ID: 1162463577

View in Genome Browser
Species Human (GRCh38)
Location 19:10827964-10827986
Sequence GTGTTTGAACAGAAGCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162463575_1162463577 19 Left 1162463575 19:10827922-10827944 CCAGAAAGGACAATGTATAAAAT 0: 1
1: 0
2: 1
3: 46
4: 357
Right 1162463577 19:10827964-10827986 GTGTTTGAACAGAAGCCAGGTGG 0: 1
1: 0
2: 2
3: 24
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162463577 Original CRISPR GTGTTTGAACAGAAGCCAGG TGG Intronic
900345824 1:2209838-2209860 CTGTCTGGACAGAAGGCAGGAGG - Intronic
902129193 1:14244094-14244116 TTGTTTTAACAGAAGCCACATGG - Intergenic
902139567 1:14341526-14341548 GTGTTTGCAGAGCAGCCAAGAGG - Intergenic
902656752 1:17874350-17874372 GTATTCCAACAGAAGCCAGATGG + Intergenic
902758738 1:18566959-18566981 GTCTGTGAACTGGAGCCAGGTGG + Intergenic
904290970 1:29485691-29485713 CTGTTGGCTCAGAAGCCAGGAGG - Intergenic
905198673 1:36301472-36301494 ATGTTTGAACAAAAAGCAGGGGG + Intronic
907291547 1:53416625-53416647 CTGTTTGCATAGAAGCCAGGGGG + Intergenic
907382215 1:54100563-54100585 ATGTTTGAACCAAAGCCAGAAGG + Intronic
907810924 1:57868943-57868965 GTGTTTGAACAGAACCTTGAAGG - Intronic
907990438 1:59577249-59577271 TTATTTGAACTGAAGCCAGGTGG + Intronic
908006352 1:59732960-59732982 GCGAATGAACAGAAGCCAGCAGG - Intronic
910226535 1:84941825-84941847 TTCTTGGAACAGAAGCAAGGAGG + Intronic
910395815 1:86792857-86792879 CTGTTTGAACAGTTGCCATGGGG - Intergenic
911923830 1:103801332-103801354 GTGTTAGAACAGAGGTCTGGAGG + Intergenic
913690455 1:121275020-121275042 GGATTTAAACAGAAGCGAGGGGG - Intronic
914147086 1:145004939-145004961 GGATTTAAACAGAAGCGAGGGGG + Intronic
914418820 1:147509633-147509655 GTGCTGCAACAGAAGCCAGAAGG - Intergenic
914686442 1:149984084-149984106 GTGTTTCAATAAAAGCAAGGTGG - Intronic
915296883 1:154927681-154927703 GTGTCTGAGGACAAGCCAGGTGG - Intronic
917231781 1:172845471-172845493 GTATTTGATCAGAAGCTAGCAGG - Intergenic
918478482 1:184951767-184951789 GTGTAAGAAGAGAAGCCATGGGG - Intronic
919062379 1:192649726-192649748 GACTTTGAACAAAAGCCTGGAGG - Intronic
919493747 1:198238167-198238189 GTGTTCCAACTGAAGCAAGGAGG - Intronic
920477773 1:206293508-206293530 GGATTTAAACAGAAGCGAGGGGG - Intronic
922022344 1:221717421-221717443 GTGTTTGAAAAGAAAAGAGGGGG + Intronic
922743594 1:228030677-228030699 GTGTTTGAGAAGCAGCCAAGAGG - Intronic
922844251 1:228670711-228670733 GTGTTGGAGCAGAGGCCTGGTGG + Intergenic
923389744 1:233502319-233502341 GTGTTTGAAGAGTAGCCAAGAGG + Intergenic
923650389 1:235867537-235867559 GTGTTTGAACAGGAGTCGGTTGG - Intronic
