAAGAGGAAGG + Intronic
1072275274 10:93816681-93816703 AAGGAGAAAAGAAGAGAGGCAGG + Intergenic
1072615468 10:97046574-97046596 AGGGAAAGGAAGAGAGAGGCTGG - Intronic
1072719771 10:97773208-97773230 AGGGAGAGCCAATGAAAGGCAGG - Intergenic
1072917738 10:99549780-99549802 GGGGTGAAGCGAAGAGAGGGAGG - Intergenic
1073130774 10:101187798-101187820 AGGTAAAAGCAAAGAGGGGCTGG + Intergenic
1073311762 10:102547852-102547874 AGAGAGAAAGAAAGAGAGGCTGG + Intronic
1074256140 10:111804353-111804375 AGGGAGAAGAAAAGAGTATCAGG + Intergenic
1074321340 10:112406010-112406032 GAGGAGATGGAAAGAGAGGCAGG + Intronic
1074608719 10:115000503-115000525 AGAGAGAAGGAAAGAAAGGAAGG + Intergenic
1074740958 10:116483937-116483959 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1075014009 10:118896840-118896862 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1075248877 10:120848129-120848151 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1075256353 10:120928738-120928760 AGGGAGAAGGGAAGGGAGGGAGG - Intergenic
1075561621 10:123472664-123472686 AGGGAGAAGCAAGGAGGGGATGG + Intergenic
1075624438 10:123951441-123951463 GGGGAGAAGGACAGAGAGGTTGG + Intergenic
1075844665 10:125535632-125535654 AGGAAGAAGAAAAGGGAGGAAGG - Intergenic
1075901320 10:126044886-126044908 AGAGAGAAGCCATGAGGGGCAGG - Intronic
1075956311 10:126526067-126526089 AAGCAGAGGCAAAGAGGGGCAGG + Intronic
1076474127 10:130740624-130740646 AGTGAGAAGCTGAGAGAGACAGG + Intergenic
1076571955 10:131438901-131438923 AGGGAGAAGGGAAGAGAGGAGGG - Intergenic
1076749406 10:132535072-132535094 AGAGAGAAGCAGAGTAAGGCAGG + Intergenic
1076821174 10:132940484-132940506 AGGGAGCAGCAAAGGCACGCTGG + Intronic
1077210764 11:1370066-1370088 AGGGACAAGCAACGAGGGGGAGG + Intergenic
1077447896 11:2608911-2608933 AGGGAGAAGAAAAGAAGGGGAGG - Intronic
1077612368 11:3651226-3651248 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1077657060 11:4029538-4029560 AGGGAGAGGGAGAGAGAGGAGGG + Intronic
1077850624 11:6072258-6072280 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1077883533 11:6369094-6369116 AGGTGAAAGCGAAGAGAGGCTGG - Intergenic
1078152653 11:8772620-8772642 AGAGAGAAGGAAACAGAGACAGG + Intronic
1078404843 11:11061458-11061480 AGGGAGAAAGAAAGAGAGAGAGG - Intergenic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078414579 11:11155013-11155035 AAGGAGAAGCAGAGAGTGGTGGG + Intergenic
1078524778 11:12091904-12091926 AGGGAGGAGAAAAGGGAGGAAGG - Intergenic
1078544728 11:12239176-12239198 AGGGATAAGAAATGAGAGTCGGG + Intronic
1078545012 11:12240939-12240961 AGGGAGAAGAGAAGAGGAGCAGG - Intronic
1078660330 11:13280734-13280756 AGGGAGAAGAAAAGACAAGGTGG - Intronic
1078760261 11:14245826-14245848 AAGGAGAAGCAACACGAGGCAGG + Intronic
1078789165 11:14525746-14525768 AGGTAAAAGCAAAGAGAGGCTGG - Intronic
1078987813 11:16612214-16612236 AGAGAGAGGGAGAGAGAGGCTGG - Intronic
1079083284 11:17428534-17428556 TGGGAGTAGCAAGGGGAGGCCGG + Intronic
1079288930 11:19168304-19168326 AGAGAGAAGAGAAGAGAGGCAGG - Intronic
1080036854 11:27719768-27719790 AGGGAGGGGGAAAGAGAGGGAGG + Intronic
1080119874 11:28664786-28664808 AGAGAGAAAAAAGGAGAGGCTGG + Intergenic
1080321395 11:31014244-31014266 AGAAAGAAACAAAGAGAGGAAGG - Intronic
1080421507 11:32115271-32115293 AAGAAGAAGCAAAGAGTGGAAGG - Intergenic
1080556310 11:33420614-33420636 AGGGAGAAGTGAAGAGAGTGAGG + Intergenic
1080556604 11:33422587-33422609 AGGAAGAAGGAAAGAAAGGAGGG - Intergenic
1080807126 11:35663376-35663398 AGGGAGATAGAAAGCGAGGCAGG + Exonic
1080994310 11:37581133-37581155 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1081159876 11:39737688-39737710 AGGTAAAAGCAAAGAGAGGCTGG - Intergenic
1081356987 11:42123866-42123888 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1081694435 11:45099976-45099998 TGGGAGAAGAATTGAGAGGCAGG + Intronic
1081938496 11:46920797-46920819 TTGGAGAAGAAACGAGAGGCGGG + Intergenic
1082143564 11:48638625-48638647 AGGGAGAAGAAAAGAGATGTTGG - Intergenic
1082223917 11:49677738-49677760 GGGGAGAAGAAAAGAGAAGAGGG - Intergenic
1082266863 11:50128767-50128789 AGAGAGAGACAGAGAGAGGCAGG + Intergenic
1082289226 11:50349801-50349823 AGAGAGAGACAGAGAGAGGCAGG - Intergenic
1082887002 11:58096099-58096121 AGGGAGAAAGAAAGAGAGGGAGG - Intronic
1083041368 11:59690700-59690722 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1083351885 11:62035475-62035497 AAGGAGAAAGAAAGAGAGGAAGG - Intergenic
1083534583 11:63456195-63456217 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1083549053 11:63572138-63572160 AGGAAGAAAGAAAGAGAGGAAGG + Intergenic
1083596484 11:63920356-63920378 AGGGAGCGGCAAGGGGAGGCCGG - Intergenic
1083611865 11:64008199-64008221 AGGGAGAGGCAAAGCGTGGAGGG + Intronic
1083737374 11:64689207-64689229 AGGGAGACACAGAGAGAGGCAGG - Intronic
1083996456 11:66275467-66275489 TGTGAGAAGCAAAGAGAGAGCGG - Intronic
1084052073 11:66606436-66606458 AGGGAGAATCTAAGAGTTGCTGG + Intergenic
1084209191 11:67613144-67613166 AGGGAGAAGGGCAGAGAGGCGGG + Intergenic
1084303749 11:68267941-68267963 AGGGAAAAGGAAAGACAGCCAGG - Intronic
1084354377 11:68627427-68627449 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1084535343 11:69753152-69753174 AGAGAGGAGCAAACAGAGGCTGG - Intergenic
1084591504 11:70093271-70093293 AGGGAGAAGGAGAGAGAGAGGGG - Intronic
1084683081 11:70678470-70678492 AGGGAGAGGCAGGGAGAGGCAGG - Intronic
1084792740 11:71485108-71485130 GGGCAGAGGAAAAGAGAGGCCGG + Intronic
1085154078 11:74277261-74277283 AGGAAGGAGGAAAGAGAGGGAGG + Intronic
1085259240 11:75194806-75194828 AGGGAGAAGAAAAGAGAGATGGG - Intronic
1085469136 11:76745711-76745733 GCGGAGAAGCAGAGAGAGGGTGG - Intergenic
1085569518 11:77547248-77547270 AGGGAGAGAGAAAGAGAGGAAGG - Intronic
1085791561 11:79501400-79501422 AGAGATAAGCAAACAGAAGCAGG - Intergenic
1085866965 11:80305578-80305600 AGGGAGAGGTAAAGAGGGGATGG - Intergenic
1085959561 11:81444381-81444403 AGAGAGAAGCAAAGAAACCCTGG + Intergenic
1086134662 11:83434030-83434052 AAGGGAAAGCGAAGAGAGGCTGG + Intergenic
1086270843 11:85064875-85064897 AGAGAGAAAGAGAGAGAGGCTGG - Intronic
1086550390 11:88046472-88046494 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1086983295 11:93222011-93222033 AGGAGGAAGAAAAGAGAAGCTGG - Intergenic
1087306927 11:96499678-96499700 AGGGAAACGCAAAGAGCTGCAGG + Intronic
1087314856 11:96591214-96591236 AAGCAAAAGCGAAGAGAGGCTGG - Intergenic
1087512550 11:99115827-99115849 AGTGAGAAGCAAAGAAAGGAAGG + Intronic
1087734278 11:101814218-101814240 AGGGAGAGGGAAAGAGAGTGAGG + Intronic
1087839366 11:102906506-102906528 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1088058444 11:105612652-105612674 AGGAAGAAGCAAAGAGAGGGAGG - Intronic
1088596139 11:111441756-111441778 AGGGAAAAGCAAAGCGAGTTGGG + Intronic
1088900834 11:114115805-114115827 GGGGAGAAGGACAGAGAGGCAGG + Intronic
1088904065 11:114140747-114140769 AGGTACAAGAAAAGAGAGACTGG - Intronic
1089196760 11:116698067-116698089 AGGAAGGAGAAAAGAAAGGCGGG - Intergenic
1089343613 11:117776405-117776427 GGGGAGGAGGAATGAGAGGCGGG - Intronic
1089454449 11:118617892-118617914 ATAGAGCAGCAAGGAGAGGCAGG + Intronic
1089723402 11:120451007-120451029 AGGAAGAAGAAAAGAGAGAAAGG - Intronic
1089850104 11:121488285-121488307 AGAGAGAAGGAGGGAGAGGCAGG - Intronic
1089930974 11:122311595-122311617 AGGATGAGGCAAAGAAAGGCTGG + Intergenic
1089953485 11:122550236-122550258 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1090871786 11:130755939-130755961 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1090920631 11:131203416-131203438 AGGGAACAGAACAGAGAGGCTGG - Intergenic
1091153972 11:133356545-133356567 AGGGAAAAGCAAAGAGGGAGAGG - Intronic
1091196546 11:133736286-133736308 AGGGAAAAGCAGAGAGAGAGAGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091665493 12:2415792-2415814 AGAGAGAAGCAAAGACAGAGAGG - Intronic
1092217622 12:6694128-6694150 AGGGAGGCCCAAAGGGAGGCTGG + Exonic
1092363903 12:7861145-7861167 AGGAAGAACCAAAGAGAGAGGGG + Intronic
1092525120 12:9305148-9305170 AGGGAGAAGGAAAGCAAGGAGGG - Intergenic
1092719801 12:11430603-11430625 AGGGAGAAGACAAGGGAGGGAGG - Intronic
1092780129 12:11978591-11978613 AGGAAGAAGGCAAGAAAGGCAGG + Intergenic
1092875363 12:12842982-12843004 AGGAGGAAGCAAGGAAAGGCAGG - Intergenic
1092924677 12:13262390-13262412 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1093117749 12:15232938-15232960 AGGCAGAAAGGAAGAGAGGCAGG + Intronic
1093124416 12:15311248-15311270 AGAGAGAAAGAAAGAGAGGAAGG - Intronic
1093358604 12:18198244-18198266 AGGTGAAAGCAAAGAGAGGCTGG - Intronic
1094146120 12:27230287-27230309 AGAGAGAAGGAAAGAAAGGAAGG - Intergenic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1094583482 12:31755841-31755863 AAGGAATAGAAAAGAGAGGCAGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095328910 12:40933101-40933123 AGGGAGAAGGAAAGAGAAGAAGG - Intronic
1095627500 12:44333787-44333809 ATGGAGAAGTAAAGAGAGATAGG + Intronic
1095637823 12:44453083-44453105 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1095714165 12:45323623-45323645 AGGGAAAATCATAGAAAGGCAGG - Intronic
1095778362 12:46033430-46033452 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1096405303 12:51339806-51339828 AGGGATAGGCAGAGAGTGGCGGG + Intronic
1096424633 12:51490744-51490766 AATGAGAAGGAAAGAGAGGCAGG + Intronic
1096614751 12:52825582-52825604 AGGCAGGAACAAAGAGAGACAGG + Intronic
1096701510 12:53386255-53386277 AGGGAGAAGGAAAGGGAGTGGGG + Intronic
1096793663 12:54060704-54060726 AGGAGGAAGAAAGGAGAGGCTGG - Intergenic
1097200282 12:57272584-57272606 AGGGAAGAGAAAAGAGAGGTGGG + Intronic
1097254629 12:57664457-57664479 AGGAAGAAGGAAAGAAAGGAAGG - Intergenic
1097320663 12:58222522-58222544 AGGTTGAAGCAGAGAGAGTCTGG - Intergenic
1097882203 12:64696126-64696148 AGGGAGAGGGAGAGAGAGGGAGG - Exonic
1098040764 12:66352228-66352250 AGGGTGAAGAATGGAGAGGCAGG + Intronic
1098109085 12:67102644-67102666 AGAGAGATGCAGAGAGAGGGAGG - Intergenic
1098234526 12:68406100-68406122 GGGGAAATGCAGAGAGAGGCAGG - Intergenic
1098576029 12:72043313-72043335 AGGGAGAAGGAAAGAATGGATGG - Intronic
1098629235 12:72706640-72706662 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1099185737 12:79513931-79513953 AGGGAAAGGCATAGAGAGGGAGG - Intergenic
1099188896 12:79543151-79543173 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1099226276 12:79973171-79973193 AGAGAGAGGGAAAGAGAGGGAGG + Intergenic
1099314202 12:81064517-81064539 AGGGAGAAGGAGAGAGAGAGAGG - Intronic
1099335583 12:81352474-81352496 AGGGAAAGGGAAAGTGAGGCAGG - Intronic
1099724987 12:86413897-86413919 AGGGATAGGGAAAGAGAAGCAGG + Intronic
1099778194 12:87161559-87161581 AGGGAGAAGGAGAGAGAGAGAGG - Intergenic
1099872969 12:88370965-88370987 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1099944276 12:89225993-89226015 AGGGAGAGGAAGAGAGAGGGAGG - Intergenic
1100307988 12:93368915-93368937 AGGGAGAAAGGAAGAGAGGTAGG - Intergenic
1100307997 12:93368961-93368983 AGGGAGAAAGGAAGAGAGGTAGG - Intergenic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1100561535 12:95752450-95752472 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1100711358 12:97260444-97260466 TGGGAGAGGCAAAGAGAGAAAGG + Intergenic
1100974121 12:100103588-100103610 AAGGAGAAACAAAGACAGTCTGG + Intronic
1101033562 12:100683266-100683288 AGGGAGAGAGAAAGAGAGGCAGG + Intergenic
1101278221 12:103225099-103225121 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1101375931 12:104171667-104171689 ATAAAGATGCAAAGAGAGGCTGG + Intergenic
1101782630 12:107849256-107849278 AGGGAGAGACAAAGAGAGAAGGG - Intergenic
1101876544 12:108599887-108599909 AGGGAGAAGCAAAGAACGAGGGG - Intergenic
1102194905 12:111018188-111018210 AGGGAGAGAGAAAGAGAGGAAGG + Intergenic
1102198025 12:111038020-111038042 CAGGATGAGCAAAGAGAGGCCGG + Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102551485 12:113695166-113695188 AGGGGGAGGTAAAGAGAGCCGGG - Intergenic
1102604657 12:114059130-114059152 AGGTAAAAGCAAAGAGAGGCTGG - Intergenic
1102682231 12:114698626-114698648 AGGGAGATGGAGAGAGAGGAGGG - Intergenic
1102933448 12:116879254-116879276 AATGAGAAGGAAAGAGAGGAAGG - Intronic
1103175440 12:118859403-118859425 AGGGAGAAACAAACAAAGGTGGG - Intergenic
1103834486 12:123807981-123808003 AGGGAGAGGGAGAGAGAGACGGG + Intronic
1103951678 12:124554824-124554846 AGGGAGAAGCCAAGACAGACAGG + Intronic
1104206377 12:126642689-126642711 AGGGTGAAGCAAAGCAGGGCGGG - Intergenic
1104249305 12:127075938-127075960 AGAGAGAAGGAAGGAGAGGAGGG - Intergenic
1104604125 12:130175510-130175532 ATGGGGAAGCAAAGGAAGGCCGG + Intergenic
1104649751 12:130522947-130522969 AGAGAGGGGGAAAGAGAGGCAGG - Intronic
1104915922 12:132264491-132264513 AGGCTGGAGCCAAGAGAGGCAGG - Intronic
1104920027 12:132285882-132285904 AGGGAGAGACAGAGAGAGACAGG + Intronic
1104921836 12:132294638-132294660 GGGCAGGAGCAAGGAGAGGCTGG + Intronic
1105032401 12:132892997-132893019 AGGTAAAAGCAAAGAGAGGCTGG - Intronic
1105753810 13:23446254-23446276 AGGCAGAAGACAAGAAAGGCTGG - Intergenic
1105771575 13:23617211-23617233 AGGGAGTGGCAGAGAGAGGGAGG + Intronic
1105947570 13:25202769-25202791 AGGCACAAGCAAAGCCAGGCTGG - Intergenic
1106286692 13:28324249-28324271 AGGCAGAAGCAGAGAGGGACTGG + Intronic
1106310516 13:28549987-28550009 AGGGAGAAAGAAAGAGAAGGAGG - Intergenic
1106580255 13:31011628-31011650 AGTGAGAGGCAAAGAGATGCTGG + Intergenic
1106828842 13:33556249-33556271 AAGGAAAAGAAAAGGGAGGCGGG - Intergenic
1106943621 13:34801924-34801946 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1107329053 13:39277866-39277888 GGGGAGAAGGAAAGGGAGGGTGG - Intergenic
1107579221 13:41764327-41764349 AGGGAGAAACGAAGGGAGGGAGG - Intronic
1107795337 13:44045960-44045982 AGAGAGAATGAAAGAGAGGAAGG - Intergenic
1107824296 13:44313614-44313636 AGAGAGGAGTAAAGGGAGGCTGG + Intergenic
