ID: 1162465890

View in Genome Browser
Species Human (GRCh38)
Location 19:10840031-10840053
Sequence CTTTAGCCATTCATTATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 2, 2: 14, 3: 61, 4: 347}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162465885_1162465890 -7 Left 1162465885 19:10840015-10840037 CCTGGCCCCACAATTTCTTTAGC 0: 1
1: 0
2: 12
3: 47
4: 376
Right 1162465890 19:10840031-10840053 CTTTAGCCATTCATTATTGAGGG 0: 1
1: 2
2: 14
3: 61
4: 347
1162465883_1162465890 28 Left 1162465883 19:10839980-10840002 CCAAAGCGCTGAGATTACAGTTG 0: 1
1: 120
2: 7326
3: 95118
4: 236711
Right 1162465890 19:10840031-10840053 CTTTAGCCATTCATTATTGAGGG 0: 1
1: 2
2: 14
3: 61
4: 347
1162465882_1162465890 29 Left 1162465882 19:10839979-10840001 CCCAAAGCGCTGAGATTACAGTT 0: 1
1: 142
2: 8050
3: 108708
4: 341638
Right 1162465890 19:10840031-10840053 CTTTAGCCATTCATTATTGAGGG 0: 1
1: 2
2: 14
3: 61
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162465890 Original CRISPR CTTTAGCCATTCATTATTGA GGG Intronic
901547223 1:9967279-9967301 CTCAAGCCATTAATAATTGAAGG + Intronic
904348220 1:29887650-29887672 CTTTATCCAGTTATCATTGATGG - Intergenic
905525921 1:38639424-38639446 CTTTGGCTCTTCATTTTTGAAGG + Intergenic
906592739 1:47042841-47042863 CTTTATCCATTCTTGATTGATGG + Intronic
906893787 1:49748394-49748416 CTTTATCCAGTCATCATTGATGG + Intronic
908593383 1:65657708-65657730 CTTTATCCATCTATCATTGATGG - Intergenic
908907426 1:69032177-69032199 CTCTATCTATTCATCATTGATGG - Intergenic
909172066 1:72309572-72309594 GTTTGTTCATTCATTATTGAAGG + Intergenic
909530533 1:76677039-76677061 GTTTATCCATTCATTTGTGATGG - Intergenic
909822875 1:80088121-80088143 CTTTATCCATTCATCTTTGATGG + Intergenic
910660645 1:89668367-89668389 TTTTAGCTATTTATTATAGAAGG + Intronic
911222314 1:95262030-95262052 ATTTAGCCATTCACCTTTGATGG + Intergenic
911796248 1:102080233-102080255 CTTTATTCATTCACCATTGATGG - Intergenic
912842374 1:113050435-113050457 GTCTACCCATGCATTATTGATGG - Intergenic
913266026 1:117045604-117045626 CTTTATCCTTTCTTTGTTGAAGG - Intergenic
915313144 1:155014565-155014587 CTTTAGCCAATACTTATTGAGGG - Intronic
917739977 1:177952655-177952677 CTTGGGCCATTGATTTTTGATGG - Intronic
918906627 1:190504790-190504812 CTTTATCCAGTCATCATTCATGG + Intergenic
919508542 1:198430692-198430714 CTTTATCCACTCATGGTTGATGG + Intergenic
919988774 1:202694346-202694368 CTTTTTCCCTTCAATATTGAGGG + Intronic
920383727 1:205552108-205552130 CTTTGGTCATTGAATATTGAAGG - Intergenic
920447804 1:206032911-206032933 ATTTAGCCATTTCTTATTGTTGG - Intergenic
921494411 1:215820973-215820995 CTTTATCCATTCATTCATGATGG + Intronic
921869981 1:220129739-220129761 CTTTATCCATTCATCTTTGATGG + Intronic