924944344 1:248836053-248836075 GTGTTTGAACAGAAGTCTGAAGG + Intergenic
1063048808 10:2422596-2422618 GTCTTGGAACTGAGGCCAGGCGG + Intergenic
1063240251 10:4161902-4161924 GTGTTGGAAGAGAAGCCTGGTGG - Intergenic
1066253912 10:33660584-33660606 CTCTTGGAACAGCAGCCAGGGGG - Intergenic
1067542514 10:47166215-47166237 GTGTGTGAGCAAAAGCCAGAAGG + Intergenic
1067572193 10:47379782-47379804 GTGTTGGAAATGAAGCCCGGAGG - Intronic
1067984079 10:51122368-51122390 GTGTTTGAACAAAAGCCTCTTGG - Intronic
1068306326 10:55213026-55213048 GTGTTTGAACAGAAGGAATTAGG - Intronic
1068693969 10:59946236-59946258 GTGTTTGAGAAAGAGCCAGGAGG + Intergenic
1069273615 10:66562362-66562384 GTGTGTGAACATCAGCCAGTTGG - Intronic
1070228239 10:74534848-74534870 TTGTTGGAACAGAAGTAAGGTGG - Intronic
1070261469 10:74859908-74859930 GTGTATGAACACAAGCCTGCAGG + Intronic
1070659752 10:78296072-78296094 CCCTTTGCACAGAAGCCAGGGGG + Intergenic
1071376879 10:85014906-85014928 GTTTTTGAAAATAAACCAGGAGG + Intergenic
1071438731 10:85670664-85670686 GGGTGGGAACAGAAGCCAGTTGG - Intronic
1071576424 10:86730055-86730077 GTGTTTGAAAACATCCCAGGTGG - Intronic
1072618292 10:97063907-97063929 GTGTTTGAAAATGAGCCAGGTGG - Intronic
1073345329 10:102778554-102778576 GTGTCTGAACAGTTGCCTGGTGG + Intronic
1074439076 10:113459165-113459187 GTGTTTGAAGGGAATCCGGGAGG - Intergenic
1074555095 10:114481623-114481645 GTGTTTGGAGAGGAGGCAGGAGG + Intronic
1075260463 10:120959016-120959038 CTGGGTGAACAGAAGACAGGTGG - Intergenic
1080564152 11:33492603-33492625 GTGTTTGAAAAGAAATCAAGGGG - Intergenic
1082864784 11:57888641-57888663 CTGTTTTAACAGGAGCCAGATGG - Intergenic
1085808664 11:79660273-79660295 GAATTTGAACAGAAGTCAGCTGG - Intergenic
1088240365 11:107768101-107768123 GTGTTTGAACAGAACCTTGAGGG - Intergenic
1092081550 12:5720642-5720664 GTGTTTTCCCAGAAGCCATGAGG + Intronic
1093400774 12:18744048-18744070 CTGATGGAATAGAAGCCAGGGGG - Intergenic
1096269250 12:50151190-50151212 GTGTAGGGACAGAAGCCAGAGGG - Intronic
1096568215 12:52498827-52498849 GTGTTTGACCAGAAGGCCGATGG - Intergenic
1098636561 12:72791363-72791385 GTGATTTCACAGAAGCCAGAGGG - Intergenic
1098710191 12:73748107-73748129 GTGTTGAAACAAAAGGCAGGAGG - Intergenic
1098823571 12:75264879-75264901 GTGTTTGAAAAGCAGTGAGGTGG - Intergenic
1100403197 12:94250130-94250152 ATGTTTGAAGAGCAGCAAGGAGG + Intronic
1101139717 12:101782809-101782831 ATGTTTGAAGAAAAGCCAGGAGG - Intronic
1101642787 12:106600764-106600786 GTGTGTGAGGAGGAGCCAGGAGG - Intronic
1102767480 12:115446169-115446191 GGGTTTGAACAGTGGCCAGTGGG - Intergenic
1103180917 12:118910607-118910629 GTTTTTCAGCAGAAGGCAGGTGG + Intergenic