1108004628 13:45934431-45934453 GGGCAGGTGCAAAGAGAGGCTGG + Intergenic
1108421065 13:50250130-50250152 AGGGAGGAAGAAAGAGAGGAAGG - Intronic
1108513171 13:51173154-51173176 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1108588655 13:51892936-51892958 AGGGTGCAGTAAAGAAAGGCAGG - Intergenic
1108677633 13:52750983-52751005 AGGGAGCAGAAAGGGGAGGCAGG - Intergenic
1108721450 13:53136851-53136873 AGGGAGAGGGAAAGAGAAGGAGG + Intergenic
1108794814 13:54017974-54017996 AGGGAGAAGAAAAGGAAGGAAGG + Intergenic
1109260980 13:60144755-60144777 AGTGAGAAGCAAAGAGACACTGG + Intronic
1109337615 13:61012500-61012522 AAGGAGATGTAAAGAGAGCCAGG + Intergenic
1109343752 13:61091646-61091668 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1109353089 13:61208090-61208112 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1109374762 13:61477551-61477573 AGGGAGGAGAAAAGAAAGGCTGG + Intergenic
1109476909 13:62891404-62891426 AAGGAGAGGCAGAGAGAGGGAGG - Intergenic
1109499472 13:63216401-63216423 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1109837987 13:67883756-67883778 AGGGAGCAACAGAGAGAGGAGGG - Intergenic
1109932839 13:69238475-69238497 ATGGAGAAGCACAGAAGGGCAGG - Intergenic
1110205832 13:72911975-72911997 AGAGAGAAGGAAAGAAAGGAAGG + Intronic
1110277256 13:73653873-73653895 AGTGAGAGGCAAACAGAAGCAGG + Intergenic
1110493030 13:76131736-76131758 AGGCTGAAGCCAAGAGAGGCTGG - Intergenic
1110650317 13:77935750-77935772 AGGTGAAAGCAAAGAAAGGCTGG + Intergenic
1110978659 13:81869467-81869489 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1111125863 13:83910705-83910727 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1111194209 13:84851239-84851261 CTGGAAAAGCAAAGAGAGGCAGG - Intergenic
1112237002 13:97645602-97645624 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1112359915 13:98708124-98708146 AGAGAGAGGCAAAGAGAGGGAGG + Intronic
1112388213 13:98959710-98959732 AGGAAAACGAAAAGAGAGGCAGG + Intronic
1112504884 13:99969707-99969729 AGGGCGATGGAAAGAGAGGCCGG - Intronic
1112661897 13:101519528-101519550 AGGAAGAAGGGAAGACAGGCAGG - Intronic
1113217428 13:108058719-108058741 AGGGAGAAAGAAAGGGAGGCAGG + Intergenic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113599489 13:111558408-111558430 AGGGAGAAGGAAAGCGAGACAGG + Intergenic
1113705693 13:112431709-112431731 TGGGAGAACTAAAGAGAGGTGGG + Intronic
1113992239 14:16036863-16036885 AGGGAGAAAATAAGAAAGGCAGG - Intergenic
1114193589 14:20458718-20458740 AGGGAGAAGAAAAGAAAGATGGG + Intronic
1114221846 14:20703846-20703868 AGGTAAAAGCAAAGAGAGGCTGG - Intergenic
1114479806 14:23025670-23025692 ACGGAGAAGGAGAGAGAGGCAGG - Intronic
1114556979 14:23567729-23567751 AGGCAGAAGCCAGGTGAGGCTGG - Exonic
1114950105 14:27739591-27739613 AGTTAGAAGCTAACAGAGGCTGG + Intergenic
1115240433 14:31247823-31247845 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1115395885 14:32907868-32907890 AGACAGACGCAAAGAGAGTCTGG - Intergenic
1115432870 14:33341532-33341554 AGGGAGAGGGAAAGGGATGCGGG + Intronic
1116179852 14:41519234-41519256 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1116490404 14:45497806-45497828 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1116702228 14:48257807-48257829 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1116763111 14:49039065-49039087 AGGGAGAGACAGAGAGAGGGAGG - Intergenic
1117601556 14:57381148-57381170 AGGAAGAAGGAAAGAAAGGAAGG + Intergenic
1118138971 14:63058918-63058940 AGAGAGCTGCAAAGAGATGCTGG + Intronic
1118231036 14:63950116-63950138 TGGAAGAAGCACAGAGAGGAAGG - Intronic
1118357445 14:65026519-65026541 TGGGAGAACAGAAGAGAGGCAGG - Intronic
1118489956 14:66249309-66249331 AGGGAGAAGAAGAGAAAGGAAGG - Intergenic
1118937079 14:70298223-70298245 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1119022593 14:71127598-71127620 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1119041514 14:71278711-71278733 AGGGAGAAGAAAAGAGAGGAAGG + Intergenic
1119048935 14:71346849-71346871 AGGGAGATAGAAAGATAGGCAGG - Intronic
1119317375 14:73706773-73706795 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1119673067 14:76534315-76534337 AGGGAACAGCAAAGAGAGAATGG + Intergenic
1119674223 14:76541815-76541837 GGGCTGAAGCAAAGAGAGGAGGG + Intergenic
1119689494 14:76660288-76660310 AGGCAGGAGGAAAGAGAGGGAGG + Intergenic
1119703638 14:76771029-76771051 AGGGAGAGGGAAAGAGAAGGAGG + Intronic
1119749196 14:77065473-77065495 AGAGAGAAGAAAAGTGAGCCAGG + Intergenic
1119932043 14:78556969-78556991 AGGGAGAAGGGAAGGGAGGGAGG - Intronic
1120590318 14:86366318-86366340 AGGGAGAAAGAAAGGGAGGAAGG + Intergenic
1120618415 14:86734607-86734629 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1120659783 14:87237462-87237484 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1120749851 14:88187218-88187240 AGAATGAAGCAAACAGAGGCTGG + Intronic
1121289603 14:92763156-92763178 AGGTAAAAGCAAAGAGAGGCTGG - Intergenic
1121451762 14:94012448-94012470 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1121564130 14:94895977-94895999 ATGGAGTTGCAGAGAGAGGCAGG + Intergenic
1121697961 14:95928341-95928363 AGAGAGAGGCAGAGAGAGGGAGG - Intergenic
1121703825 14:95976239-95976261 AGGTGAAAGCAAAGACAGGCTGG - Intergenic
1121720516 14:96105542-96105564 AGGAAGAAAGAAAGAAAGGCAGG + Intergenic
1121938262 14:98041557-98041579 AGGGACATGGGAAGAGAGGCAGG - Intergenic
1122589122 14:102833451-102833473 AGGGAAAAGCAAAGGAAGGAAGG - Intronic
1122861747 14:104585633-104585655 AGAGAGAATCAGAGAGAGGAAGG + Intronic
1122861758 14:104585747-104585769 AGACAGAATCAGAGAGAGGCAGG + Intronic
1123882318 15:24688004-24688026 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1124004560 15:25785579-25785601 AGGCAGAAGCAGTGAGTGGCAGG + Intronic
1124045208 15:26142546-26142568 AGAGAGAAAGAAAGAGAGGGAGG - Intergenic
1124100389 15:26687548-26687570 AGGGAAAAGGGAAGAGAGGAAGG - Intronic
1124416884 15:29479613-29479635 AGGGAGAGAGAAAGAGAGGGAGG - Intronic
1125213040 15:37238637-37238659 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1126529978 15:49701562-49701584 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1126843923 15:52741868-52741890 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1126923514 15:53555115-53555137 ATGGAGAAGCAAAGAATAGCAGG + Intronic
1127071860 15:55295201-55295223 AAGGAGAAGGAAAGGGAGGGAGG + Intronic
1127397706 15:58555881-58555903 AGGGCGGAGAAGAGAGAGGCAGG - Intronic
1127438820 15:58986040-58986062 AGGGAGAAGATAAGATAGTCCGG + Intronic
1127957237 15:63864022-63864044 AGGGACATGGAAAGAGAAGCTGG + Intergenic
1128326791 15:66729223-66729245 AGGGAGATGCAGGGAGACGCAGG - Intronic
1128384875 15:67140420-67140442 AGGCAGAAGTAAAGAGAGAACGG - Intronic
1128404182 15:67318212-67318234 AGGGAGAAGGAAGGAAAGGAAGG - Intronic
1128686175 15:69687342-69687364 AGGGAGAAGGAAAGTTAGGAAGG + Intergenic
1129274197 15:74434492-74434514 AGGGAGGAGAAAGGAGAGGGAGG - Intergenic
1129665294 15:77576226-77576248 AGGGAGGAGCAGGGGGAGGCTGG + Intergenic
1129970632 15:79774933-79774955 AGGGAGAAACAAAGAAGGGGTGG + Intergenic
1130099141 15:80878873-80878895 AGGGAGCAGCAGAGAGAGATTGG - Intronic
1130272401 15:82458862-82458884 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1130464752 15:84186215-84186237 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1130487933 15:84408589-84408611 AGGGAGAAGCAGGGATAGGTGGG - Intergenic
1130499514 15:84487322-84487344 AGGGAGAAGCAGGGATAGGTGGG - Intergenic
1130587044 15:85190829-85190851 AGGGAGAAGCAGGGATAGGTGGG + Intergenic
1130673089 15:85930429-85930451 AGGGAGAAGGCAGGAGAGGGGGG - Intergenic
1130791989 15:87165147-87165169 TGGGAGAACTGAAGAGAGGCAGG - Intergenic
1131010843 15:89017360-89017382 AAGGGGAGGCAAAGAGAGGAAGG - Intergenic
1131217724 15:90553341-90553363 AGTGAGAAGCACAGAGAGTTAGG + Intronic
1131320294 15:91382934-91382956 AAAAAGAAGCAAAGAGAGGGAGG + Intergenic
1131357434 15:91757912-91757934 AGGAAGAAGCAAAGAGGGGAGGG - Intergenic
1131551258 15:93359002-93359024 AGGGAGGAGAGAAGAGAGGGAGG + Intergenic
1131573288 15:93561020-93561042 ATGGAAAAGGAAAAAGAGGCTGG + Intergenic
1131684353 15:94754060-94754082 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1131780064 15:95846328-95846350 AGGGAGAAGGGAAGAGAGGAGGG + Intergenic
1131838465 15:96413105-96413127 AGTGAGAATCAGAGAGATGCAGG - Intergenic
1131882336 15:96874245-96874267 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1132020406 15:98356518-98356540 AGGGAGAAAGAAAGGGAGGGAGG + Intergenic
1132325130 15:100962643-100962665 AGGGAGGAGAAAAGAGTGTCAGG + Intronic
1132481575 16:168874-168896 AGGGGGAAGCAAAGAGTGAGGGG - Intergenic
1132766435 16:1536739-1536761 AAGGAGAAGGCGAGAGAGGCAGG - Intronic
1132831886 16:1932468-1932490 AGGGAGAAGCAGAAAGGGACAGG + Intergenic
1133389776 16:5400387-5400409 AGAGAGAAGCAAGCAGTGGCCGG - Intergenic
1133392770 16:5422830-5422852 AGGGAGGAGCAGAGAGAAGGAGG + Intergenic
1133460110 16:5980209-5980231 AGGGAGATGCAAACAGTGGTAGG - Intergenic
1133485312 16:6214310-6214332 AGGGAGAAGGAGAGAGAGAGGGG + Intronic
1133755240 16:8757675-8757697 AGGGAGAGGGAAGGAGAGGTGGG + Intronic
1133766580 16:8842514-8842536 AGGTGAAAGCAAAGAGAGGCTGG + Intronic
1133842744 16:9424956-9424978 AGAGAGAAGGAAAGAGAGAGAGG + Intergenic
1133938349 16:10286445-10286467 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1134230512 16:12425561-12425583 AGGGAATAGAAAACAGAGGCAGG + Intronic
1134557411 16:15177380-15177402 AAGGAAAAGGAAAGAGAGGGAGG + Intergenic
1134598014 16:15511274-15511296 AGGGAGTGTCAAAGAGAAGCAGG - Intronic
1134892565 16:17853992-17854014 TGGGAGAGGAAAAGAGAGGAGGG + Intergenic
1134917981 16:18089059-18089081 AAGGAAAAGGAAAGAGAGGGAGG + Intergenic
1135066537 16:19314898-19314920 AGGGAGAAGAAGGGAGAGGAAGG + Intronic
1135200760 16:20436170-20436192 AGAGAGAAGAAAAGGGAGGGAGG - Intronic
1135206350 16:20487688-20487710 TGGGAAAAACAAAGAAAGGCAGG + Intergenic
1135281712 16:21158688-21158710 CAGGCGAAGCGAAGAGAGGCAGG - Exonic
1135821264 16:25688587-25688609 AGGCAGAAGCCTTGAGAGGCAGG - Intergenic
1136403340 16:30030161-30030183 ACGGGGAAGAAGAGAGAGGCGGG + Intronic
1136403519 16:30030788-30030810 GGGGAGAGGCAAAGAGGGGATGG + Exonic
1136500737 16:30668741-30668763 AGGGTGAAGCAGAGAGTGACAGG - Intronic
1136536545 16:30902970-30902992 CAGGCAAAGCAAAGAGAGGCTGG - Exonic
1136629777 16:31483137-31483159 ATGGAGGAGCACACAGAGGCAGG + Exonic
1136935600 16:34461050-34461072 AGGGAGAAATGAAGAGAGGGAGG - Intergenic
1136939655 16:34510887-34510909 AGCGAGAAAGGAAGAGAGGCAGG - Intergenic
1136946107 16:34652916-34652938 AGGGAGAAAGGAAGAGAGGGAGG + Intergenic
1136948943 16:34691458-34691480 AGGGAGAAAGGAAGAGAGGGAGG + Intergenic
1136956437 16:34791970-34791992 AGGGAGAAAGGAAGAGAGGGAGG + Intergenic
1136960165 16:34837673-34837695 AGCGAGAAAGGAAGAGAGGCAGG + Intergenic
1136964218 16:34887520-34887542 AGGGAGAAATGAAGAGAGGGAGG + Intergenic
1137029139 16:35506239-35506261 AGGGAGGAGCAAGAAGGGGCGGG + Intergenic
1137384234 16:48026814-48026836 AGGCAGAAGGCAAGAGAGCCAGG + Intergenic
1137510833 16:49098658-49098680 AGGGGGAAGGAAGGAGAGGAGGG + Intergenic
1137608229 16:49801191-49801213 TGGGACCAGCACAGAGAGGCAGG - Intronic
1137656145 16:50159534-50159556 AGAAATAAGCAGAGAGAGGCCGG - Intronic
1137708023 16:50548648-50548670 CGGGAGAAGGAAAGAAAGGAAGG - Intronic
1137807480 16:51321037-51321059 AGGGAGAAGAAAAGAGTGTGGGG + Intergenic
1138213111 16:55179784-55179806 AGGGAGAGGATAAGAGAGGGGGG - Intergenic
1138542326 16:57695940-57695962 AGGGAGCAGCAGATAAAGGCTGG - Intronic
1138659856 16:58510511-58510533 AAGGACAGGCACAGAGAGGCTGG - Intronic
1138835993 16:60435214-60435236 AGAAAGAAGGAAAGAGAGGCCGG + Intergenic
1139439528 16:66958948-66958970 AGGAAGAAAGAAAGAGAGGAAGG + Intergenic
1139636935 16:68263852-68263874 ATGGAGGAGCAAACAGAGGGAGG + Intergenic
1140236805 16:73166527-73166549 AGAGAGAAGCAAGGAAGGGCCGG + Intergenic
1140565040 16:76031907-76031929 AGAGAGAACCAAAGAGATGATGG + Intergenic
1140908388 16:79429522-79429544 AGGAAGCAGCAGAGAGAGGGAGG + Intergenic
1141029109 16:80572323-80572345 AGGGAGAGACAGAGAGAGACAGG + Intergenic
1141316170 16:82964457-82964479 AGGGAGAAGTAAAGAGAAAGAGG + Intronic
1141326768 16:83067812-83067834 AGAGAGAAGAAGAGAGGGGCAGG - Intronic
1141478723 16:84292138-84292160 AGGGAGAGAGAGAGAGAGGCAGG + Intergenic
1141565413 16:84898373-84898395 AGGAAGATGCACAGAGAGGGTGG - Intronic
1141766662 16:86063680-86063702 AGGGAGAGGGAAGGAGAGGGAGG + Intergenic
1141796715 16:86279825-86279847 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1141798971 16:86294567-86294589 AGGGAGAGGGAAAGACAGGAGGG - Intergenic
1141931891 16:87210760-87210782 AGGGAGAGAGAAGGAGAGGCGGG + Intronic
1142145715 16:88492174-88492196 AGAGAGAGAGAAAGAGAGGCAGG - Intronic
1142216673 16:88833423-88833445 AGAGAGAAGGAAAGAAAGGGAGG - Intronic
1142287788 16:89178469-89178491 TGGGAGAAGAAGAGTGAGGCTGG + Intronic
1142379048 16:89721501-89721523 AGCGAGAAGCAAAGCGAGGCGGG - Intronic
1203141197 16_KI270728v1_random:1767920-1767942 TGTGAGAAGCTCAGAGAGGCTGG - Intergenic
1143011766 17:3869895-3869917 AGGGCGAAGGAAGGAGAGGAGGG + Intronic
1143039858 17:4026031-4026053 AGGGAGATGCAGAGAGAGAGGGG + Intronic
1143156830 17:4842737-4842759 AGCGTGAGGCAAAGATAGGCAGG + Intronic
1143373169 17:6453025-6453047 AGGGAGAAAGAAAGACAGGAAGG - Exonic
1143393195 17:6572538-6572560 ACAGAAATGCAAAGAGAGGCCGG - Intergenic
1143624278 17:8100108-8100130 AGAGAGAAAGAAAGAGAGGGAGG + Intronic
1143679272 17:8464341-8464363 AGGGAGCAGCAAAGAGCCACAGG - Intronic
1143702831 17:8674293-8674315 AAGGAGGAGAAAAGAGAGACTGG - Intergenic
1143703134 17:8676268-8676290 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1144029201 17:11304495-11304517 AGAGAGAAGCAAAGGGCGGGTGG + Intronic