922121257 1:222671351-222671373 CTTTAGAAATTCATTTTTGTTGG - Intronic
922147186 1:222958517-222958539 GTGTGGACATTCATTATTGAAGG + Intronic
923946630 1:238895411-238895433 ATTGAGCTATTCATTATTGAAGG - Intergenic
924392484 1:243578291-243578313 CTTTATCCATCTATCATTGATGG - Intronic
1063167471 10:3476812-3476834 CTTTACCCATTAACTTTTGAGGG - Intergenic
1063287134 10:4702267-4702289 GTTTACCCATTCACAATTGAAGG - Intergenic
1064305865 10:14165613-14165635 CTTTATCCAGTCGTTGTTGATGG - Intronic
1064701822 10:18029863-18029885 TTTTAGCCAGTCAATTTTGAAGG - Intronic
1064853111 10:19732952-19732974 CTTTAGCCATTCATAATGAAAGG - Intronic
1065426477 10:25609700-25609722 CTTTATCCATTCATCGTTGATGG + Intergenic
1065764831 10:29018785-29018807 TTTTATCCACTCATTGTTGATGG - Intergenic
1066422372 10:35274982-35275004 CACTAGCCATTCATTCTTTAAGG + Intronic
1067155236 10:43775998-43776020 CTTTCTCCAGCCATTATTGATGG - Intergenic
1067923789 10:50486915-50486937 CTTTATCCAGTCATCATTGATGG - Intronic
1068253265 10:54470950-54470972 CTTAACCCATTCATTTTTCAAGG - Intronic
1069098004 10:64283673-64283695 CTTTATCCAATCATTCATGATGG - Intergenic
1069652032 10:70055881-70055903 ATTTAGCCATTCCCTGTTGATGG - Intronic
1069730055 10:70605166-70605188 GTTTACCCATTCATAACTGATGG + Intergenic
1069865344 10:71499012-71499034 CTTTATCCATTTATCATTGACGG - Intronic
1070573724 10:77661153-77661175 TTTTACCCATTCATTATAAAAGG - Intergenic
1070987687 10:80702364-80702386 CTGTGGCCATTCATTGCTGAGGG - Intergenic
1071106393 10:82101582-82101604 CTTAACCCATTAATTATTTAGGG + Intronic
1071209703 10:83325227-83325249 ATTAATCCATCCATTATTGATGG + Intergenic
1072872982 10:99140373-99140395 CTGTAGCCAATAATTATAGATGG - Intronic
1073157319 10:101357577-101357599 CATTAGCGATTCACAATTGAGGG - Intronic
1073495967 10:103891237-103891259 TTTTAGACATTCCTTTTTGATGG - Intronic
1074517500 10:114184098-114184120 ATTAAGCCACTCATTACTGAAGG - Intronic
1074809568 10:117090168-117090190 GTTTACCCATTCATTATTGATGG - Intronic
1075226707 10:120635965-120635987 CTGTGGACATTTATTATTGATGG - Intergenic
1076375665 10:129982748-129982770 CTTTAGCCATTCTTTTGAGATGG - Intergenic
1077542447 11:3153577-3153599 CTGTGGCCATTCATTATTCCTGG - Intronic
1079113307 11:17620475-17620497 GTTTATCCATTCATTATTGATGG + Intronic
1081740516 11:45436314-45436336 CTTTATCCTTTCATCACTGATGG + Intergenic
1081750473 11:45507218-45507240 TTTTAACTATTCACTATTGATGG - Intergenic
1082697336 11:56385500-56385522 CTTTATCCACTCATGGTTGATGG - Intergenic
1082908581 11:58342652-58342674 CTTTATCCAGTCACCATTGATGG - Intergenic
1083131376 11:60626146-60626168 CTTTATCCATTCATCATTGATGG - Intergenic
1083392475 11:62364604-62364626 CTTTATCCATTCTTCATTGATGG - Intronic