1103883547 12:124184643-124184665 GTGTGTGAGCTGACGCCAGGAGG - Intronic
1104709845 12:130977763-130977785 GTGTGGGTACAGACGCCAGGCGG + Intronic
1106426831 13:29639132-29639154 ATGTTTGAAAAGAAGAAAGGTGG + Intergenic
1107800952 13:44107593-44107615 AGGATTGGACAGAAGCCAGGTGG + Intergenic
1109102641 13:58205529-58205551 GTTATAGAACAGAAGCAAGGGGG - Intergenic
1111948679 13:94692319-94692341 GTGTTTGAGCAGCAGCAAGAAGG + Intergenic
1112199434 13:97260752-97260774 GTGGTTAAACAGAGGCCTGGTGG + Intronic
1112930667 13:104732399-104732421 GTGTTGGAAGAGAGGCCTGGTGG + Intergenic
1114136024 14:19852036-19852058 GTCTATGAATAGAATCCAGGAGG + Intergenic
1115860686 14:37682930-37682952 GTGATTCAAAAGAAGCCAAGTGG + Intronic
1117069922 14:52047320-52047342 GTGACTGAGCAGAGGCCAGGAGG + Intronic
1118991005 14:70796872-70796894 GTCTTTGAAAAGAAGCCCGGAGG - Intronic
1121927709 14:97944063-97944085 GTGTTTCACCAGAAGCCAGTTGG - Intronic
1122033498 14:98931074-98931096 CTGTGTGCACAGAAGACAGGTGG - Intergenic
1122841947 14:104469753-104469775 GTCTGTGAGCAGAAGCCGGGTGG + Intergenic
1124101542 15:26698749-26698771 ATCTGTGAACACAAGCCAGGCGG - Intronic
1124577964 15:30926198-30926220 GCCTTTGTACAGAAGTCAGGGGG + Intronic
1126735427 15:51727709-51727731 CAGTATGTACAGAAGCCAGGGGG - Intronic
1127050803 15:55081440-55081462 GGGTGTCAACAGAGGCCAGGTGG + Intergenic
1128527289 15:68421301-68421323 GTGTTTGAAGAACAGCCCGGAGG + Intronic
1128913856 15:71541910-71541932 GTGTGTGAACACAAGACAGGAGG + Intronic
1128931114 15:71705640-71705662 GTGTCAGGACAGCAGCCAGGAGG + Intronic
1129751316 15:78066555-78066577 GCATTTTAACAGAACCCAGGAGG + Intronic
1129923903 15:79344898-79344920 GTGTTTGAGCAGTAGCCGGAAGG + Intronic
1133105893 16:3509275-3509297 GTGTTTGAGGAAAAGCAAGGAGG + Intronic
1133142748 16:3759978-3760000 GTGAGTGAACATGAGCCAGGTGG - Intronic
1134041325 16:11070733-11070755 GTGTTTGAAGAAGAGCAAGGAGG - Intronic
1134216975 16:12323715-12323737 GTGTGGGCACTGAAGCCAGGTGG + Intronic
1134332963 16:13267118-13267140 ATGTTTAAAAAGAAGCCAAGTGG + Intergenic
1134335565 16:13296407-13296429 GTTTTTGAACAGCACGCAGGGGG + Intergenic
1135236688 16:20763429-20763451 GTGTTTGAGAAAAAGCAAGGAGG + Intronic
1136521178 16:30796877-30796899 GTGTTTGAAAATAAACCAGCTGG - Intergenic
1139198264 16:64946535-64946557 GTGTGTGAAGAGAAGCCAGGAGG + Exonic
1140022188 16:71249052-71249074 GAGTTTGCTCAGAAGCCAGGTGG + Intergenic
1140479512 16:75254818-75254840 CTGTTTGTACAGAAAACAGGTGG + Intronic
1142038341 16:87876563-87876585 GTGTTCAAACAGAAGCTAGAAGG - Intergenic
1142468595 17:149391-149413 GTGTGTGAACAGAAGTGCGGTGG - Intronic