1144098607 17:11924012-11924034 GGGGAGAAGCTAAGAGTGGATGG - Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144190748 17:12843240-12843262 GGGGAGAAACAGAGGGAGGCAGG - Intronic
1144283353 17:13748842-13748864 AGGGAGAAGCGTTGAGAGGAAGG - Intergenic
1144377626 17:14661190-14661212 AGGGAGGAAAAAAGAAAGGCAGG + Intergenic
1144742280 17:17590788-17590810 AGGGAGAATGCAAGAGAGGTTGG + Intronic
1144837058 17:18162013-18162035 AGAGAGAAGCATTCAGAGGCAGG - Intronic
1145302418 17:21649896-21649918 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1145347902 17:22053416-22053438 AGGAAGAAGCAGAGGGAGGGAGG + Intergenic
1145415691 17:22711966-22711988 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1145722750 17:27088816-27088838 TGGGAGGAGGAAAGAGAGGAAGG - Intergenic
1146093078 17:29901751-29901773 AGGGAGAAAGAAAGGGAGGAAGG - Intronic
1146299336 17:31676140-31676162 AGGGAGAAAAAGAGAGAGGGAGG + Intergenic
1146516798 17:33495765-33495787 ATGGAGAAGCATAGGGAGCCAGG + Intronic
1146941160 17:36845411-36845433 GGGGAGAAGGAAAGAGAATCAGG + Intergenic
1147119264 17:38326252-38326274 AGTTAGAAGTAAAGAGAGGGTGG + Exonic
1147228231 17:38997662-38997684 AGGGAGAAAGAGAGAGAGGAAGG - Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147325906 17:39669523-39669545 AGGAAGAACTAGAGAGAGGCAGG + Intronic
1147405342 17:40207653-40207675 AAAGAAAAGAAAAGAGAGGCTGG - Intergenic
1147438579 17:40432842-40432864 AGGGAAAAACCAAGAGAGGGAGG - Intergenic
1147539476 17:41345109-41345131 AGGCAGGAACAAAGAGAGGAAGG + Intergenic
1147658824 17:42106207-42106229 AGAGAGAAGGAAAGAAAGGGAGG + Intronic
1147699882 17:42387352-42387374 AGAGGGAAACAAAGACAGGCTGG - Intronic
1147766199 17:42838016-42838038 AGGGAAAATGAGAGAGAGGCAGG + Intronic
1147854483 17:43468466-43468488 TGGGAGCAGCAAAGGGAGACTGG + Intergenic
1148014215 17:44509681-44509703 AGAGAGAAAGAAAGAGAGGAAGG + Intergenic
1148211690 17:45812717-45812739 AGGAAGAAATAGAGAGAGGCAGG - Intronic
1148529819 17:48378913-48378935 AGGGACAAGCTTGGAGAGGCAGG + Intronic
1148554872 17:48572502-48572524 AGGGAGAAGATATGAGAGGTTGG - Intronic
1148562694 17:48614840-48614862 AAGGAGAGGGAAAGAGAGGAGGG + Exonic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149165493 17:53747017-53747039 AGGAAGATGCATAGAGAGGGAGG + Intergenic
1149220669 17:54412643-54412665 AGGTAAAAGCAAAGAGAGGCTGG - Intergenic
1149485883 17:57042459-57042481 AGGGAGAAAGAAAGGGAGGAAGG - Intergenic
1149559318 17:57596827-57596849 AAGAAAAAACAAAGAGAGGCGGG - Intronic
1149664320 17:58355087-58355109 AGGGAGAAGCAGAGACTGTCTGG + Intronic
1150047834 17:61930742-61930764 AAGGAAAAAAAAAGAGAGGCTGG - Intergenic
1150449474 17:65254322-65254344 GGGGAGAAGCCAAGAAAGGGTGG + Intergenic
1150477775 17:65487800-65487822 AGGGAGAGGGAAAGAGAGAGAGG + Intergenic
1150477807 17:65487918-65487940 AGGGAGAAAGAGAGAGAGGGAGG + Intergenic
1150477845 17:65488076-65488098 AGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1150478006 17:65488668-65488690 AGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1150478093 17:65489032-65489054 AGGGAGAGGAAGAGAGAGGAAGG + Intergenic
1150548510 17:66187751-66187773 CTGGAGTTGCAAAGAGAGGCTGG - Intronic
1150654713 17:67032266-67032288 AGGGGGAAGAAAAGAATGGCTGG - Exonic
1150880587 17:69021692-69021714 AGGGAGAAAGAAAGAAAGGAAGG - Intronic
1150918496 17:69459945-69459967 AGGGAGAAGGAAAGGAAGGAAGG - Intronic
1151201050 17:72468197-72468219 AGGGAGAGGGAGAGAGAGGGAGG + Intergenic
1151300824 17:73224031-73224053 AGGGAGAAAGGAAGAGAGGAAGG + Intronic
1151342441 17:73480675-73480697 AGGGAGAAAGAGAGAGAGACAGG + Intronic
1151430709 17:74060631-74060653 AGGGAGAAGGATAGAGAGGGAGG - Intergenic
1151622662 17:75255859-75255881 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1151635349 17:75343824-75343846 AGGGAGAAGAAAGGAGAGGAAGG + Intronic
1151812342 17:76452181-76452203 AGGGTAAAACAAAAAGAGGCTGG + Intronic
1151839572 17:76608379-76608401 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1151886679 17:76926816-76926838 CTGGAGAAGGAAAGAGAGGGAGG - Intronic
1151930706 17:77229920-77229942 TGGGAGAAGCCAAGAGGAGCTGG - Intergenic
1152077376 17:78168151-78168173 AGAGAGGAGGAAAGAGTGGCAGG + Intergenic
1152322806 17:79617626-79617648 AGGGAGAAGCAGAGAAAGACAGG - Intergenic
1152441370 17:80312263-80312285 AGGGAGGAGGAAGGAGAGGGAGG + Intronic
1152622872 17:81373977-81373999 AGGAATAAGCAAAGAGACCCTGG + Intergenic
1152814007 17:82397017-82397039 AGGGAGCAGCTGAGGGAGGCAGG + Intronic
1152993536 18:384853-384875 ATGGATAAGCACAGATAGGCTGG + Intronic
1153850957 18:9093838-9093860 AAGGAGAAAGAAAGAGAGGTGGG - Intergenic
1153881542 18:9425703-9425725 AGGTAAAAGCAAAGAGAGGCTGG + Intergenic
1153930066 18:9870442-9870464 AGTGAGAAGGGAAGAGAGGGTGG - Intergenic
1154489182 18:14906225-14906247 AGGGAGAGGCAGAGACTGGCAGG - Intergenic
1155096499 18:22560501-22560523 AGTGAGAATAAAATAGAGGCTGG + Intergenic
1155644863 18:28064948-28064970 AAGGACAAGCTGAGAGAGGCAGG - Intronic
1155696845 18:28695536-28695558 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1155725633 18:29078699-29078721 AAGGAGATGCAAAGAGACACAGG + Intergenic
1156915985 18:42464856-42464878 AGGTAAAAGCAAGGAGTGGCTGG - Intergenic
1157314513 18:46576496-46576518 AGGGAGAGGAAAAGGGAGGGTGG - Intronic
1157429328 18:47611628-47611650 AGGGAAAAGCAGAGGAAGGCAGG + Intergenic
1157475027 18:48018445-48018467 AGGCAGAAGCTAAGAGGGTCAGG + Intergenic
1157545565 18:48544153-48544175 AGGGAGAAGGACAGAAAGGTTGG + Intronic
1157584642 18:48793247-48793269 AGGGAGAAGCAGGGAGGGGCAGG + Intronic
1157814729 18:50722363-50722385 AGGATGAAGGAAAGAGAGGGAGG - Intronic
1158314361 18:56194457-56194479 AGGGAGAAAGAAAGAAAGGAAGG - Intergenic
1158442133 18:57485690-57485712 ACAAAGAAGCAAAGAGAGGAAGG + Exonic
1158565009 18:58547439-58547461 AGGGAGAAGGAAAGAGACCAGGG - Intronic
1158712839 18:59852701-59852723 AGGGAGAAAGAAAGAAAGGGAGG - Intergenic
1159122084 18:64182879-64182901 AGGGAGAGGCAGAGGGAGGGAGG - Intergenic
1159682889 18:71377075-71377097 AGAGAGAAGAAAAGACAGGTGGG - Intergenic
1160498592 18:79389930-79389952 AGGGGGAGGCAGAGGGAGGCAGG + Intergenic
1160957682 19:1701249-1701271 AGGGGGGAGCAAAGAGAGAGAGG - Intergenic
1161029106 19:2049848-2049870 TGGGAGGAGCAAAGAGAGACTGG - Intronic
1161075678 19:2284327-2284349 AGGGTAAGGCAAAGAGAAGCAGG + Intronic
1161251233 19:3281418-3281440 AGGGAGATGGAGGGAGAGGCAGG - Intronic
1161458131 19:4380172-4380194 AGGAAGAAGCAAGGAAAGGAGGG - Intronic
1161468384 19:4444560-4444582 AGGGTGAATCAGAGAGAGACTGG - Intronic
1161661907 19:5551762-5551784 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1161702470 19:5803006-5803028 TGTGAGAAGGAAAGATAGGCCGG + Intergenic
1161712293 19:5855707-5855729 AGGTAAAAGCAAAAAGAGGCTGG - Intergenic
1161756673 19:6138804-6138826 GGGAAGAAGCAAAGGGAGGAAGG + Intronic
1162048993 19:8020851-8020873 AGGGAAAAGAAAAGAAAGGAAGG - Intronic
1162104702 19:8363403-8363425 AGGAAGAAGGAAAGAAAGGAAGG - Intronic
1162215071 19:9127394-9127416 AGAGAGAAAGAAAGAGAGGGGGG - Intergenic
1162315829 19:9937304-9937326 AGTGAGAGGCAGAGAAAGGCTGG - Intergenic
1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG + Intronic
1162717057 19:12640786-12640808 AGAGAAAAGGAAAAAGAGGCCGG + Intergenic
1162986942 19:14276983-14277005 AGGAAAAAGCAAGTAGAGGCTGG - Intergenic
1163203825 19:15787784-15787806 AGGGAGAAGGCAAGAGAAGCAGG + Intergenic
1163207188 19:15812411-15812433 AGGGAGGAAGAAAGAGAGGGAGG + Intergenic
1163207362 19:15813507-15813529 AGGGAGAAACAGAGAGAGAGAGG + Intergenic
1163565242 19:18047233-18047255 AGATAAAATCAAAGAGAGGCCGG - Intergenic
1163667796 19:18611240-18611262 GGAGAGAAGCAAAGAAAAGCCGG - Intronic
1163779788 19:19240173-19240195 AGGGAGAAGGAGAGAGATGAGGG - Intronic
1163900038 19:20093042-20093064 AGGTGAAAGCAAAGAGAGGCTGG + Intronic
1164003915 19:21132207-21132229 AGGTAAAAGCAAAGAGAGGCTGG + Intergenic
1164153153 19:22571532-22571554 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1164434337 19:28216348-28216370 AGAGAGAGGGAAAGAGAGGCTGG - Intergenic
1164509242 19:28883972-28883994 AAAGAGAAGGAAAGAGAGGAGGG - Intergenic
1164526210 19:29015420-29015442 AGAGAGAAGGAAAGAGAGAGAGG - Intergenic
1164526312 19:29016043-29016065 AGAGAGGAGGAAAGAGAGGGAGG - Intergenic
1164537991 19:29100658-29100680 AGGGAGAAGCTGAGAGAAGATGG - Intergenic
1164548678 19:29189828-29189850 AGGAAGAGGCACAGAGAAGCTGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164916818 19:32058528-32058550 AGGGTGAAGTAAAGAGATGGAGG + Intergenic
1165249420 19:34517282-34517304 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1165331734 19:35144105-35144127 AGAGAGAAGCAGAGAGACGGAGG + Intronic
1165387513 19:35519510-35519532 AGGGAGAAACACAGAGAGGAAGG - Intergenic
1165393063 19:35549391-35549413 AGGGAGGAGCAAAGAGTTCCAGG + Intergenic
1165598402 19:37031463-37031485 AAAGAGAAGCAAGGAGAGGATGG - Intronic
1165757223 19:38300970-38300992 AGGGAGAGGGGAGGAGAGGCGGG - Intronic
1165835535 19:38752898-38752920 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1166052452 19:40268387-40268409 AGAGAGAAGCAAAGGCAGCCAGG + Intronic
1166159212 19:40939139-40939161 AGGGAGAAGGAGAGGGAGGGTGG + Intergenic
1166175141 19:41062685-41062707 AGAGAGAAGAACAGAGAGACTGG - Intergenic
1166275099 19:41748049-41748071 AGGGAGAAAGAAAGAGAGAGAGG + Intronic
1166319503 19:42007612-42007634 AGGGAGCTGCAAAGAGAGGGAGG + Intronic
1166344037 19:42154220-42154242 AGAGAGACACAAACAGAGGCAGG + Intronic
1166350367 19:42195112-42195134 AGGGAGGAACGAAGAGAGGGAGG + Intronic
1166353296 19:42211390-42211412 AGGGAGAAGAAAAGGAAGGAAGG + Intronic
1166498761 19:43325929-43325951 AAGTGAAAGCAAAGAGAGGCGGG + Intergenic
1166532552 19:43551810-43551832 TGGGAGAAACAAAAAGAGGTTGG + Intronic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1166852948 19:45769048-45769070 AGGGAGAATCACAGACAGACGGG - Exonic
1166982367 19:46638921-46638943 AGGGAGAGTCAGAGAGACGCAGG + Intergenic
1167198010 19:48044034-48044056 AAGGAGAAGCCAAGAGAGGCAGG - Exonic
1167609299 19:50499179-50499201 AGGGAGACGGAGAGAGAGACAGG + Intergenic
1167734668 19:51286294-51286316 AGGGAGAGGGAGAGAGAGTCGGG - Intergenic
1167792726 19:51691220-51691242 AGGGAGACCCAAAGAGAGAAGGG + Intergenic
1167901283 19:52624018-52624040 AGGTAAAAGCAAAGAGGGGCTGG - Intronic
1168169358 19:54575656-54575678 AGGGAGAGACAGAGAGAGACAGG + Intronic
1168283962 19:55321320-55321342 TGGGAGGTGCAAGGAGAGGCTGG - Intronic
1168302173 19:55411396-55411418 AGGATGAAGCAAAGAGAGCATGG - Intergenic
1168450846 19:56465592-56465614 AGGTGGAAGCACAGAGAGGGAGG + Intronic
1168659687 19:58155884-58155906 AGGGAGAAAGAGAGAGAGGAAGG + Intergenic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
925115553 2:1375484-1375506 GGGGAGAAGGAAAAAGAGGGAGG + Intronic
925149751 2:1606945-1606967 AGGGAGAAAGGAAGAGAGTCTGG - Intergenic
925225917 2:2184068-2184090 AGAGAGAAACAGAGAGAGGGAGG + Intronic
925541443 2:4972002-4972024 AGGGAGGAACTAAGAGAGGGAGG - Intergenic
925601323 2:5611281-5611303 AGGGAGGAAAAAAGAGAGACAGG + Intergenic
925686908 2:6482225-6482247 AGAGAGCAGCACAGATAGGCAGG - Intergenic
925721522 2:6833088-6833110 AGAGAGAAAGAAAGAGAGGGAGG + Intergenic
925828645 2:7875097-7875119 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
925942357 2:8833182-8833204 AGGGAGTGATAAAGAGAGGCTGG - Intronic
926145415 2:10394248-10394270 ATGGAGAAGGAAAGAGACTCCGG - Intronic
926159952 2:10480896-10480918 AGGGAGAAAGAGAGAGAGGGAGG - Intergenic
926210179 2:10863403-10863425 AGGGAGAGGATAAGATAGGCAGG + Intergenic
926332333 2:11835829-11835851 AGGGAGAAAGAAAGAAAGGAAGG - Intergenic
926459759 2:13114444-13114466 AGAGAGAAGGAAAGAGAGAGAGG + Intergenic
926463772 2:13165348-13165370 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
926815370 2:16794359-16794381 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
926819976 2:16841284-16841306 AGTGAGAAGAAAAGAGGGCCAGG - Intergenic
926846803 2:17150019-17150041 AGGGAGAAGCAGAGGGAAGCGGG + Intergenic
926883492 2:17574968-17574990 AGAGAAAAGAAAAGAGAGGAAGG - Intronic
926910583 2:17849125-17849147 AGGGAGAAAGACAGGGAGGCAGG + Intergenic
926974043 2:18495457-18495479 AGGAAGGAGAAAAGAGAGGAAGG - Intergenic
927090892 2:19711727-19711749 AGGAAGAAGAGAAGAGAGGAAGG + Intergenic
927134334 2:20085600-20085622 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
927639541 2:24838067-24838089 AGGGAGAGGCTCAGAGAGGAGGG - Intronic
927678983 2:25127753-25127775 AGGGAGAGGCACAGAGCTGCAGG - Intronic
927734296 2:25504439-25504461 AGAGAGAAGGAAAGAAAGGAAGG + Intronic
927873721 2:26640498-26640520 TGGGAGAAGGAAAGAGGGGCGGG + Intronic
928084361 2:28336559-28336581 AGGGAGAGGTAGAGAGAGGCAGG + Intronic
928125000 2:28609214-28609236 AGAGAAAAGAAAACAGAGGCCGG - Intronic
928334295 2:30382929-30382951 AGGGAGAAGAGATGGGAGGCAGG - Intergenic
928684233 2:33731818-33731840 AGCCAGAACCAAAGACAGGCAGG - Intergenic
928706224 2:33952606-33952628 GGGAAGAAGAAAAGAGAGACTGG - Intergenic
928770640 2:34699514-34699536 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
928779538 2:34803387-34803409 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
928972786 2:37049309-37049331 AGGGACAAGGAAAGGGAGGGAGG + Intronic
929004665 2:37383421-37383443 AGGTGAAAGCGAAGAGAGGCTGG + Intergenic
929076501 2:38083188-38083210 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
929080071 2:38113671-38113693 AGGGAGAACCAAAGAGGTGAGGG + Intergenic
929173729 2:38957152-38957174 AGGTAGAAGGAAAGAGAGAAGGG + Intronic
929401868 2:41592216-41592238 AGGGAGGAAAAAAGAGAGGGAGG + Intergenic
930098897 2:47588087-47588109 AGGTAAAAGCAAAGAGAGGCTGG + Intergenic
930159342 2:48138189-48138211 AGAGAGAAGGAAAGAGAGGGGGG + Intergenic
930615098 2:53585292-53585314 GGGGAGAGGCAAAGACATGCAGG - Intronic
930741254 2:54835035-54835057 AGGGAGAAGCAGCGAGGGGAAGG - Intronic
930955271 2:57196247-57196269 AAGCGAAAGCAAAGAGAGGCTGG - Intergenic