1083720587 11:64601734-64601756 CTTTTCCCCTTCAGTATTGAAGG - Exonic
1084197015 11:67528965-67528987 CTTTACTCATTCATAGTTGATGG - Intergenic
1084253119 11:67918041-67918063 CTTTATCCACTAATTGTTGATGG + Intergenic
1084847990 11:71915798-71915820 CTTTAGCCATAAATTATTCTTGG - Intronic
1085362353 11:75901747-75901769 CATAAGTCATTAATTATTGAGGG - Intronic
1085904438 11:80743226-80743248 CTTTAGGTCTTCATTTTTGAAGG + Intergenic
1086197997 11:84165254-84165276 CTTTAGACATTTATTATTAGAGG - Intronic
1086379311 11:86235738-86235760 CTTAAACCATTTATTATTGGAGG - Intergenic
1086888617 11:92230003-92230025 CTTGAACAATGCATTATTGAAGG + Intergenic
1087107851 11:94429438-94429460 CTTTATCCAATCCGTATTGATGG - Intronic
1087604490 11:100360480-100360502 CTTTATCCATGTATTGTTGATGG + Intergenic
1089165500 11:116472999-116473021 CTTTGGACCTTCATTATTGAAGG + Intergenic
1092374133 12:7941293-7941315 CTTTATTCAATAATTATTGAAGG - Intergenic
1093125587 12:15323833-15323855 TTTTAGGCATTCATAATTAATGG - Intronic
1093324129 12:17752620-17752642 CTTTATTCAGTCATCATTGATGG + Intergenic
1093550080 12:20399205-20399227 GTTTATCCATTTATTATTGATGG + Intronic
1093589669 12:20886438-20886460 CTTTAGCGATTAATAATAGAAGG + Intronic
1094231127 12:28104551-28104573 CTTTAGCAATAGATTTTTGAAGG - Intergenic
1095255183 12:40026522-40026544 CTCTAGCCATGCAGTGTTGACGG - Intronic
1095785860 12:46108488-46108510 CTTTTGACATTCACTAATGATGG + Intergenic
1097776527 12:63653025-63653047 CTTGCGCCATCCATTATTTAAGG - Intronic
1097937978 12:65275118-65275140 CCTTAGCCAGTCAGTATTCACGG + Intergenic
1099024988 12:77454499-77454521 CTTTATCCATTTATCTTTGATGG - Intergenic
1099859973 12:88214366-88214388 CTTTATCCAGTCACCATTGATGG - Intergenic
1099950721 12:89299893-89299915 CTTTACCCATTCTTCATCGATGG - Intergenic
1099983750 12:89638610-89638632 ATTTAAAAATTCATTATTGAGGG + Intronic
1100220451 12:92499237-92499259 TTTTAGCCATTAAATTTTGAGGG + Intergenic
1100347185 12:93743609-93743631 TTTTAGGCTTTTATTATTGAAGG - Intronic
1103097243 12:118141889-118141911 GTTTAGCCATTCTCTATTGATGG + Intronic
1104524766 12:129509854-129509876 CTTTATCCATTCATCGCTGATGG + Intronic
1105465607 13:20636900-20636922 ATTTATCCATTCATTGTTGATGG - Intronic
1106306934 13:28520771-28520793 CTTTATCCATTCATTATTGATGG + Intergenic
1106317796 13:28610308-28610330 GTTTATCCATTCACTGTTGATGG + Intergenic
1107306214 13:39022809-39022831 TTTTAGTCATTCATTATTTATGG - Intronic
1108162554 13:47656992-47657014 CTTTATCCATCCACCATTGATGG - Intergenic
1108276250 13:48812761-48812783 CTTTATCCATTCACCACTGATGG + Intergenic
1108567556 13:51715987-51716009 GTTTATCCATTCATCACTGATGG - Intronic
1108645424 13:52422344-52422366 CTTTATCCGTTCATCACTGATGG + Intronic