1144142517 17:12363330-12363352 GTTTTTGAACAAATGCCAGATGG + Intergenic
1144250487 17:13411763-13411785 GTGTTTTCAAAGAAGCCATGAGG - Intergenic
1144575832 17:16428792-16428814 GTGTGGGAGCAGAATCCAGGTGG - Intronic
1145099949 17:20066568-20066590 CTGTTTTTACAGAATCCAGGAGG + Intronic
1146400122 17:32495172-32495194 GTGGTTGAACAGACGCCACCAGG + Intronic
1146553590 17:33803702-33803724 TTGTCTGAATAGAAGGCAGGCGG - Intronic
1148777460 17:50103751-50103773 CTGTGTGAACAGAAGCGTGGAGG + Intronic
1150114920 17:62538925-62538947 GTTTTTGAAAAGAAGGCAAGTGG + Intronic
1151373510 17:73666174-73666196 GTGTTGGAGGAGAAGCCTGGTGG + Intergenic
1151910534 17:77079915-77079937 TTGTTGGGCCAGAAGCCAGGGGG + Intergenic
1157592838 18:48845962-48845984 GTGTTTGGACTGGAGGCAGGGGG - Intronic
1159343791 18:67171322-67171344 TTGTATGAACAGAAGCCACCAGG - Intergenic
1161683315 19:5691311-5691333 GTGTTTGGTCAGACGCTAGGGGG - Exonic
1162463577 19:10827964-10827986 GTGTTTGAACAGAAGCCAGGTGG + Intronic
1163332161 19:16646643-16646665 GTGTTTCCACAGAAGACATGTGG - Exonic
1167644663 19:50699420-50699442 GTGTTTGGAGAGAAGCCAGATGG + Intronic
926616245 2:14999431-14999453 GTGTTGGAGCAGAGGCCTGGTGG + Intergenic
927272098 2:21222697-21222719 GTGTTTGAATAATAGCAAGGAGG + Intergenic
928504943 2:31941223-31941245 GTGTTTGAGGAGAAGCAAGGAGG - Intronic
929446202 2:42003275-42003297 GTGGTGGAAAAGGAGCCAGGTGG - Intergenic
935728165 2:106042216-106042238 CTGGTTCAACAGAAGCCAAGTGG - Intergenic
935759447 2:106306490-106306512 GTGTTGGAAGAGGAGCCTGGTGG + Intergenic
936440738 2:112550268-112550290 ATGTTCCAACAGAGGCCAGGTGG - Intronic
941825979 2:169897586-169897608 CTGCTTGAACTGAACCCAGGAGG - Intronic
942031430 2:171965374-171965396 GTGTTTGTGCAAAATCCAGGTGG - Exonic
942847287 2:180442228-180442250 GTGTTGGAAAAGAGGCCTGGTGG - Intergenic
942913482 2:181274524-181274546 GTGTTAGAACACCAGGCAGGTGG + Intergenic
943718485 2:191178299-191178321 CTGTATGAACAGAAGACATGGGG + Intergenic
947094776 2:226553569-226553591 GTTTCTGAATATAAGCCAGGTGG + Intergenic
1169899067 20:10534689-10534711 GTGCATGAACAGAGGCCAGCAGG + Intronic
1170472729 20:16684379-16684401 GTCTTTCAACACAAGGCAGGTGG + Intergenic
1171199736 20:23231531-23231553 GTGACTGAACAAATGCCAGGTGG - Intergenic
1171956542 20:31468211-31468233 GGGTTTGAACAGCAGCAAGGAGG - Intronic
1172306163 20:33882309-33882331 CTGTTTGAGCAGAAGCCGGAGGG - Intergenic
1172631788 20:36383496-36383518 GTGTCTGAAATGAAGCCAGTAGG + Intronic
1172704846 20:36875632-36875654 GTGTTAGAACAGAAGCTAGAAGG - Intergenic
1172989241 20:39020746-39020768 TTGCTTGAACTGAACCCAGGAGG - Intronic