931385646 2:61795483-61795505 AGAAAGAAACAAAGAGAGGGAGG + Intergenic
931469418 2:62523367-62523389 AGAGAGAAGCATAGAGGTGCAGG - Intergenic
931686156 2:64795955-64795977 AGGTACAACCAATGAGAGGCTGG - Intergenic
931717531 2:65040914-65040936 AGGGACAAGGAAAGAGAGGGTGG - Intergenic
931913746 2:66930433-66930455 AGGGAAAAGCAGTGAGAGGTTGG + Intergenic
932022242 2:68099105-68099127 AGGGAGAGGGAAAGAGAGCAAGG - Intronic
932159275 2:69446075-69446097 AGGTAAAAGCAAAGAGAGGCTGG + Intergenic
932311027 2:70741163-70741185 TGGGAGACGGAAAGAGAGTCAGG + Intronic
932335461 2:70928564-70928586 TGGGTGTAGCAAGGAGAGGCGGG - Intronic
932336658 2:70935672-70935694 AGGGAGAAGGGAAGAGGGGAGGG - Intergenic
932367069 2:71160360-71160382 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
932417907 2:71584739-71584761 GGGGAGAAGCTGGGAGAGGCTGG + Intronic
933229252 2:79787033-79787055 AGGGTGAAGAACACAGAGGCAGG - Intronic
933234542 2:79850374-79850396 AGGGAGAAACAAACAGAGGGAGG - Intronic
933248012 2:79997306-79997328 AAGGAGAAAAAAAGAGAGGGAGG + Intronic
933337356 2:80975513-80975535 AAGGAGAAGGAAAGAAAGGAAGG - Intergenic
933552221 2:83791328-83791350 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
933713688 2:85345204-85345226 AGGGTGAAGGAAGGAGAGGCTGG + Intronic
933746670 2:85576865-85576887 GGTAAGAAGCAAAAAGAGGCCGG - Intronic
934626162 2:95855891-95855913 CTGGAGAAGCAAAGAGAGAGCGG - Exonic
934639881 2:96021473-96021495 AGTGAAAAGCAAAGAGAGCAAGG + Intergenic
934729410 2:96647153-96647175 AAGGTGAGGCAGAGAGAGGCAGG + Intergenic
934781279 2:96971254-96971276 GGGGAGAAGGAGAGAGAGGGAGG - Intronic
934793768 2:97083918-97083940 AGCGAAAAGCAAAGAGAGCAAGG - Intronic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935192113 2:100786592-100786614 AGGCAGAAGCAAAAAGCAGCAGG - Intergenic
935302858 2:101708479-101708501 AGGAATAAGGAAAGTGAGGCAGG + Intronic
935337548 2:102031153-102031175 AGGGAGAAGTACGGAGGGGCCGG + Intergenic
935363961 2:102270259-102270281 AGGCAGGAGCAGAGAGAGGGAGG - Intergenic
935708127 2:105873796-105873818 AGGGAGAGGCTCAGAGAGACAGG - Intronic
935728550 2:106045520-106045542 AGGGAGAAGGCATGAGAGACGGG - Intergenic
936472614 2:112812377-112812399 AGGGAAAGGTAAAGAGAGTCAGG - Intergenic
936544572 2:113379942-113379964 AGGGAGAAGCACAGATAGAAAGG - Intergenic
936611345 2:114004973-114004995 AGAGAGAAGCTGAGCGAGGCAGG - Intergenic
937048064 2:118863333-118863355 GGAGAGAAGCAAGGAGAGGCTGG + Intergenic
937065237 2:119012463-119012485 AGTGAGAAGAGAAGAGAGCCAGG + Intergenic
937264231 2:120606009-120606031 AGGGATAGGGAAAGAGAAGCTGG + Intergenic
937302095 2:120848805-120848827 AGGAAGAAGGAAGGAGTGGCAGG + Intronic
937355596 2:121196315-121196337 TTGGAGCAGCCAAGAGAGGCAGG + Intergenic
937594828 2:123660533-123660555 AGGTAAAAGCAAAGAAAGGCTGG + Intergenic
937666269 2:124490364-124490386 AGAGAGAAAGAAAGAGAGGGAGG + Intronic
937709955 2:124969233-124969255 AGGGGAGAGCAAAAAGAGGCAGG + Intergenic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
937982667 2:127624464-127624486 AGGGAGGAGGAAACAGAGGCTGG - Intronic
938287548 2:130130048-130130070 AGGGAGGAGGAAAGAGAGGGTGG + Intergenic
938313280 2:130308782-130308804 AGGGAGAAGGAAAGAGAAGGAGG + Intergenic
938428044 2:131208811-131208833 AGGGAGGAGGAAAGAGAGGGTGG - Intronic
938468954 2:131542823-131542845 GGGGAGGAGGAAAGAGAGGATGG - Intergenic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
938656697 2:133442208-133442230 AGGAAGGAAGAAAGAGAGGCAGG + Intronic
938698924 2:133859171-133859193 AAGGAGAAGCTGAGATAGGCAGG - Intergenic
938949953 2:136246238-136246260 AGGGAGAGGCAGAGGGAAGCCGG + Intergenic
939031563 2:137081949-137081971 AGGGAGAAGAAATTAGAGGAGGG - Intronic
939082976 2:137685363-137685385 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
939095921 2:137833253-137833275 AGAGAGAAGGATAGAGAGGAAGG - Intergenic
939490779 2:142874023-142874045 AGGGAGAAGAAAGGAGAGTATGG + Intergenic
939631515 2:144531511-144531533 AGGGGGGAGCAAAAAGAGGGCGG - Intergenic
939806952 2:146785595-146785617 AGGGAGAATTAAAGGGATGCAGG - Intergenic
939833593 2:147101626-147101648 AGGGAGTAAGAAAGAGAGGAAGG + Intergenic
940164734 2:150757868-150757890 AGAGAAAAACAAAAAGAGGCAGG - Intergenic
940179731 2:150918634-150918656 AAGGAAAAGAAAAGAGAGGAGGG + Intergenic
940183870 2:150961594-150961616 AGGTAAAAGCAAAGAGAGGCTGG - Intergenic
940373030 2:152923223-152923245 AGGGAGAGAGAAAGTGAGGCAGG - Intergenic
941273210 2:163456758-163456780 AAGGAGAAGCAAAGAGGAGGGGG + Intergenic
941353561 2:164462401-164462423 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
941456022 2:165712923-165712945 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
941970207 2:171341932-171341954 AGGGAGAGGAAAGGAGTGGCTGG + Intronic
942131568 2:172885281-172885303 AGGGAGGAGGAAAGTGAGGCAGG - Intronic
942131573 2:172885301-172885323 AGGGAGGAGGAAAGTGAGGCAGG - Intronic
942159804 2:173172184-173172206 AGAGAGAAACAAAGATAGGTGGG + Intronic
942450656 2:176106482-176106504 AGAGAGAAGGGAAGAGAGCCGGG + Intronic
942730117 2:179054182-179054204 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
943784003 2:191856552-191856574 AGGCAGAAGCAAGGAGATACCGG + Intergenic
943835569 2:192510762-192510784 AAGCGAAAGCAAAGAGAGGCTGG - Intergenic
944090509 2:195904700-195904722 AGGGAGCAGCAAGGTGTGGCAGG + Intronic
944141451 2:196461175-196461197 AGGGAGAAAGAAAGGCAGGCAGG + Intronic
944251204 2:197581392-197581414 AGATAAAAGCAAACAGAGGCTGG - Intronic
944294634 2:198048604-198048626 AGGGAGAAGGAGAGAGAGTGGGG + Intronic
944394316 2:199250218-199250240 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
944526833 2:200627903-200627925 AGGGAGAATCAGAGAGAGAAAGG - Intronic
945173628 2:207020535-207020557 AAGTGGAAGCAAAGAGAGGTTGG - Intergenic
945219630 2:207470460-207470482 AAGTAACAGCAAAGAGAGGCAGG - Intergenic
945284241 2:208066132-208066154 AGGGAGAAGCAGAAAAAGCCAGG + Intergenic
945301313 2:208218658-208218680 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
945361810 2:208902515-208902537 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
945394469 2:209302494-209302516 AAGAGAAAGCAAAGAGAGGCTGG - Intergenic
945438332 2:209845925-209845947 AGAGAGAAGGAAAGAAAGGAAGG - Intronic
945500589 2:210568414-210568436 AGGTAGAAGTAAGGAGAGACTGG + Intronic
945644324 2:212470274-212470296 GTGAAGAAGCACAGAGAGGCTGG - Intronic
945851258 2:215010452-215010474 AGGGAGAAGCAAAATGGTGCTGG + Exonic
946057848 2:216917226-216917248 AGGAAGAAGGGAAGAGGGGCTGG + Intergenic
946141778 2:217697363-217697385 AGGGAGAAGAAAAGAGAAGATGG - Intronic
946214859 2:218176437-218176459 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
946459138 2:219853498-219853520 AGGTAGAAGAAAAGAGACGTGGG + Intergenic
946462585 2:219882229-219882251 AGAGAGAAAGAAAGAGAGGGAGG - Intergenic
946780870 2:223192258-223192280 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
946849354 2:223890017-223890039 AGGGATACACAGAGAGAGGCAGG - Intronic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947710652 2:232313502-232313524 AGGGAGCAGTAAAGAGAGCATGG - Intronic
947813094 2:233016581-233016603 AGAGAGAGGGAGAGAGAGGCAGG - Intergenic
948057433 2:235019076-235019098 AGGAAGGAGCAAAGTCAGGCAGG + Intronic
948080141 2:235198999-235199021 AGAGAGAAGGAAAGAGGAGCAGG + Intergenic
948082725 2:235219897-235219919 AGGGTGAAGAAATGAGAGGATGG + Intergenic
948390867 2:237610238-237610260 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
948512269 2:238476517-238476539 AGAGAGGAGCAAAATGAGGCCGG + Intergenic
948741703 2:240052335-240052357 AGGAAGAAGAAAAGAGAAGCAGG + Intergenic
1168826756 20:819327-819349 AGGGAGAGACAGAGAGAGGGAGG - Intergenic
1168980199 20:1997386-1997408 ACAGAGAAGGAAACAGAGGCTGG + Intergenic
1169645587 20:7806174-7806196 TGGGAAAAGCAGAGAGAGGTTGG - Intergenic
1169825629 20:9765654-9765676 AGGGAGAAGCAGGGAGAGGGCGG - Intronic
1169920622 20:10730965-10730987 AGGGAAAAGGAAAGGGAGGAAGG - Intergenic
1169972945 20:11289896-11289918 AGGGAGATACAAAGAGAGCCAGG - Intergenic
1170243818 20:14198239-14198261 AGGGAAGAGCAAGGAGATGCTGG + Intronic
1170398408 20:15953142-15953164 AGGCAGAAGCCAAGAAAGGTTGG + Intronic
1170405621 20:16032748-16032770 AGGGAGGAGGGAAGAGAGGAAGG + Intronic
1170589001 20:17757023-17757045 AGGGAGAAGCAGAAAGATACGGG - Intergenic
1170680264 20:18520024-18520046 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1170888832 20:20363199-20363221 AGAGAGAAGGAAAGAGAGAAGGG + Intergenic
1171096368 20:22336037-22336059 AGGGAGGGACAGAGAGAGGCAGG - Intergenic
1171370939 20:24661546-24661568 AGGGAGGAAAAAAGAGAGGAAGG + Intronic
1171431670 20:25086669-25086691 AGTAAGAAGCCAAGAGAGGTTGG - Intergenic
1171807306 20:29690901-29690923 AGGGAGAAGAGAGCAGAGGCCGG - Intergenic
1172228757 20:33323074-33323096 AGGAAGAAATAAAGAGAAGCAGG + Intergenic
1172687759 20:36769957-36769979 AGAGAGAAAGAAAGTGAGGCGGG + Intronic
1172696461 20:36826364-36826386 AGGGAGAAGGAGAGGGAGGGGGG - Intronic
1172804686 20:37603430-37603452 AGGAAGAAACAAAGAAAGGAAGG - Intergenic
1172932293 20:38595134-38595156 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1172947659 20:38701565-38701587 AGGGAGTAGGAAAGGGAGACCGG - Intergenic
1173020977 20:39268159-39268181 AGGGAGAAGGGAAGAGAGAGAGG + Intergenic
1173114802 20:40230932-40230954 AAGGAGAAGCAAGGAAAGGAAGG + Intergenic
1173181075 20:40806806-40806828 AAAAAGTAGCAAAGAGAGGCTGG - Intergenic
1173213240 20:41054311-41054333 AGTGTGAAGCAAAGTGGGGCAGG - Intronic
1173365587 20:42381700-42381722 AGGGAGAAGAAAAGAGAAGGAGG + Intronic
1173579829 20:44139191-44139213 ATGGAGAACCACAGAGGGGCAGG + Intronic
1173652218 20:44673647-44673669 AGGTAAAAGCAAAGAGAGGCTGG - Intergenic
1173767750 20:45629642-45629664 AGGGGCAAGCAAAAAGAGGAAGG + Exonic
1173781891 20:45762951-45762973 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1173939948 20:46902113-46902135 AGGGGGAAGCACAGAGAGGTTGG + Intronic
1174062778 20:47844236-47844258 AGGAAGAAACAAAGAAAGGAAGG + Intergenic
1174342533 20:49906855-49906877 AGGGAGTAGAAAAGAAAGGTGGG + Intronic
1174423489 20:50415972-50415994 AGAGAGAAGGAAACAGAGGGAGG + Intergenic
1174775681 20:53341165-53341187 AAGGACAAGCAAACTGAGGCAGG - Intronic
1175264872 20:57696385-57696407 AGGGAGAGTCACAGAGAAGCGGG - Intronic
1175695162 20:61097753-61097775 AGAGAGAAAGAAAGAGAGGAAGG + Intergenic
1175772508 20:61632639-61632661 GGGGAGATGGAAAGAGAGGTGGG - Intronic
1175785991 20:61712131-61712153 ACTGAGAAGCCAGGAGAGGCTGG + Intronic
1175938060 20:62524076-62524098 AGGGAGCATCAAAGGGAGGGTGG - Intergenic
1175984832 20:62759425-62759447 AGGCAGCTGCAAGGAGAGGCAGG + Intronic
1176031684 20:63015971-63015993 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031687 20:63015981-63016003 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031690 20:63015991-63016013 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031693 20:63016001-63016023 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176031696 20:63016011-63016033 AGGGAGAGGCAGGGAGAGGCAGG - Intergenic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176843278 21:13857464-13857486 AGGGAGTAGCAGACAGAGGTCGG - Intergenic
1176982531 21:15399626-15399648 AGGGAGAAAGAAAGAGAGAGAGG + Intergenic
1177100796 21:16895451-16895473 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1177102847 21:16917279-16917301 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1177144994 21:17397800-17397822 AGGGAGAAGGGAAGGGAGGGAGG + Intergenic
1177160710 21:17545115-17545137 AGGGAGAGGAAGAGAGAGGCAGG + Intronic
1177306895 21:19330264-19330286 AAGGATAACCAAAGAGAGGAGGG - Intergenic
1177362378 21:20089610-20089632 AGGAAGTAGTAAAAAGAGGCAGG - Intergenic
1177564989 21:22808884-22808906 AGGGGGAAGAAAAGAGAGGGAGG - Intergenic
1177684350 21:24417376-24417398 AGGGAGACAGACAGAGAGGCAGG - Intergenic
1177930473 21:27276821-27276843 AGTGAGAAAGAGAGAGAGGCCGG + Intergenic
1178001366 21:28164492-28164514 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1178050677 21:28743585-28743607 AGGGAGAATGGAAGAGAGGAAGG + Intergenic
1178151925 21:29805020-29805042 AAGGAAAAACAAATAGAGGCTGG - Intronic
1178600686 21:33991987-33992009 AGGGAGAAGCAGAAAGGTGCAGG + Intergenic
1178831930 21:36063446-36063468 AGAGAGAAGGAAAGAGAGAGAGG - Intronic
1178832818 21:36070497-36070519 AGGGAGGAGCTAGGAGATGCAGG + Intronic
1178897987 21:36576534-36576556 TGGGAAAAGCTGAGAGAGGCAGG - Intronic
1179221395 21:39410850-39410872 AGCCAGAAGCAAACAAAGGCAGG + Intronic
1179506668 21:41845587-41845609 AGGGATGAGTAAACAGAGGCAGG - Intronic
1179936557 21:44609546-44609568 AGGGAGCAGCCAATAGAGACTGG + Intronic
1180280644 22:10690582-10690604 AGAGAGAAGCCAACAGAAGCTGG - Intergenic
1180315032 22:11270654-11270676 AGGGAGAAAATAAGAAAGGCAGG + Intergenic
1180317169 22:11285313-11285335 AGGAAGAAGCAAACAAAGGAAGG - Intergenic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1181335070 22:22123218-22123240 TGGGAGGAGTAAAGAGAGGTTGG - Intergenic
1181396770 22:22628631-22628653 ACAGAGAAGCAAAGGGCGGCGGG - Intergenic
1181499464 22:23307679-23307701 ACAGAGAAGCAAAGGGCGGCGGG - Intronic
1181581706 22:23832405-23832427 TGGGAGAAGCAAGGGCAGGCCGG - Intronic
1181704893 22:24644189-24644211 ACAGAGAAGCAAAGGGCGGCGGG - Intergenic
1181885262 22:26017068-26017090 AGGGAGAGGCACAGAGAGGAAGG - Intronic
1181890482 22:26058700-26058722 AGGAAGAAAGAGAGAGAGGCAGG - Intergenic
1182158992 22:28103165-28103187 AGGCAGAAGCAGAGAGAAGCTGG - Intronic
1182595239 22:31414645-31414667 AGGGGGAAAAAAAGAGTGGCTGG - Intronic
1182732457 22:32506060-32506082 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1183015584 22:34983862-34983884 AGAGACAAGAAAAGAGAAGCAGG + Intergenic
1183090068 22:35516123-35516145 AGGGAGAAAGAAAGAGAAGAAGG - Intergenic