1173747081 20:45445947-45445969 GTGTTTGAGCAGCAGCGATGAGG + Intergenic
1174203214 20:48821402-48821424 GATCTTGAACAGAAGCCAGGTGG - Intronic
1175461396 20:59154339-59154361 GTGTTGGGACAGGACCCAGGTGG + Intergenic
1177160870 21:17546616-17546638 GTGTTGGAAGAGAGGCCTGGTGG - Intronic
1177396983 21:20549216-20549238 GTGTTGGAGGAGAAGCCTGGTGG + Intergenic
1177421883 21:20870094-20870116 CTGTTCAAACAGAAGCAAGGAGG - Intergenic
1177602534 21:23334917-23334939 GTGTTGGAAGAGAGGCCTGGTGG + Intergenic
1177752655 21:25304725-25304747 GTGTCAGAACAGAAGGAAGGCGG + Intergenic
1178296986 21:31418373-31418395 GTGTCTAAACAGTAGCCAGAGGG - Intronic
1178433540 21:32537203-32537225 GCATTTGAGCAGAAACCAGGAGG + Intergenic
1179251927 21:39677904-39677926 GCGTGTGAAAAGAAGCAAGGGGG + Intergenic
1180671195 22:17554873-17554895 GTGTTTGTGCAGAAGCAGGGAGG + Intronic
1181444642 22:22959633-22959655 GAATTTGAAAAGAAGCTAGGAGG + Intergenic
1181845044 22:25700040-25700062 GTGTTTCAGCAGAAGCAAGGGGG - Intronic
1184356221 22:43981191-43981213 GTGTTTTAATAGAATCCACGTGG + Intronic
1184781423 22:46651572-46651594 GTGTGTGAGCAGAGTCCAGGTGG - Intronic
1185089749 22:48759198-48759220 ATGATTGAACAGAGTCCAGGAGG - Intronic
1185179852 22:49353007-49353029 GGGTCTCAACAGAAGCCATGGGG - Intergenic
951589209 3:24245003-24245025 CTGTTTGAACAAAGGTCAGGGGG + Intronic
952540493 3:34362545-34362567 CAGCTTGAAAAGAAGCCAGGTGG + Intergenic
954655269 3:52190639-52190661 GTGCTGGACCAGAAGCCAGAAGG + Intergenic
955517836 3:59745679-59745701 TTGTTTTAAAAGAAGCCAGAAGG - Intergenic
956185161 3:66555527-66555549 ATGTTTTACCAGAAGCCAAGAGG + Intergenic
956220001 3:66892872-66892894 GAGGGTGAGCAGAAGCCAGGTGG + Intergenic
957293272 3:78305383-78305405 GTGGTGGAAGAGAAGCCTGGTGG + Intergenic
957552957 3:81730616-81730638 GTTTCACAACAGAAGCCAGGAGG + Intronic
958560377 3:95742000-95742022 GTGTTGGAAGAGGGGCCAGGTGG - Intergenic
959689442 3:109182725-109182747 ATGTTTGAAGAGCAGCAAGGGGG - Intergenic
960712535 3:120545373-120545395 TTTTTTGAGCAGAATCCAGGGGG - Intergenic
962120632 3:132556672-132556694 ATGTTGGAACAGCAGCCAGAAGG + Intergenic
962895708 3:139712711-139712733 GTGTTTGCCAAGAAGCCAAGAGG + Intergenic
963775062 3:149430417-149430439 ATGTTTAAACAGAAGCCAGATGG - Intergenic
964046451 3:152333427-152333449 GTGTTTGGCCAGAACCCTGGTGG - Intronic
967768000 3:193303327-193303349 GTGTGAGAACTCAAGCCAGGAGG - Intronic
968726106 4:2248517-2248539 GTGTTTGAAATGAAGCCTGGGGG + Exonic
970760140 4:19475828-19475850 GTGTTTGAAAAACAGCAAGGAGG + Intergenic
970841576 4:20477606-20477628 GAATTTGAACAGAAGCCAAAGGG + Intronic
971881401 4:32379260-32379282 GTGTTTTACCAGATCCCAGGTGG + Intergenic
975302335 4:72804943-72804965 GGGTATGAACAGAGGCCAAGTGG + Intergenic
975526704 4:75358643-75358665 TTATTTGAACAGAAGCCAACTGG + Intergenic
978168421 4:105637530-105637552 ATCTTTGAAGAGAAGCCAGGAGG - Intronic
983603218 4:169553981-169554003 GTATTTAAACAGATGCCAAGAGG - Intronic
987002670 5:13675969-13675991 GTGGATGAACAGGAGGCAGGTGG + Intergenic
988901851 5:35741422-35741444 GTGTTTGAAGAACAGCAAGGAGG + Intronic
989260839 5:39418302-39418324 GTGTTTGAACATATGTCAGAGGG - Intronic
991973255 5:72161231-72161253 GTGATTGATCCAAAGCCAGGTGG - Intronic
992082383 5:73247259-73247281 GTATTTGACCAGAAACCAGACGG + Intergenic
992984346 5:82212218-82212240 GTGTGGGTACAGAAGTCAGGAGG - Intronic
992984919 5:82218466-82218488 GTTTTGGTACAGCAGCCAGGCGG + Intronic
994055905 5:95414749-95414771 ATATTTGAACAGAAACCTGGAGG - Intronic
996015350 5:118527924-118527946 GTGTTTGAGTAGTAGACAGGTGG - Intergenic
996488243 5:124061911-124061933 GGGTTTGAACTGAGTCCAGGTGG - Intergenic
999438429 5:151582259-151582281 GTGTGTGGACAGAACCCAGGGGG - Intergenic
999670791 5:153957519-153957541 GTGTTTGCACAGCAGTCTGGAGG + Intergenic
1000626590 5:163546287-163546309 CTGGTTGAACTGAAGTCAGGAGG - Intergenic
1001242580 5:170081598-170081620 GGTTTTGACCAGGAGCCAGGAGG + Intronic
1001600555 5:172925604-172925626 GTGTTTGAATAGAAGGAAGGAGG - Intronic
1002349616 5:178574825-178574847 TGGTTTGAAGAGAAGTCAGGTGG - Intronic
1002755147 6:151895-151917 GTGTGTGCACAGCAGCCACGTGG + Intergenic
1003017009 6:2476170-2476192 GTTGTTGAACAGAAGCCAGGGGG + Intergenic
1006501116 6:34459384-34459406 GTCTTTGAACCCAAGCCTGGTGG - Intergenic
1010914368 6:81597601-81597623 TTCTTTAAACAGAAGCCACGAGG - Intronic
1011247726 6:85337156-85337178 ATGTTTGAAGATAACCCAGGGGG - Intergenic
1011718052 6:90127675-90127697 GAGTTAAAAAAGAAGCCAGGTGG + Intronic
1011898387 6:92260800-92260822 GTGTTGGAACAGGGGCCTGGTGG + Intergenic
1015594328 6:134851737-134851759 GTGAGTTAACAGAAGGCAGGCGG + Intergenic
1015985347 6:138879053-138879075 GTGTTTCAGCAGCAGGCAGGAGG - Intronic
1016899243 6:149084838-149084860 AAGTTTGAACAGAAGCAATGTGG + Intergenic
1017310604 6:152972373-152972395 ATTTCTGAACAGAAGCCAGTGGG + Exonic
1017361916 6:153583359-153583381 ATGTCTGAAAAGAAACCAGGGGG + Intergenic
1017379335 6:153810333-153810355 GTGTTTGAAGAGGGGCCTGGTGG + Intergenic
1017953515 6:159158907-159158929 GTGTTGGAAGAGAGGCCTGGTGG - Intergenic
1018731069 6:166650867-166650889 GTGACTGAACAGAACCCATGAGG + Intronic
1019723367 7:2586954-2586976 ATCTCTGCACAGAAGCCAGGGGG - Intronic