1183153172 22:36053779-36053801 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183153185 22:36053810-36053832 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183197487 22:36363446-36363468 AGGGAGAGACAGAGGGAGGCAGG + Intronic
1183329629 22:37212365-37212387 GGAGAGATGCAGAGAGAGGCAGG + Intergenic
1183336194 22:37248174-37248196 AGGGAGAAACAGGGAGAGGTGGG - Intergenic
1183530087 22:38348655-38348677 AGGGACAACCCAAGAGAGTCAGG - Intronic
1183565789 22:38614226-38614248 AGGGAGATGAAAAGAGCAGCAGG - Intronic
1183597820 22:38822875-38822897 AGGGAGCAGAAAAGACAGGCAGG + Intronic
1183635485 22:39059899-39059921 AGGTAAAAGCAAAGAGAGGCTGG + Intronic
1183636648 22:39067704-39067726 AGGTAAAAGCAAAGAGAGGCTGG + Intronic
1183655673 22:39183392-39183414 AGAGAGGAGCTAAGAGAGGGAGG - Intergenic
1183746469 22:39694753-39694775 AGGGAGAGACAGAGAGAGGGAGG - Intergenic
1184277739 22:43419753-43419775 AGAGAGAGGCACAGAGAGGTGGG + Intronic
1184426328 22:44411193-44411215 GGGGAGAAGCACAGAGTGGACGG - Intergenic
1184535275 22:45082419-45082441 AGGGAGAAGCGAAGGGAGTCAGG + Intergenic
1184649671 22:45913756-45913778 AGGGAAAAGCCCAGCGAGGCAGG - Intergenic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185230024 22:49674574-49674596 AGAGAGACACAAAGAGAGGAAGG + Intergenic
949190213 3:1242230-1242252 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
949262731 3:2121145-2121167 AGGAAGGAACAAAGAGAGGAAGG - Intronic
949370802 3:3332846-3332868 AGGGGAAAGCCAAGAGAAGCAGG - Intergenic
949381875 3:3455801-3455823 AGGGAGAAGACAATATAGGCAGG + Intergenic
949611417 3:5707581-5707603 AAGGAGAAGCAGAGAGAGAGAGG - Intergenic
949875188 3:8621946-8621968 AGCCAGAAGCAGATAGAGGCAGG - Intronic
949925194 3:9035616-9035638 AGAAAGAAAGAAAGAGAGGCAGG + Intronic
950114979 3:10444873-10444895 AGGAAGAAGAAAGAAGAGGCAGG - Intronic
950398873 3:12755007-12755029 AGGGGGAAGGAGAGAGAGGAAGG - Intronic
950404612 3:12796890-12796912 AGGGAGAAGAGAGAAGAGGCAGG - Intronic
950531753 3:13556345-13556367 AGAGAGAAGGGAAGAGAGGGAGG + Intronic
950867999 3:16204786-16204808 GGGGAGAAGCAATGTGGGGCAGG + Intronic
951316150 3:21191620-21191642 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
951677168 3:25254668-25254690 AGTGAGAAGGAAGGAGAGGGAGG + Intronic
952274594 3:31865062-31865084 AGGGAGAAGAAAAGAAGGGAGGG + Intronic
952297048 3:32070867-32070889 AGGTAAAAGCAAAGAGAGGCTGG - Intronic
952663290 3:35876748-35876770 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
952792012 3:37207373-37207395 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
952895047 3:38073090-38073112 AGGTGAAAGCAAAGAGAGGCTGG + Intronic
952895877 3:38078698-38078720 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
952992001 3:38838306-38838328 AGAAAGAAGGATAGAGAGGCAGG - Intergenic
953046310 3:39296655-39296677 AGGAAGAAGTGAAGTGAGGCAGG + Intergenic
953076951 3:39580222-39580244 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
953177379 3:40564264-40564286 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
953236859 3:41114452-41114474 AGGGAGAGTCAGAGAGAGGGAGG + Intergenic
953331229 3:42054352-42054374 AGGCAGAGGCAAGGAGAGGCAGG + Intronic
953374040 3:42413634-42413656 AGAGAGAACCAAAGAGGGGCGGG - Intergenic
953423681 3:42774465-42774487 AGGTGGCAGCAAAGAGAGACAGG + Intronic
953682565 3:45050936-45050958 AGGGAGAGGCCAAGAAAGACAGG + Intergenic
953821704 3:46212519-46212541 GGGGAGGTGGAAAGAGAGGCTGG - Intronic
953825528 3:46248731-46248753 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
954052008 3:47987387-47987409 AGGAAGATGAAAAGAAAGGCTGG + Intronic
954129807 3:48554683-48554705 AGTGAGAAGCAAAGAAAGAATGG + Intronic
954161596 3:48726748-48726770 AGGTAAAAGCAAAGAGGGCCTGG + Intronic
954311558 3:49772697-49772719 AGTCAGAAGTAGAGAGAGGCTGG - Intronic
954392775 3:50276109-50276131 AGGGAGAATCCGAAAGAGGCGGG - Intronic
954585158 3:51728267-51728289 AGGGAGCAGAAAAGAGAGGAGGG + Intergenic
954799669 3:53179978-53180000 AAGCAGAAGCTCAGAGAGGCTGG - Intronic
954876549 3:53806251-53806273 AGGGAGAAGCAGAGAAAGTGAGG - Intronic
954969097 3:54636912-54636934 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
955058122 3:55474116-55474138 AGGGAGAAAGAAAGTGAGACGGG + Intronic
955061678 3:55497828-55497850 AGGGAAGAGCCAAGAGAGGTGGG + Intergenic
955098857 3:55827413-55827435 AGAGGGAAGAAAAGAGAGGGAGG + Intronic
955213806 3:56966662-56966684 AGGGAGGGGAAAAGAGAGTCAGG + Intronic
955360713 3:58272096-58272118 AGGGAGAGGGAGAGAGAGGCCGG - Intronic
955785682 3:62536205-62536227 AGGGGGAAGCTAAGATAGGGAGG + Intronic
955884129 3:63579277-63579299 AGGCAGAAGGAAGGGGAGGCAGG - Intronic
955932237 3:64068501-64068523 AAAGAGAAGCAAAGAGAGAGGGG + Intergenic
956481855 3:69681161-69681183 GGAGAGACGCAAAGAGAGGAGGG - Intergenic
956548823 3:70437284-70437306 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
956621513 3:71225865-71225887 CGGGTGCAGCAAAGAGAGACTGG + Intronic
956624106 3:71249758-71249780 AGGGAGAGGGAAAGTGAGGAGGG + Intronic
956639110 3:71397942-71397964 AGGAAGAAGCAGAGAGAGTGGGG + Intronic
956709388 3:72026280-72026302 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
956790801 3:72678633-72678655 AGAGAGAAGGAAAGACAGACAGG + Intergenic
956908730 3:73794936-73794958 AGAGAGAGACAGAGAGAGGCAGG + Intergenic
956951402 3:74287748-74287770 GGGTGGAAGGAAAGAGAGGCTGG + Intronic
957036525 3:75298469-75298491 AGGAAGAAGGAAAGAAAGGAAGG + Intergenic
957279162 3:78127565-78127587 AGGTAGAAGGAAAGCTAGGCTGG - Intergenic
957295407 3:78327093-78327115 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
957451611 3:80388168-80388190 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
957515184 3:81240811-81240833 AGAGAGAAGCAAGGAAAGGAGGG + Intergenic
958422116 3:93941048-93941070 GGGTAAAGGCAAAGAGAGGCTGG - Intronic
958676627 3:97275402-97275424 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
958751150 3:98194219-98194241 AGGTAAAAGCAAAGAGAGGCTGG - Intronic
958906606 3:99948640-99948662 AGGGAGAAAGAAAGAGGGGAAGG + Intronic
958914872 3:100038250-100038272 AATGAGAAGAAAAGAGAGGCCGG - Intronic
959217160 3:103465676-103465698 AGGGAGAAATGAAGAGAGGTTGG - Intergenic
959247792 3:103897379-103897401 AGAGAAAAGAAAAGAGAGGGAGG + Intergenic
959288176 3:104442336-104442358 AAGTAAAGGCAAAGAGAGGCTGG + Intergenic
959451633 3:106510759-106510781 AGGAAGAAGCAAAGAAAGGAAGG - Intergenic
960009027 3:112813064-112813086 GTAGAGAACCAAAGAGAGGCTGG - Intronic
960038222 3:113123108-113123130 AGGGGGAAGGAAAGGGAGTCAGG + Intergenic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
960537475 3:118829110-118829132 TGGGAGAAGGAAAGAAAGGAAGG + Intergenic
960763474 3:121098345-121098367 AGGGAGCAAGAGAGAGAGGCAGG + Intronic
960952245 3:123006937-123006959 CCGGGGATGCAAAGAGAGGCTGG - Intronic
961009231 3:123424878-123424900 AGGCAGAAGGCCAGAGAGGCCGG + Intronic
961017254 3:123477978-123478000 AGAGAGAAGAAAGGAGAGGGGGG + Intergenic
961054202 3:123774062-123774084 ATGGAAAAGCAAGGAGAGGCTGG + Intronic
961293659 3:125866881-125866903 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
961711449 3:128831616-128831638 AAGTAAAAGCAAAGAGAGGCTGG + Intergenic
961747650 3:129075515-129075537 AGGGAGCAGGAAAGAGGGGAGGG + Intergenic
962022083 3:131511973-131511995 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
962048807 3:131790576-131790598 AGGGTGAAGAAAAGAAGGGCAGG - Intronic
962076018 3:132082319-132082341 AGGGAGAGGGAGAGAGAGGCAGG - Intronic
962166131 3:133050297-133050319 AGAGAGAAAGAAAGAAAGGCAGG - Intronic
962169354 3:133084360-133084382 AGAGAGAAGGGAAGAGTGGCTGG - Intronic
962198403 3:133381944-133381966 AGGCAGCAGCAAGGAGAAGCTGG - Intronic
962205749 3:133432405-133432427 AGGTGAAAGCAGAGAGAGGCTGG - Intronic
962237109 3:133716040-133716062 AGGGAGAATCCAAGAGAGTGTGG - Intergenic
962545465 3:136429715-136429737 ATGGAGAAGGAAGGAGAGGCAGG - Intronic
962661869 3:137609826-137609848 AGGGCCCTGCAAAGAGAGGCTGG - Intergenic
962762374 3:138527106-138527128 AGGGAAAGGCAAAGAGGGGCAGG + Intronic
962837813 3:139204345-139204367 AGGGAGTAGAAAAGAGAGAGTGG + Intronic
963017457 3:140839582-140839604 AGGGAGCAGTGAAGAGGGGCTGG - Intergenic
963074632 3:141334496-141334518 AGGGAGAAGGAAGGAAAGGAAGG - Intronic
963229834 3:142898469-142898491 AGGGAGGAGCAGAGAGAGGGAGG - Intergenic
963319909 3:143800573-143800595 AGGTAAAAGCAAAGAGAGACTGG - Intronic
963425392 3:145116272-145116294 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963456493 3:145553607-145553629 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
963520614 3:146356840-146356862 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963521791 3:146365345-146365367 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963663521 3:148154939-148154961 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963684502 3:148417636-148417658 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963823994 3:149931822-149931844 AGGGAGCAGTGAAGGGAGGCTGG - Intronic
963983319 3:151564429-151564451 AGGAGGAAACAAAGAGAGGAAGG - Intergenic
964040211 3:152252284-152252306 AGGGAGGAACAAAGGGAGGGAGG - Intronic
964066105 3:152581482-152581504 AGAGAGAGACAAAGAGAGGGAGG - Intergenic
964175851 3:153825690-153825712 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
964526780 3:157623106-157623128 AGGGACAAGCAGGGAGAGCCAGG + Intronic
964558620 3:157968280-157968302 TGGGATTAGAAAAGAGAGGCAGG + Intergenic
964758298 3:160109218-160109240 AGAGAGAAGCAAACATACGCTGG + Intergenic
965262483 3:166503204-166503226 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
965329327 3:167351461-167351483 AGGGTGAAGAAAAGAGAAACAGG + Intronic
965335272 3:167425880-167425902 AGGTAAAAGCAAAGAGCGGCTGG - Intergenic
965336503 3:167434507-167434529 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
965624714 3:170674945-170674967 AGATGAAAGCAAAGAGAGGCTGG + Intronic
965639862 3:170820385-170820407 AGGTGAAAGCAAAGAGAGGCTGG + Intronic
965721652 3:171668596-171668618 AGGGAGGAACAAAGAAAGGAAGG - Intronic
966064132 3:175796072-175796094 AGGGAGAAGGAGAGAGAGTGGGG + Intronic
966085597 3:176064626-176064648 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
966114520 3:176445691-176445713 AGGGAAAAGTAAAAAGATGCTGG - Intergenic
966140607 3:176752265-176752287 AGAGAGAAGGAAAGAGAGAAAGG + Intergenic
966225297 3:177591317-177591339 TTGGAGGAGCAAAGAGAGGAGGG - Intergenic
966232679 3:177668273-177668295 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
966314018 3:178625250-178625272 AGGAAAAGGCAGAGAGAGGCAGG + Intronic
966331739 3:178822342-178822364 AGGGAGCAGGACAGAGAGCCAGG - Intronic
966356346 3:179083304-179083326 AGGGACAAGCTCAGAGAAGCAGG + Intergenic
966367494 3:179205711-179205733 AGAGAGAAGCAAAGAAATGCAGG - Intronic
966426026 3:179780508-179780530 AGAGAGAAAGAAAGAGAGTCTGG + Intronic
966756230 3:183374081-183374103 AGAGAGCAGGAAAGGGAGGCAGG - Intronic
967005177 3:185376957-185376979 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
967129203 3:186455141-186455163 AGGAAGAAGCTTCGAGAGGCTGG - Intergenic
967244008 3:187468694-187468716 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
967350671 3:188511032-188511054 AGGGAGAAGGAAGGGGAGGGAGG - Intronic
967404140 3:189098155-189098177 AAGAAGAAGAAAAGAGAGCCGGG + Intronic
967496397 3:190147789-190147811 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
967721278 3:192819164-192819186 AGGGAGAAGAAAAGAGAGATAGG + Intronic
968054400 3:195680487-195680509 AGGGAGAAGCAAGGAGGAGGAGG + Intergenic
968101491 3:195968671-195968693 AGGGAGAAGCAAGGAGGAGGAGG - Intergenic
968601992 4:1513800-1513822 TGGGACCAGCAAAGAGAGGTAGG - Intergenic
968602262 4:1515782-1515804 ATGGAGAAGCCCATAGAGGCAGG - Intergenic
968872091 4:3247351-3247373 CGGGAGATGCCAAGAGATGCTGG + Intronic
969351137 4:6598514-6598536 ACGGATGAGCAAACAGAGGCTGG - Intronic
969436071 4:7190341-7190363 AGGGAGAAGGAAAGGAAGGGAGG - Intergenic
969498638 4:7540155-7540177 AGGGAGGGGCAGGGAGAGGCAGG - Intronic
969591824 4:8126461-8126483 AGAGAGGAGAAAAGGGAGGCAGG - Intronic
969653909 4:8485200-8485222 AGGTGAAAGCAAAGAGAGGCTGG + Intronic
969954665 4:10876441-10876463 ATGGATGAGGAAAGAGAGGCCGG - Intergenic
970042250 4:11809566-11809588 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
970087715 4:12367054-12367076 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
970107723 4:12603742-12603764 AAGGAGAAACAACGAAAGGCAGG + Intergenic
970256240 4:14172945-14172967 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
970819570 4:20196939-20196961 AGGGAGAGGTAAAGAGAGACTGG - Intergenic
971103255 4:23493599-23493621 GGGTAGAAAGAAAGAGAGGCAGG + Intergenic
971504140 4:27347946-27347968 AGGGGGAAGCATAGAGAGTAGGG - Intergenic
972027531 4:34403488-34403510 AGAGAGTAGAATAGAGAGGCTGG + Intergenic
972070776 4:35018003-35018025 AGGTAAAAGCAAAGAGAGGCTGG - Intergenic
972256147 4:37357868-37357890 GGGGAGATGGAAAGAGGGGCAGG + Intronic
972259814 4:37396734-37396756 AGTAAAAAGCAAAGCGAGGCTGG + Intronic
972466838 4:39365948-39365970 AGGGAGAAAGGAAGAGAGGAAGG - Intronic
972864554 4:43214225-43214247 AGGCAAAAGGAAAGAGGGGCAGG - Intergenic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973645640 4:52948859-52948881 AGGGAGAAGAAAATAGAAGGCGG - Intronic
973710664 4:53627169-53627191 AGGGAGAAGGAAAGCGTAGCTGG + Intronic
973757764 4:54092268-54092290 AGGCAGAAGAAATGAGACGCTGG - Intronic
973791705 4:54384306-54384328 AGGCAGAAGCAAAGAGTCTCAGG + Intergenic
973835634 4:54806580-54806602 AGGAAGGAGCAAAGAAAGGAAGG - Intergenic
974072096 4:57133192-57133214 AGGAAGAAGCTAAAAGATGCTGG + Intergenic
974154006 4:58046930-58046952 AGAGATAGTCAAAGAGAGGCTGG - Intergenic
974380494 4:61133928-61133950 ATGGAGAAGCAATTAAAGGCTGG + Intergenic
974389207 4:61243435-61243457 AGGGAGAAGCAGAGATTGGGTGG - Intronic
974424975 4:61730590-61730612 AGAGAGAAGTAAAGAGAGAAAGG - Intronic
974722203 4:65755008-65755030 AGAAAGAAGGAAAGAGAGCCAGG + Intergenic
974894297 4:67920286-67920308 AGGGAAGAGCAGAGAGAGGCAGG - Intronic
974903949 4:68033901-68033923 AGGTAAAAGCAAAGAGAGGCTGG - Intergenic
975146374 4:70971987-70972009 AGGGAGAAAGGAAGAGAGGGAGG - Intronic
976019733 4:80607021-80607043 AGGAAGAAGAAAAGAAAGTCAGG + Intronic
976558736 4:86477873-86477895 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
977062331 4:92273924-92273946 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
977076633 4:92460390-92460412 AGGGAGAAGTAAAGAGAGGCTGG - Intronic
977287952 4:95132695-95132717 TGAGAGAAGGAGAGAGAGGCTGG - Intronic
977350966 4:95886338-95886360 AGGGAGGAGCAAGAAGAAGCAGG + Intergenic
977427489 4:96886711-96886733 TGGGAGAAGAAAAGAGAGAGAGG + Intergenic
977578456 4:98699493-98699515 AGGGAGAAGCAAAGAATGAGAGG - Intergenic
977992482 4:103461263-103461285 AGGGAGGCTCAAAGAGAGGGAGG + Intergenic
978619137 4:110622073-110622095 AGGGAGAACTAAAGGGATGCGGG + Intronic
978657597 4:111083273-111083295 ATGGAGAAGCGTAGAGAGGGAGG + Intergenic
978758170 4:112326529-112326551 AGAGAGAAAGAAAGGGAGGCAGG + Intronic
979365713 4:119820741-119820763 GGGGAGGATCAAAGAGATGCTGG - Intergenic
979380114 4:119997210-119997232 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
979547294 4:121952061-121952083 AGGGAGAAGGAGAGGGAGGGCGG + Intergenic
979972907 4:127159677-127159699 AAGGGGAAGGAAAGAGAGGAAGG + Intergenic
980491867 4:133538814-133538836 AGTGACAAGCAAAGAGGGGAAGG - Intergenic
980528036 4:134015454-134015476 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
980575454 4:134680335-134680357 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
980904113 4:138931152-138931174 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
980988501 4:139718376-139718398 AAGGAGAAGCAAGGGGAGGCTGG + Exonic
980992865 4:139753309-139753331 AGAAAAAAGCAAAGAAAGGCAGG - Intronic
981321045 4:143391597-143391619 ACAGAGAAGCACAGAGAAGCGGG + Intronic
981616090 4:146646488-146646510 AGGGAGAGGAAGAGAGAGGAGGG - Intergenic
981747919 4:148068862-148068884 AAGTAGCACCAAAGAGAGGCAGG - Intronic
981756508 4:148145979-148146001 AGTGAGAAGAAAAGGGAGGAGGG + Intronic
981774179 4:148346102-148346124 AGGGTGAAGCCCAGAAAGGCAGG + Intronic
982083804 4:151815035-151815057 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
982265621 4:153536038-153536060 AGGGAAAAGCAAAGATCAGCTGG - Intronic
982318986 4:154059560-154059582 AGGTAAAAGCAAAGAGAGGATGG - Intergenic
982496942 4:156105904-156105926 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
982500321 4:156146626-156146648 AGGGTGAAGAAAAGAGATACTGG - Intergenic
983024050 4:162712386-162712408 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
983166366 4:164482010-164482032 AGAGAGAAAGAAAGAGAGGAAGG + Intergenic
983269647 4:165546313-165546335 AGGAATAAAGAAAGAGAGGCAGG + Intergenic
983275253 4:165608914-165608936 AGGAAAAACCAAAGAGAGTCTGG - Intergenic
983345726 4:166523812-166523834 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
983452505 4:167926178-167926200 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
983659745 4:170119738-170119760 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
984165183 4:176297273-176297295 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
984177258 4:176434781-176434803 AGGAAGAAGGGAAGAGAGGAAGG - Intergenic
984322359 4:178210376-178210398 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
984388758 4:179100070-179100092 TGGGAGAAGGAAAGGGAGGAAGG + Intergenic
984523054 4:180823745-180823767 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
985414103 4:189719211-189719233 AGGGAGGAAGAAAGAGAGGGAGG + Intergenic
985501468 5:250285-250307 AGGGAGAAGCAAGGAGGAGGAGG + Intronic
985661654 5:1160294-1160316 AGGGAGAGACAGAGAGAGACAGG + Intergenic
985712501 5:1437464-1437486 AGGGAGAGGGAAAGAGAGCGAGG + Intronic
985718261 5:1475120-1475142 AGGATGAAGCAGAGTGAGGCGGG + Intronic
985735414 5:1577349-1577371 AGGGAGAAGCAAGGAGGAGGAGG - Intergenic
985756620 5:1723344-1723366 AGGGAGAGGGAAGGCGAGGCTGG - Intergenic
985774106 5:1831753-1831775 AGGGAGGGGCACAGAGAGGATGG - Intergenic
985830781 5:2227767-2227789 AGGGAGCAGGACAGAGACGCTGG + Intergenic
985926929 5:3026275-3026297 GAGGAGAAGCAGGGAGAGGCAGG - Intergenic
985987374 5:3527386-3527408 TGGCAGATGCAAAGAGAGGAGGG + Intergenic
986001169 5:3631889-3631911 AAAGAGAAAGAAAGAGAGGCAGG - Intergenic
986193700 5:5518831-5518853 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
986348900 5:6858921-6858943 AAGGAGAAGGGAGGAGAGGCAGG - Intergenic
986368807 5:7060737-7060759 AGGTAAAAGCAAAGAGAGGCTGG + Intergenic
986389050 5:7266873-7266895 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
986748119 5:10761453-10761475 AGGGAGAAGGAAGGAGAGGGAGG + Intergenic
986794306 5:11193754-11193776 AGGGTGAAGGAAAAATAGGCTGG + Intronic
986905937 5:12493033-12493055 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
986943595 5:12987428-12987450 AGGGAGAAACTCAGAGTGGCAGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987755996 5:22098125-22098147 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
987763566 5:22195880-22195902 AGAGAGAAAGAAAGAGAGGGAGG - Intronic
987865602 5:23532161-23532183 AGGGAGAAGAAAATAGAGAGAGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988199271 5:28048930-28048952 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
988341498 5:29978218-29978240 AGAGAGAGGGAAAGAGAGACTGG + Intergenic
988777964 5:34494223-34494245 AGGGAGGAGCTGAGAGAGGTGGG + Intergenic
989462372 5:41715284-41715306 AGAGAGGAGGAAGGAGAGGCAGG + Intergenic
989736729 5:44716510-44716532 AGAGAGAAACAAAGAGAGAAAGG + Intergenic
989755445 5:44947619-44947641 AGAGAGAGGCAGAGAGAGGGAGG - Intergenic
990047015 5:51445125-51445147 TGGGGGAAGCAGAGAGAGGGTGG - Intergenic
990117018 5:52401904-52401926 AGAGAGAAGGAAAGAGAGAGAGG + Intergenic
990363143 5:55042150-55042172 AGGCAGAAGAAACAAGAGGCTGG + Intergenic
990523307 5:56600698-56600720 AGGAAGAGGCAAGGAGAGGGAGG + Intronic
990654176 5:57936086-57936108 AGGGAGGAGGATACAGAGGCTGG - Intergenic
990780333 5:59353730-59353752 AGGGAGAGGGAAGGAAAGGCAGG - Intronic
990860637 5:60323087-60323109 AGTGAGAAGAAAGGAGAGTCTGG - Intronic
990965941 5:61447929-61447951 AGGGAGGAGTAAAGAGAAGTTGG + Intronic
991433622 5:66573476-66573498 AGGGAGCAGAAAAGGGAGGGAGG + Intergenic
991433629 5:66573496-66573518 AGGGAGGAGAAAAGGGAGGGAGG + Intergenic
991468539 5:66941881-66941903 ATGGAGAAGGAAAGAGATGGGGG + Intronic
991503395 5:67300163-67300185 AGAGGGAGGCAAAGAGAGGGAGG - Intergenic
992142950 5:73817866-73817888 AGGGAGAAGCTAAGATGGGGAGG - Intronic
992159482 5:73986789-73986811 AGGAGGATGCAAAGAAAGGCAGG + Intergenic
993001484 5:82385704-82385726 AGAGAGAAGCAGAGAGAAGAGGG - Intronic
993094442 5:83465360-83465382 AGGGAGAAGCACTGAGACTCAGG + Intergenic
993384658 5:87250775-87250797 AGGGAAAAGCAAATTGAGGAAGG - Intergenic
993533537 5:89052524-89052546 AGAGAGGAGCAAAGAGAGAGAGG - Intergenic
993700336 5:91111750-91111772 ATGTAGAAGCCAAGGGAGGCTGG + Intronic
994073142 5:95622991-95623013 AAGGAGGAACAAAGAGAGGAAGG - Intergenic
994897958 5:105729714-105729736 AGGGAGAGTCATAGAGGGGCAGG + Intergenic
995066894 5:107872674-107872696 AAGGAGAAGGAAAGAGACGAAGG + Intronic
995122682 5:108552561-108552583 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
995296845 5:110533127-110533149 AGGTGAAAGCAAAGAGAGGCTGG - Intronic
995601931 5:113806994-113807016 AAGGAGGAGGAAAGAGAGCCAGG - Intergenic
995781723 5:115783808-115783830 AGGGAGAAAGGAAGAGAGGCAGG - Intergenic
995801001 5:115994971-115994993 GGGGACCAGCAAAGAGAGGCAGG - Intronic
996052456 5:118949318-118949340 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
996129415 5:119763686-119763708 TGGGGGAAGAAAAGAGAGGAAGG + Intergenic
996147345 5:119992129-119992151 AGGGAGAGCCAAAGAAGGGCAGG - Intergenic
996148106 5:119999919-119999941 AGGGAGAAAGAGAGAGAGGCAGG + Intergenic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996358446 5:122621291-122621313 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
996574814 5:124969034-124969056 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
996590895 5:125146931-125146953 AGGGAGAAGCAGGGAGAAGCAGG - Intergenic
996590897 5:125146941-125146963 AGGAAGAAGCAGGGAGAAGCAGG - Intergenic
997286548 5:132683218-132683240 AAGCAGAAGAAAAGAGAGGTGGG + Intergenic
997746572 5:136304598-136304620 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
997770458 5:136548752-136548774 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
997827937 5:137124311-137124333 GGGGAGAAGCACAGAGAAGAGGG - Intronic
998953581 5:147415664-147415686 AAGAAGAAGCTAAGAGAGGAGGG + Intronic
999148774 5:149413021-149413043 AGGGTGAAGGAGAAAGAGGCTGG + Intergenic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
999618698 5:153452131-153452153 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
999682633 5:154074414-154074436 AGAGAGAGTCAAAGAGAGGGAGG + Intronic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
999955935 5:156701570-156701592 ATAGAGAAGGGAAGAGAGGCAGG + Intronic
1000373997 5:160562475-160562497 ATGGAGATGAAAAGAGAGGAAGG - Intergenic
1000445709 5:161316570-161316592 AGGGAGAAACAAAGAAAGAAAGG - Intronic
1000728788 5:164804760-164804782 AAGAATAAGCAAAGATAGGCCGG - Intergenic
1000825132 5:166035230-166035252 AGGAAGAAGAAAGGAGAGGCTGG - Intergenic
1000885151 5:166741519-166741541 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1001108368 5:168875122-168875144 AGGGAGAAAGAATGAGAGGGAGG + Intronic
1001354131 5:171003815-171003837 AGGTAAAAGCAAAGAGAGGCTGG + Intronic
1001417493 5:171556118-171556140 AGGGAGAAGGAAAGAGGAGGAGG - Intergenic
1001546641 5:172574502-172574524 AGGGAGAAGAAAAGAAAGAAAGG - Intergenic
1001621819 5:173093133-173093155 AGGGTGAAACAAAGAGAGGATGG + Intronic
1001654395 5:173338494-173338516 AGGCAGAAGAAAAGCGAGGCGGG + Intergenic
1002327621 5:178420358-178420380 GGGGAGGAGGAAAGAGAGGAGGG - Intronic
1002492469 5:179588469-179588491 AGGGAAAAGCATAGAGAAGCAGG - Intronic
1002610775 5:180417150-180417172 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1002658653 5:180774217-180774239 AGGGAGCAAAAGAGAGAGGCAGG + Intergenic
1002831154 6:822339-822361 AGGGAAACGGAAAGAGAGGAGGG - Intergenic
1003098883 6:3162518-3162540 AGGGAGAAAAAAAGGGAGGGAGG - Intergenic
1003099912 6:3169151-3169173 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1003788439 6:9514579-9514601 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1004005239 6:11632112-11632134 AGAGAGAAGGAAAGAGAGAGAGG - Intergenic
1004106433 6:12670646-12670668 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1004283347 6:14299380-14299402 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1004376569 6:15095798-15095820 AGAGAGAAGCCAAGAGAGAGAGG + Intergenic
1004455877 6:15790983-15791005 AGGGAGAAGCAATGCTTGGCAGG + Intergenic
1004552841 6:16666115-16666137 AGGGAGGAATAAAGAGAGGTTGG - Intronic
1004674337 6:17826567-17826589 AGAGAGAGGCAGAGAGAGACAGG + Intronic
1004751487 6:18566217-18566239 AGGAAGAAAGGAAGAGAGGCAGG - Intergenic
1004816733 6:19319221-19319243 AGAAAGAAGAAAAGAGAGGAAGG - Intergenic
1005148268 6:22717921-22717943 AGAGAAAAGCAAAGAGAGAAAGG + Intergenic
1006011802 6:31048531-31048553 AGTGAGTAGAAAATAGAGGCTGG + Intergenic
1006041682 6:31261285-31261307 TCTGAGAAGCAAAGAGGGGCTGG + Intergenic
1006089496 6:31620239-31620261 AGGGAGAAAGAGAGAGAGGACGG - Intergenic
1006105558 6:31714154-31714176 AGAGAGAAGCTGAGAGAGCCAGG - Intronic
1006536714 6:34705044-34705066 AGGAAGCAGCAAAAAGAGCCAGG - Intergenic
1007068741 6:39019172-39019194 AGGGAGGAGGTAAAAGAGGCAGG + Intronic
1007070871 6:39037363-39037385 AGAGAGAGGCAAAGAGAGAGGGG - Intergenic
1007226830 6:40321049-40321071 GGGGAGAAGGGAAGAGAGGGAGG + Intergenic
1007299421 6:40855652-40855674 AGGGAGAACCCAAAAGAGACAGG + Intergenic
1007300809 6:40866632-40866654 AGGTAAAAGCAAAGAGAGGCTGG + Intergenic
1007402867 6:41614368-41614390 AGGGAGCAGGCAGGAGAGGCAGG + Intergenic
1007407822 6:41644964-41644986 AGGGGGACACAAGGAGAGGCAGG - Intronic
1007427068 6:41754076-41754098 AGGGCAAAGCAAAGAGAAGCAGG - Intronic
1007522562 6:42462650-42462672 AGGGAGAAAGAAAGAGAGAGAGG + Intergenic
1007605416 6:43114427-43114449 AGGGAGAAACAGAGGGAGACAGG - Intronic
1007747538 6:44052097-44052119 AGGGAGCTGCAAAGAGCAGCCGG + Intergenic
1007786173 6:44280686-44280708 AGGGGGAAGCTGAGAGAGGGTGG + Intronic
1007930532 6:45686925-45686947 AGGGGCAAGGCAAGAGAGGCAGG - Intergenic
1007976202 6:46103913-46103935 AGAGAGAGACAAACAGAGGCTGG - Intergenic
1008447398 6:51609233-51609255 AGGGAGCAGAAAAGAGAAGAAGG - Intergenic
1008520376 6:52357291-52357313 AGGGGGAAGTGAAGAGAGGTTGG + Intergenic
1009269990 6:61603388-61603410 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1009379312 6:63008610-63008632 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1009464502 6:63953165-63953187 AGGTAAAAGCAAAAACAGGCTGG - Intronic
1009575210 6:65447283-65447305 AGAGAGAAAGAAAGAGAGTCAGG - Intronic
1009687372 6:66980065-66980087 AGGGAGAAGCAATGAGAATGGGG - Intergenic
1009786153 6:68342368-68342390 AGGGAGTAGAAATGAGAGACAGG - Intergenic
1010062920 6:71645620-71645642 AGGTAGTAGGAAAGAGAGGGGGG + Intergenic
1010143245 6:72635695-72635717 AGGTAGAAGCACAGAGAGAAAGG - Intronic
1010269106 6:73901147-73901169 ATTGAGAAGCAAAGCTAGGCTGG - Intergenic
1010415669 6:75608517-75608539 AGAAAGAAGGAAAGAGAGGAAGG + Intronic
1010454836 6:76043103-76043125 AGAGAGAAGGAAAGAGAGAGTGG + Intronic
1010554204 6:77258814-77258836 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1010574014 6:77510324-77510346 AGAGAGGAGAAGAGAGAGGCTGG + Intergenic