1019973061 7:4557699-4557721 GGGTGGGATCAGAAGCCAGGAGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1023053482 7:36273369-36273391 GTTTTTTAAAAAAAGCCAGGGGG - Intronic
1024536138 7:50435945-50435967 GTGTTTGAAGTGAAGCCTGTGGG - Intergenic
1028312453 7:89355848-89355870 GTTTTTTAACAAAAGCCTGGTGG - Intergenic
1032023152 7:128421319-128421341 GTTTTAGAACAGAGGGCAGGGGG + Intergenic
1032044638 7:128594601-128594623 GTTTTTGAAAAGAAGGCAAGCGG + Intergenic
1033714535 7:143986036-143986058 GTGTGTCAACAAAAGCCAGAAGG - Intergenic
1034151626 7:148921473-148921495 TTGTTTTAACAGCAGCCAGTAGG + Intergenic
1034349892 7:150408712-150408734 GAGTGTGTACAGGAGCCAGGAGG - Intronic
1034460579 7:151195839-151195861 GGGTGTGAACAGGTGCCAGGAGG - Intronic
1036038111 8:5042421-5042443 GTGTTCTAACAGAAGAAAGGAGG - Intergenic
1037935179 8:22910652-22910674 GTGCTGGAACGGAAGTCAGGAGG + Intronic
1038414793 8:27387026-27387048 GTGTTTGAGCAGAATTCTGGGGG + Intronic
1038632148 8:29256057-29256079 GTGTCTGAAGTGCAGCCAGGTGG - Intronic
1039647464 8:39303474-39303496 GAGTTTCAACTGAAGCCAGGAGG + Intergenic
1049210334 8:141383583-141383605 GTGTTTGGACACAAGCGGGGTGG + Intergenic
1052791630 9:32880196-32880218 GTCTCTGAACAGAAGCTACGTGG + Intergenic
1053010857 9:34632319-34632341 GTGTTGGAAGAAAAGCAAGGAGG + Intergenic
1053886751 9:42649740-42649762 GGTTTGGGACAGAAGCCAGGCGG - Intergenic
1054225770 9:62457190-62457212 GGTTTGGGACAGAAGCCAGGCGG - Intergenic
1054744085 9:68836785-68836807 CTGTCTTACCAGAAGCCAGGTGG + Intronic
1056179248 9:84065671-84065693 GTGTTACTATAGAAGCCAGGAGG + Intergenic
1056844693 9:90027041-90027063 GTTTGTGAACAGAAGTCAGAAGG + Intergenic
1057460233 9:95254424-95254446 GAGGGTGAGCAGAAGCCAGGTGG + Intronic
1057882776 9:98806012-98806034 GTGTCTGAACAGAGGCCAAAGGG + Intergenic
1062173374 9:135147707-135147729 GTGCCTGGACAGAGGCCAGGTGG - Intergenic
1062663656 9:137654636-137654658 GTTTCTGCACAGAAGCCAGCTGG + Intronic
1186986181 X:15016475-15016497 GTGATGGAACAGAACCCATGTGG + Intergenic
1187371555 X:18712185-18712207 GTGTCTCAAAAGAAGCCAAGTGG + Intronic
1194817652 X:98463997-98464019 TAGTTTCAACAGAAGCCATGTGG + Intergenic
1196020492 X:110985940-110985962 GAGATTGAAGAGAAGCCAGGGGG - Intronic
1199943189 X:152643651-152643673 GGGTGTGAACAAAAGCTAGGAGG + Intronic
1200687617 Y:6270842-6270864 ATGTTTGAAAAGAAGACATGAGG - Intergenic
1200750046 Y:6936491-6936513 TTGTTTGATCAGAAGCCTGAAGG - Intronic
1201047654 Y:9903867-9903889 ATGTTTGAAAAGAAGACATGAGG + Intergenic
1201887498 Y:18901654-18901676 ATATTTGAACAGAAACCTGGGGG + Intergenic