1010696456 6:78980290-78980312 AGGGAGAAACAAGGAGAAACAGG + Intronic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011037566 6:82994518-82994540 TGGGACAGGCAAACAGAGGCAGG + Intronic
1011103970 6:83758443-83758465 AGGGAGAGAGAGAGAGAGGCTGG + Intergenic
1011106631 6:83788912-83788934 AGGGAGAAGGAAAGAGGGTAGGG - Intergenic
1011258559 6:85449571-85449593 GAGGAGGAGTAAAGAGAGGCCGG - Intronic
1011367727 6:86600797-86600819 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1011480022 6:87784566-87784588 AGGGAAAAGTAGAGTGAGGCAGG + Intergenic
1011802519 6:91033710-91033732 AGGGAGAGACAAAGAGAGAGAGG - Intergenic
1012085601 6:94822386-94822408 AGGGAGAAGGAGAGAGAGAGAGG - Intergenic
1012100386 6:95077588-95077610 AGGTAGAGGAAAAGACAGGCAGG + Intergenic
1012350223 6:98240940-98240962 AGGGAGAAAGAAAGAGAGAAAGG + Intergenic
1012675265 6:102105239-102105261 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1012859799 6:104545543-104545565 AGGCAGAAGGAAAGATAGACGGG + Intergenic
1012986167 6:105878432-105878454 ACGGAGAAGAAAAGAGAAGCTGG + Intergenic
1013347392 6:109274955-109274977 AGGGAGATCCAAGGAGAGGTAGG + Intergenic
1013459769 6:110364019-110364041 AGGGGGAACTAAAAAGAGGCAGG - Intergenic
1013570720 6:111421895-111421917 AGACAGAAGCAAAGAAAGACTGG - Intronic
1013656733 6:112254332-112254354 AGAGAGAGGGAGAGAGAGGCTGG - Intronic
1014115180 6:117662143-117662165 AGGTAAAAGCAAAGAGAGGCTGG + Intergenic
1014121690 6:117733470-117733492 AGGGAGCAAGAAAGAGAGGGAGG + Intergenic
1014279854 6:119429692-119429714 AGGCAGAGACAGAGAGAGGCTGG + Intergenic
1014588595 6:123232612-123232634 AGGGAGAAAGCAAGAGAGGATGG + Intronic
1014793817 6:125704287-125704309 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1015020790 6:128471998-128472020 AGAGAGAGGAAAAGAGAGGGGGG + Intronic
1015026638 6:128541325-128541347 AGGGAGAATGAAAGGGAGGGAGG - Intergenic
1015026646 6:128541349-128541371 AGGGAGAATGAAAGGGAGGGAGG - Intergenic
1015026683 6:128541501-128541523 AGGGAGAATGAAAGAGAGGGAGG - Intergenic
1015198581 6:130552489-130552511 AGGGAGAAGAGAACAGAAGCAGG - Intergenic
1015255662 6:131177001-131177023 AGGCATATGCAAACAGAGGCAGG - Intronic
1015271544 6:131342155-131342177 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1015461088 6:133491973-133491995 AGGAAGAAGAAAAGAAAGCCTGG + Intronic
1016113397 6:140254045-140254067 AGGGAGTGGGAAAGAGAGACAGG + Intergenic
1016113974 6:140259871-140259893 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1016429782 6:143970985-143971007 AGGGAGAGGCAGAGAGTGGAGGG - Intronic
1016535586 6:145105576-145105598 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1016828109 6:148406659-148406681 AGGGAGGAGCAGAGAGAATCAGG + Intronic
1016828114 6:148406689-148406711 AGGGAGGAGCAGAGAGAATCAGG + Intronic
1016828123 6:148406749-148406771 AGGGAGGAGCAGAGAGAATCAGG + Intronic
1016828128 6:148406779-148406801 AGGGAGGAGCAGAGAGAATCAGG + Intronic
1016828139 6:148406839-148406861 AGGGAGGAGCAGAGAGAATCAGG + Intronic
1016828144 6:148406869-148406891 AGGGAGGAGCAGAGAGAATCAGG + Intronic
1016828154 6:148406929-148406951 AGGGAGGAGCAGAGAGAATCAGG + Intronic
1017303371 6:152888389-152888411 AGGGTGGAGCCAAGAGAGGCGGG - Intergenic
1017389679 6:153924773-153924795 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1017418927 6:154252272-154252294 AAGAAAAAGTAAAGAGAGGCAGG + Intronic
1017624932 6:156338623-156338645 AGGAAGAAAAAAAGAGAGGAAGG - Intergenic
1017777179 6:157689427-157689449 AGGGAGAAGGAAGGAGCGGTGGG - Intergenic
1017779173 6:157703078-157703100 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1017826818 6:158087575-158087597 AGGGAGAAGTAAACAGTGGTGGG - Intronic
1017832315 6:158141668-158141690 AGGAAGAATCAAAAAGAGCCAGG + Intronic
1017954252 6:159165344-159165366 AGGGAAAAGAAAATAGAAGCAGG - Intergenic
1018122519 6:160649805-160649827 AGAGAGAAGCAAAGGCAGGAAGG - Intronic
1018358850 6:163045243-163045265 AGGCAGAAGCCCAGAGGGGCTGG - Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018687766 6:166317118-166317140 AGGGCTAAGAAAAGAGAAGCTGG + Intergenic
1018991797 6:168679403-168679425 AGGTAAAAGCAAAGAGAGGCTGG + Intergenic
1019535140 7:1525087-1525109 AAGAAGAAGCTAATAGAGGCCGG - Intergenic
1019568407 7:1696327-1696349 AGAGAGAGGGAAAGAGAGACAGG + Intronic
1019682801 7:2361713-2361735 AGAAAGAAGCTCAGAGAGGCCGG - Intronic
1019780018 7:2934192-2934214 AGAGAGAAAGAAAGACAGGCTGG - Intronic
1019937721 7:4267273-4267295 AGGAAGGAGGAAAGAGAGGAAGG - Exonic
1020249101 7:6452939-6452961 AAGTAGAAGGAATGAGAGGCAGG + Intronic
1020316220 7:6907066-6907088 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1020477328 7:8612368-8612390 TGAGAGAAGAAAAGAGAAGCAGG - Intronic
1020540969 7:9460984-9461006 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1020794376 7:12662823-12662845 AGGTAAAAGCAAAGAGAGGCTGG - Intergenic
1021234754 7:18128843-18128865 AGGGAGAAAAAAAGAGAGACAGG - Intronic
1021447479 7:20749031-20749053 AGGGAGAGACAAAGAAAGGAAGG - Intronic
1021637492 7:22706527-22706549 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1021781274 7:24109117-24109139 AGGGAGCAGGAATGAGGGGCAGG - Intergenic
1021977732 7:26026619-26026641 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1022109253 7:27218229-27218251 AGGAAGAAACAAAGGGAGGATGG - Intergenic
1022373047 7:29788126-29788148 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1022499064 7:30871215-30871237 GGGAAGAAGCACAGAGAAGCTGG - Intronic
1022601028 7:31759844-31759866 AGAGAGAACAAAAGATAGGCTGG - Intronic
1022651968 7:32285741-32285763 GGGGAGAAGAGAAGAGAGGGGGG + Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023506198 7:40901962-40901984 ATGGAGAGGCAAAGAGAGCTTGG + Intergenic
1023836289 7:44069825-44069847 AGGGAGAAGGAGAGATAGGAGGG + Intergenic
1023868940 7:44252445-44252467 AGGGTGCAGCACAGAGGGGCAGG + Intronic
1024666287 7:51550390-51550412 GGGGAGAAGAAAAGGCAGGCAGG + Intergenic
1024737747 7:52323540-52323562 AGGGAGAAGGAAAGGGAGAAGGG - Intergenic
1024849648 7:53696463-53696485 AGGGAGAAGCTGGGAGAGGAGGG + Intergenic
1025073700 7:55924393-55924415 AGGGAGATACAGAGAGAGGCTGG - Intronic
1025117033 7:56267128-56267150 AGGGAGAAAGAAAGAGGGGGAGG - Intergenic
1025231631 7:57206758-57206780 AGGGAGAAAGAAAGAGAGGAAGG - Intergenic
1025245918 7:57317204-57317226 AGAAAGAAGGAAAGAAAGGCAGG - Intergenic
1025247500 7:57328402-57328424 AGAGAGAAGAAAACAGAGGGAGG - Intergenic
1025556753 7:62319035-62319057 AGGGAGAAAGGAAGAGAGGGAGG - Intergenic
1025843760 7:65176736-65176758 ATGGAAAAGCACAGGGAGGCCGG - Intergenic
1026100273 7:67378574-67378596 AGGCTGAAACAGAGAGAGGCTGG - Intergenic
1026535685 7:71236851-71236873 AGAGAGAAGAAAAGAAAGCCAGG + Intronic
1026590986 7:71695397-71695419 AGGGAGAAGCCAGCAGAGGAAGG + Intronic
1026834829 7:73631738-73631760 AGGGAGAAGGGGAGAGAGGAAGG - Intergenic
1026837562 7:73648503-73648525 AGAGAGAGGGAAAGAGAGGAAGG - Intergenic
1026837616 7:73648870-73648892 AGAGAGATGGAAAGAGAGGGAGG - Intergenic
1026852607 7:73734665-73734687 AGGGAGAGGTAAGGAGAGGAGGG - Intergenic
1026905082 7:74058188-74058210 AAGGAGAAGAAAGGAGAAGCAGG - Intronic
1027158487 7:75785211-75785233 AGGTAAAAGCAAAGAGAGGCTGG - Intronic
1027268297 7:76505749-76505771 GGGGAGGAGGAGAGAGAGGCAGG - Exonic
1027578584 7:79962859-79962881 AGGGTGAGGGAAAGAGAGGGTGG - Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027994707 7:85410911-85410933 AGGAAGAAAGAAAGAGAGGAAGG + Intergenic
1028589725 7:92482210-92482232 AGGTAAAAGCAAAGAGAGGCTGG + Intergenic
1028618880 7:92801920-92801942 GAGGAGACGAAAAGAGAGGCGGG - Intronic
1028690343 7:93643144-93643166 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1028999202 7:97135340-97135362 TTGGAGCAGCTAAGAGAGGCAGG - Intronic
1029218416 7:98969272-98969294 ATGGGGATGCAGAGAGAGGCAGG - Intronic
1029263679 7:99322280-99322302 AGGGGGAAGCAAAAAGAAGCAGG + Intergenic
1029317341 7:99726554-99726576 AGGTAAAAGCAAAGAGAGGCTGG - Intronic
1029449240 7:100631757-100631779 AGGAGGAAGCAGAGAGAGGAAGG - Intronic
1029494150 7:100888189-100888211 TGGGAGAAGAAAACAGAGGATGG + Intronic
1030058256 7:105602028-105602050 AGGGAGAAGAGAAGAGAGATTGG - Intergenic
1030114982 7:106056056-106056078 AGGAAGAAGCAACTTGAGGCCGG + Intergenic
1030247141 7:107395300-107395322 AGGGAGAAGTAAAGGGTGGTGGG + Intronic
1030926494 7:115461821-115461843 AGAGAGAAGCAGAGAGAGTCAGG - Intergenic
1031004846 7:116458791-116458813 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1031008967 7:116503872-116503894 AGAGAGAAAGAAAGAGAGGGAGG + Intronic
1031020860 7:116626085-116626107 AGGGAGAAGTAATGGGAGGTTGG - Intergenic
1031395597 7:121269997-121270019 AGGGAGAAGGAGAGAGAGGCGGG + Intronic
1031422297 7:121566413-121566435 GGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1031463755 7:122083049-122083071 AGAGAGAAGAAAAGAGAGAGAGG + Intronic
1031496449 7:122454880-122454902 AGGGATAAGCAGATAGTGGCTGG - Intronic
1031686016 7:124732318-124732340 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1031955390 7:127937421-127937443 TGGGAGACGGAAAGAGAGGAAGG - Intronic
1032182058 7:129688695-129688717 AGAGAGAGACAAAGAGAGACAGG + Intronic
1032433676 7:131883009-131883031 AGGGAGAGGGAAGGAGAGGGAGG - Intergenic
1032507741 7:132448503-132448525 AGGGAGAGGCATAGAAAGGGTGG + Intronic
1032520008 7:132536666-132536688 AAGGAGCTGCAGAGAGAGGCTGG + Intronic
1032582754 7:133118354-133118376 AGGGAGAAGGAAAGAATGGTAGG - Intergenic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1032978459 7:137252980-137253002 AGGGAGAAACATGGAGAAGCAGG + Intronic
1032993067 7:137415165-137415187 AAGGACAAGGAAGGAGAGGCTGG + Intronic
1033464869 7:141581250-141581272 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1033501065 7:141950245-141950267 AGGGAGAAGGGAAGAAAGTCAGG - Intronic
1033652271 7:143352264-143352286 AGGGGGAGGCAGAGAGAGGCAGG - Intergenic
1033972120 7:147055438-147055460 AGGGACAAGCAAAGCAAGGTGGG - Intronic
1034049806 7:147970426-147970448 AAGGTGGAGAAAAGAGAGGCTGG + Intronic
1034084647 7:148312474-148312496 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1034098328 7:148429931-148429953 ATAAAGAAGAAAAGAGAGGCCGG + Intergenic
1034483741 7:151343275-151343297 AGGGAGGAGAAAAGAGAGGAAGG - Intronic
1034971155 7:155420057-155420079 AGAGAGGAGCACAGAGAAGCCGG + Intergenic
1034985271 7:155509515-155509537 AGGGAGAGACAGAGAGAGGGAGG + Intronic
1035175617 7:157048084-157048106 AGAAAGAAACAAAGAAAGGCAGG - Intergenic
1035404847 7:158590044-158590066 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
1035470556 7:159106471-159106493 AGGAAGGGGCAGAGAGAGGCCGG + Intronic
1035470642 7:159106736-159106758 AGGGAGGGGCAGAGAGAGGCTGG + Intronic
1035471207 7:159109926-159109948 GGAGAGAAGCAGAGTGAGGCAGG + Intronic
1036051590 8:5205451-5205473 AGGAAGAAAGAAAGAGAGGAAGG + Intergenic
1036281651 8:7405720-7405742 AAGTGGAAGCGAAGAGAGGCTGG - Intergenic
1036339819 8:7905852-7905874 AAGTGGAAGCAAAGAGAGGCTGG + Intergenic
1036472168 8:9061864-9061886 AAGGGAAAGCGAAGAGAGGCTGG + Intronic
1036549847 8:9806228-9806250 AGGTAAAAGCAAAGAGAGGCTGG - Intergenic
1036588258 8:10144999-10145021 AAGGAAAAGCAGGGAGAGGCGGG - Intronic
1036639655 8:10574552-10574574 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1036775667 8:11611183-11611205 AGGGAGTGATAAAGAGAGGCTGG + Intergenic
1036814607 8:11892179-11892201 AGAGAAAAGCAAACAAAGGCTGG - Intergenic
1037008101 8:13806829-13806851 AGGGAGGAAGAAAGAGAGGGAGG - Intergenic
1037053796 8:14410217-14410239 AGGCAGAAGGAAAGGGAGGAGGG - Intronic
1037409478 8:18581004-18581026 AGAGAGAAGCAGAGACTGGCAGG + Intronic
1037461035 8:19109700-19109722 AGGGAGAAAGAGAGAGAGGGGGG - Intergenic
1037733589 8:21549498-21549520 AGAGAGAAAGAAAGAGAGGAGGG + Intergenic
1037803562 8:22047930-22047952 CGGGAGAAGCAAGGACAGGAAGG - Intronic
1037892674 8:22631745-22631767 AGGGAGGAGCACAGAGGGGTGGG - Intronic
1037950460 8:23015931-23015953 AATGAGAAGCCCAGAGAGGCAGG - Intronic
1038115228 8:24546429-24546451 TGGGAGATGCAAGAAGAGGCTGG + Intergenic
1038126202 8:24675572-24675594 AGGGGGATGAAAAGAGAGGAAGG - Intergenic
1038309737 8:26437186-26437208 AGGGAGAAGCAAAGATGGGGTGG + Intronic
1038386916 8:27156971-27156993 GGAGGGAAGCAAAGAAAGGCCGG - Intergenic
1038476939 8:27875210-27875232 AGGGAGGAGTGAAGAGAGGGAGG - Intronic
1039198019 8:35053996-35054018 AGAGAGAAAGAAAGAGAGACAGG - Intergenic
1039276377 8:35937399-35937421 AGAGAGAAGGAAAGAGAGAGAGG + Intergenic
1039417731 8:37409950-37409972 AGGAAGAAAGAAAGAGAGGGAGG - Intergenic
1039498831 8:38001105-38001127 AGGTAAAAGCAAAGAGAGGCTGG + Intergenic
1039500699 8:38014441-38014463 AGGGAGAAAGAAAGAGAATCTGG - Intergenic
1039641429 8:39227455-39227477 AGGGAGAAGGAAACAGACTCGGG + Intronic
1040436172 8:47393808-47393830 AGAGAGAAACAAAGAAAGGATGG - Intronic
1040441877 8:47451781-47451803 AAGGAGAAGAGAAGAGAGGGAGG + Intronic
1040577669 8:48667880-48667902 AGGGAGAAGGAAGAAGAGACAGG - Intergenic
1041347925 8:56920676-56920698 AGGGAGAAGCAGAGAAAGGTGGG + Intergenic
1041917365 8:63150748-63150770 AAGCGAAAGCAAAGAGAGGCTGG + Intergenic
1042533116 8:69834376-69834398 AGGGAGAAAGGCAGAGAGGCTGG + Intronic
1042635701 8:70871639-70871661 AAGGAGAAGCAAGGAGATGGAGG - Intergenic
1043057214 8:75454058-75454080 AGGGAGAAAGGAAGAGAGGGAGG - Intronic
1043057223 8:75454086-75454108 AGGGAGAAAGGAAGAGAGGGAGG - Intronic
1043142769 8:76610668-76610690 AGGGTGTGCCAAAGAGAGGCAGG + Intergenic
1043335462 8:79170996-79171018 AGGGAGAGATAAAGAGAGGTTGG - Intergenic
1043526625 8:81104701-81104723 GGGGAGAAGCAAGGAGAGGATGG - Intronic
1043717729 8:83507575-83507597 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1043746939 8:83886196-83886218 AAGGAGATGGAAAGGGAGGCAGG + Intergenic
1043837904 8:85066258-85066280 AGGTGAAAGCGAAGAGAGGCTGG - Intergenic
1043967667 8:86497404-86497426 ATCAAGAAACAAAGAGAGGCTGG + Intronic
1043980973 8:86638935-86638957 AGAGAGAAGGAAAGGGAGGAGGG - Intronic
1044275461 8:90294392-90294414 AGGTAGAAGAAAAAAGAGGAAGG - Intergenic
1044319258 8:90784260-90784282 AAAGAGATGTAAAGAGAGGCAGG - Intronic
1044417265 8:91951247-91951269 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1044633990 8:94304147-94304169 AGGGAATAGAAAGGAGAGGCAGG - Intergenic
1044760271 8:95510392-95510414 AGGGGGAAGCAAAGAAATGGTGG - Intergenic
1044922167 8:97178363-97178385 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1045253620 8:100501471-100501493 AGGGAGAAGCGGAGACAGGGAGG + Intergenic
1045349275 8:101323311-101323333 AGGGGAAAGGAAAGAAAGGCAGG - Intergenic
1045722948 8:105135349-105135371 AGGTAGATGCACAGAGATGCTGG + Intronic
1046440186 8:114244625-114244647 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1046547905 8:115674597-115674619 AGGGAGAAGGAGGGAGAGGAAGG - Intronic
1046724827 8:117663014-117663036 TTGGAGAAGCAAATAAAGGCAGG + Intergenic
1046742010 8:117839603-117839625 AGAGAGTAGAATAGAGAGGCTGG - Intronic
1046934841 8:119875667-119875689 AGGTAAAAGCAAAGAGAGGCTGG + Intronic
1046993271 8:120485917-120485939 AGGGAAAGGCAAAGTGAGTCAGG - Intronic
1047218636 8:122900331-122900353 AGGGAGAAAGCAAGAGAGTCAGG + Intronic
1047414739 8:124655049-124655071 AGAGAGCAGAAAAGAGAGGGTGG - Intronic
1047680267 8:127247571-127247593 AGGGAGAAGCATCTGGAGGCTGG + Intergenic
1047699526 8:127435004-127435026 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1047797184 8:128269497-128269519 AGGGAGAAAGAAAGAGAGAGGGG - Intergenic
1047953678 8:129956835-129956857 AGAAAGAAAGAAAGAGAGGCTGG - Intronic
1048097770 8:131313481-131313503 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1048168257 8:132082658-132082680 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1048287318 8:133151919-133151941 AGGGAGAAGGCAGCAGAGGCAGG - Intergenic
1048324480 8:133428576-133428598 AGAGAGAAGCATAGAGTGGCTGG - Intergenic
1048338400 8:133520227-133520249 AGGGAGGAACATAGAGAGGCTGG + Intronic
1048363111 8:133715144-133715166 AGGGAGAAAGAAAGGGAGGGAGG - Intergenic
1048408106 8:134143213-134143235 AGGAAGAAAGAAAGAGAGGAAGG - Intergenic
1048583553 8:135751006-135751028 AGGGTGATGAAGAGAGAGGCAGG - Intergenic
1048585255 8:135769575-135769597 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1048676438 8:136788279-136788301 AGGGAGGAGAAAAGGGAGGGAGG + Intergenic
1048728254 8:137410700-137410722 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1048824722 8:138412876-138412898 AGGGAGCAGGAGAGAGAGTCAGG - Intronic
1048872353 8:138810125-138810147 AAGGAGGAGGAAAGAGAGGGAGG + Intronic
1048963814 8:139600700-139600722 AAGGAGCAGCAAAAAGGGGCAGG + Intergenic
1049128742 8:140817079-140817101 AGGAAGGGGCAAAGAAAGGCGGG + Intronic
1049198893 8:141330302-141330324 AGGAAGAGGGAAGGAGAGGCAGG - Intergenic
1049200264 8:141336674-141336696 AGGGAGGAGGAGAGACAGGCAGG - Intergenic
1049245670 8:141561025-141561047 GGAGAAGAGCAAAGAGAGGCAGG - Intergenic
1049475258 8:142794313-142794335 AGGGAGAGGCAGAGGGAGGGTGG - Intergenic
1049478651 8:142809576-142809598 AAGTACAAGCACAGAGAGGCGGG + Intergenic
1049870513 8:144971706-144971728 AGGGGAAAGGAAAGAGAGGAAGG - Intergenic
1049877373 8:145033596-145033618 AGAGAGAAGGAAAGAGAGAGAGG + Intergenic
1050099383 9:2102295-2102317 AGAGAGAGGCAAGGAGAGGTAGG - Intronic
1050117784 9:2278848-2278870 AGTGAAAAGCGAAGAGAGGCTGG - Intergenic
1050231653 9:3532276-3532298 AGGGAGAGGGAGAGAGAGGGAGG - Intergenic
1050334621 9:4578532-4578554 AGGGAGAAGGACAGAGAGATGGG + Intronic
1050479531 9:6075410-6075432 AAAGGGAAGCAAAGAGAGCCTGG - Intergenic
1050829969 9:9998409-9998431 AGAGAGGAGAAAAGAGAGACTGG - Intronic
1050879565 9:10681862-10681884 AGGGCAAAGGAAAGTGAGGCAGG + Intergenic
1051052801 9:12951631-12951653 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1051159220 9:14187093-14187115 AGACAGAAGCAGAGAGAGACAGG - Intronic
1051222093 9:14859627-14859649 AGGGAAAAGAACAGAGAGGCTGG - Intronic
1051261838 9:15272278-15272300 ATGGAGAAGCAAAGAGACTTTGG - Intronic
1051507727 9:17844277-17844299 AGGGAGAAACTAGGAGAGGTAGG - Intergenic
1051675091 9:19551105-19551127 AGGGAGAAATGAAGAGAGGTCGG - Intronic
1051738145 9:20224651-20224673 AGGGAGAAGAGAAGAGGGGAGGG + Intergenic
1051741205 9:20254013-20254035 AGAGAGAGACAAAGACAGGCAGG + Intergenic
1051888102 9:21916037-21916059 AGAGAGAAGGAGAGAGAGGGAGG + Intronic
1052380906 9:27770023-27770045 TTGTAGAAGCAAAGAAAGGCAGG + Intergenic
1052515951 9:29480099-29480121 AGGGAAAAGGAAAGAGGGGAAGG - Intergenic
1052588140 9:30455924-30455946 AGGAATGAGCAAAGAAAGGCAGG + Intergenic
1052662315 9:31449752-31449774 AGGGAGAAGAAAAGAGAGAGGGG - Intergenic
1052720469 9:32166952-32166974 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1052728933 9:32262717-32262739 ATGGAGCAGCAATGAGGGGCAGG - Intergenic
1053098184 9:35347408-35347430 CAGTAGTAGCAAAGAGAGGCTGG + Intronic
1053398204 9:37794384-37794406 AGGGAGAAAGAAAGAAAGGCAGG + Intronic
1054735403 9:68745207-68745229 GGGGAGAAGCAGGGAGGGGCAGG + Intronic
1054807314 9:69407173-69407195 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1054935634 9:70684432-70684454 AGGGAGGACCAAGGGGAGGCTGG + Intronic
1054957861 9:70933927-70933949 AGGTAGGAGCAAAGGAAGGCAGG + Intronic
1055233242 9:74088947-74088969 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1055407139 9:75987169-75987191 AGGCAGAAGGAATGGGAGGCAGG - Intronic
1055433906 9:76272881-76272903 TTGGAGAAGCAAGAAGAGGCAGG - Intronic
1055514025 9:77019498-77019520 AGAGAGAAGCAGAGAGGGCCTGG + Intergenic
1055944645 9:81681947-81681969 AGGAAGAAGCACAGACAGGCCGG + Intronic
1056097460 9:83270013-83270035 AGGAACAAGAAAAGAGAGGTGGG + Intronic
1056197330 9:84240940-84240962 AGAGAGAAGGAAAGTGAGGTTGG + Intergenic
1056231801 9:84554144-84554166 AGGGAGAAGCTGAGATAAGCTGG + Intergenic
1056363876 9:85883984-85884006 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1056578459 9:87873090-87873112 AGGGAGAAAGACAGAGAGGAGGG + Intergenic
1056697579 9:88872854-88872876 AGGGAGAAATAAAGGGAGGGAGG + Intergenic
1057302504 9:93894958-93894980 AGGGAGAAGCAGGGAGATGCAGG - Intergenic
1057962955 9:99474402-99474424 GGGGAGGAGGAGAGAGAGGCTGG - Intergenic
1058379981 9:104367072-104367094 AGGGATAAGGAAAAAGAGGAGGG - Intergenic
1058598318 9:106640324-106640346 AGGGAGAGAGAAAGAGAGGGAGG + Intergenic
1058612563 9:106791485-106791507 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1058624163 9:106916947-106916969 AGGGACAAGAAAAGAAAGGGAGG - Intronic
1059349644 9:113655485-113655507 AGGGAGCAGAAAAGAGACGAGGG - Intergenic
1059371516 9:113843346-113843368 AGTGAGAAGTACAGAGTGGCAGG + Intergenic
1059449368 9:114360686-114360708 TGGGAGCAGGAAAGAGAGCCTGG - Intronic
1059546005 9:115177046-115177068 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1059632298 9:116137571-116137593 AGGGAAAAATGAAGAGAGGCAGG - Intergenic
1059713379 9:116889963-116889985 AGGAAGAAAGAAAGAGAGGAGGG + Intronic
1059961033 9:119564718-119564740 AGGGATATGGAAAGAGAGGAAGG + Intergenic
1060010671 9:120040612-120040634 AGGCATAAGGAAAGTGAGGCTGG - Intergenic
1060442676 9:123656183-123656205 AGGCAGAGGCAAAGACAGGGTGG + Intronic
1060737705 9:126077050-126077072 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1061488076 9:130930366-130930388 AGGGAGACGCAGGGAGATGCGGG + Intronic
1061489333 9:130936552-130936574 AGGGAGCAGCAGAGGAAGGCGGG + Intronic
1061583241 9:131550357-131550379 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1061634824 9:131900922-131900944 AGGGAGAGGGAGAGAGAGGGAGG + Intronic
1061699197 9:132402623-132402645 AAGGAGAAGAAATGAGATGCTGG + Exonic
1061734556 9:132644968-132644990 GAGCAAAAGCAAAGAGAGGCTGG + Intronic
1061763718 9:132868505-132868527 AGGGAGAAGGAGTGGGAGGCTGG - Intronic
1061831563 9:133299643-133299665 AGGGAGAACCCAAAAGAGCCTGG + Intergenic
1061836090 9:133331319-133331341 AGGCAGAAGCCAAGAGAGCGGGG + Exonic
1061958560 9:133976399-133976421 AGGGTGAGGCCAGGAGAGGCAGG - Intronic
1062092087 9:134683706-134683728 AGGGAGTATCAAAGGGCGGCAGG - Intronic
1062144019 9:134978974-134978996 AGGGAGGAGAAAAGAGAGGGAGG + Intergenic
1062524471 9:136972670-136972692 AGGGAGAAGCAGAGACCTGCAGG - Intergenic
1062692120 9:137847402-137847424 AGGTAAAAGCAAAGAGAGGCTGG - Intronic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203363316 Un_KI270442v1:236538-236560 AGGGAGAAAATAAGAAAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1185714435 X:2330053-2330075 AGAGAGAAGCAGAGAGACGGCGG + Intronic
1185999255 X:4989537-4989559 AGGGAGAAGAAAAAAGAAGTAGG - Intergenic
1186076748 X:5887801-5887823 ACACAGAAGCAAGGAGAGGCAGG - Intronic
1186161967 X:6786728-6786750 AGCTATAAGCAAAAAGAGGCAGG - Intergenic
1186532847 X:10314677-10314699 GGGAAGGAGCAATGAGAGGCAGG + Intergenic
1186716624 X:12258944-12258966 AGGGAGAAATGAAGAGAGGTTGG - Intronic
1186774249 X:12848125-12848147 AGAGAGAAGGAAAGAAAGGGTGG - Intergenic
1187296574 X:18007455-18007477 ATGGAGAAGGGAAGAGATGCTGG - Intergenic
1187414250 X:19078894-19078916 GGGGAGAAAAAGAGAGAGGCAGG + Intronic
1187934418 X:24321875-24321897 AAGGCCAGGCAAAGAGAGGCTGG - Intergenic
1188200790 X:27291563-27291585 AGGTAAAAGCAAAGAGGGGCTGG + Intergenic
1188300932 X:28505143-28505165 AGGTAAAAGCAAAGAGAGGCTGG + Intergenic
1188351756 X:29140098-29140120 AGAGAGAAGGAAAGAGAGATGGG + Intronic
1188463207 X:30451524-30451546 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1188801085 X:34530762-34530784 AGAGAGAAAAAAAGAGAGGAGGG + Intergenic
1188803760 X:34561994-34562016 AGGGAGAGGGAAAGAGATGTTGG + Intergenic
1189264506 X:39703402-39703424 AGGAAGAAAGGAAGAGAGGCCGG - Intergenic
1189325071 X:40106885-40106907 AGGGAGAAGCGTCGGGAGGCCGG - Intronic
1189334926 X:40165242-40165264 AAGGAATAGCAAAGAGACGCAGG + Intronic
1189683438 X:43539999-43540021 AGAGAGAAACAAAGAGAGAAGGG + Intergenic
1190439575 X:50463604-50463626 AGAGAGAAACAGAGAGAGGAAGG - Intronic
1190902069 X:54685540-54685562 AGGAAGAAGGAAAGAAAGGAAGG - Intergenic
1191021226 X:55862498-55862520 ATGGAGAATCCAGGAGAGGCAGG + Intergenic
1191761454 X:64652197-64652219 AGGTGAAAGCAAAGAGAGACTGG - Intergenic
1191805636 X:65132073-65132095 AGGTAAAAGCAAAGAGAGGCTGG + Intergenic
1191976238 X:66874708-66874730 AGGGAGAAGCAAGGTGAGATTGG + Intergenic
1192369098 X:70498709-70498731 AGGAAGAAGCATAGAGAAGAAGG - Intronic
1192913967 X:75634709-75634731 AGGTAAAAGCAAAGAGAGGCTGG + Intergenic
1193853778 X:86573132-86573154 AGAGAGGAGGAAAGAGAGGGAGG + Intronic
1193863281 X:86697294-86697316 AGGGAGAAGCAAAAACAAGGAGG + Intronic
1194150059 X:90313152-90313174 GGGGAGAAGGAAAGAGAGAGAGG - Intergenic
1194367275 X:93026216-93026238 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1194660856 X:96627315-96627337 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1194767621 X:97860448-97860470 AGGAAGAAGCTGAGGGAGGCTGG + Intergenic
1196047976 X:111275994-111276016 AGGGTGAAGTAAAGATAGGGAGG + Intergenic
1196124257 X:112082571-112082593 AGAGAAAAGCAAAGAGGGGTGGG + Exonic
1196220815 X:113111142-113111164 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1196243482 X:113370455-113370477 AGCGAGTAGCAGAGAGCGGCGGG - Intergenic
1196439536 X:115705761-115705783 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
1196525302 X:116723381-116723403 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1196572669 X:117282439-117282461 AAGTTAAAGCAAAGAGAGGCTGG - Intergenic
1196585280 X:117420911-117420933 AGGTAAAAGCAAAGAGAGGCTGG - Intergenic
1196586612 X:117436473-117436495 TAGGAGAAGCAAAGAGTGGAGGG + Intergenic
1196729099 X:118923033-118923055 AGGGAGAAAGAAAGAAAGGAAGG + Intergenic
1196892300 X:120302871-120302893 AGAGAGAAGCAAAGCGAGAGGGG - Intronic
1196943269 X:120798637-120798659 AGGGAGAAGCAATGTCAGGATGG + Intergenic
1197499889 X:127229877-127229899 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1197606796 X:128594574-128594596 ATAAAGAAGTAAAGAGAGGCCGG - Intergenic
1197666284 X:129227369-129227391 AGGCAGCAGCACAGAGAGTCTGG + Intergenic
1198217444 X:134568945-134568967 AGAGAGAAAAAGAGAGAGGCAGG - Intronic
1198260161 X:134958706-134958728 GGGGAGAAGCAAATAAAGGGTGG - Intergenic
1198507245 X:137312909-137312931 GGGTAGAAGGAAAGAGAGGGTGG - Intergenic
1198598616 X:138262090-138262112 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1198599227 X:138266742-138266764 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1198790494 X:140340129-140340151 AGAGAGAAGGAAAGAGAGCAAGG - Intergenic
1199576650 X:149318946-149318968 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1199827046 X:151510534-151510556 AGGGAGAAACGGAGAGAGGTAGG + Intergenic
1200009779 X:153112282-153112304 AGGGAGGAACCAAGAGAGGCGGG - Intergenic
1200029821 X:153287640-153287662 AGGGAGGAACCAAGAGAGGCGGG + Intergenic
1200051157 X:153432562-153432584 AGGGAGAGAAAAAGAGAGGAAGG + Intergenic
1200072348 X:153535481-153535503 ACGGAAAGGCAAAGAGAGGGAGG - Intronic
1200379737 X:155822293-155822315 AGGAAGAGGAAAAGAGAGGGAGG + Intergenic
1200496487 Y:3890230-3890252 GGGGAGAAGGAAAGAGAGAGAGG - Intergenic
1200675485 Y:6142475-6142497 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1201146286 Y:11067095-11067117 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146388 Y:11067409-11067431 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201194513 Y:11478687-11478709 AGGGAGAAGCCACCAGAAGCTGG - Intergenic
1201256355 Y:12112015-12112037 AGGGAAAAGAGAAGAGAGGGAGG - Intergenic
1201526029 Y:14935465-14935487 ATGGAGAAGGAAGGAGAGACAGG - Intergenic
1201625604 Y:16011741-16011763 AGAGAGGAGGAAAGAAAGGCAGG + Intergenic
1201733709 Y:17234454-17234476 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1202062255 Y:20899855-20899877 AGGTAAAAGCAAAGAGAGGCTGG - Intergenic
1202076365 Y:21041510-21041532 AGGTGAAAGCAAAGAAAGGCTGG + Intergenic