1109248022 13:59981545-59981567 TTTAAGCAGTTCATTATTGATGG - Intronic
1110134738 13:72052157-72052179 CTTTAGGCCTTCATTTTTGAAGG + Intergenic
1110654255 13:77977857-77977879 CTTTACCCATTCATCTGTGATGG + Intergenic
1110685531 13:78368596-78368618 TTTTACCAATCCATTATTGATGG + Intergenic
1110825757 13:79969828-79969850 CTTTATCCATCTATCATTGATGG + Intergenic
1110890796 13:80695345-80695367 CTTTATCCAGTCTATATTGATGG - Intergenic
1111229661 13:85327758-85327780 CTTTAACCATTCATTCATTATGG + Intergenic
1111517657 13:89356384-89356406 ATTTAGCAATTCCTTATTGGTGG + Intergenic
1111520963 13:89403630-89403652 CTTTAGGCATTGATTAATGTTGG - Intergenic
1111583595 13:90255785-90255807 CATTAGCCATTTATTATTCCAGG - Intergenic
1112322565 13:98420819-98420841 TTTTAGCCGTTCATAATAGAAGG + Intronic
1113921115 13:113912176-113912198 CTTTAGCCATTCTTTTTGGATGG + Intergenic
1117283228 14:54260937-54260959 CTTTACCCACTCATCGTTGATGG + Intergenic
1117784480 14:59268228-59268250 TTTTATCCATTCATCATTGATGG + Intronic
1118598679 14:67455712-67455734 CTTTAGCAATTTATTATATATGG - Intronic
1118653574 14:67923613-67923635 CTTTATCCACTCGTTATTGATGG + Intronic
1118664975 14:68058648-68058670 CTTTAACCAAACATTATTGCTGG + Intronic
1119523680 14:75304947-75304969 GCTTATCCATTCATCATTGATGG + Intergenic
1122827621 14:104378034-104378056 TTTTGGCCATTCATTTTAGAGGG + Intergenic
1125141219 15:36410006-36410028 CTTTACCCATTCACCATTGATGG + Intergenic
1125345914 15:38718714-38718736 GTTTATCCATTCTCTATTGATGG + Intergenic
1126977740 15:54203431-54203453 CTTTATCCACTCATGATTGTTGG - Intronic
1127288728 15:57552193-57552215 CTCCAGCCTTTCTTTATTGACGG - Intergenic
1128365603 15:66999481-66999503 GTTTATTCATTCATCATTGATGG - Intergenic
1129796006 15:78376345-78376367 CTTAATCCAGTCATCATTGATGG + Intergenic
1129818928 15:78582936-78582958 CACTAGCCATTTATTATTCAAGG + Intronic
1131159674 15:90097084-90097106 CTTTATCCATTCATCTGTGATGG - Intronic
1131341589 15:91607635-91607657 CTTTATCAATTCCTTACTGATGG - Intergenic
1133484270 16:6203470-6203492 CTTTATCCATTCATTGTTGATGG + Intronic
1134597791 16:15509768-15509790 CTGTGGCCATTCATTCTTGTGGG + Intronic
1134796582 16:17042962-17042984 CTTTATCCAGTCTATATTGATGG - Intergenic
1134796642 16:17043881-17043903 CTTTATCCAGTCTATATTGATGG + Intergenic
1136752572 16:32652456-32652478 TTTTAGCCATTCATCAATAATGG - Intergenic
1136822019 16:33327985-33328007 TTTTAGCCATTCATCAATAATGG + Intergenic
1136828582 16:33384524-33384546 TTTTAGCCATTCATCAATAATGG + Intergenic
1136833648 16:33483298-33483320 TTTTAGCCATTCATCAATAATGG + Intergenic
1136992833 16:35166594-35166616 CTTTATTCATTGATTTTTGAAGG - Intergenic
1137443739 16:48519056-48519078 ATTTATCCATTCACTACTGAAGG - Intergenic
1137467649 16:48725362-48725384 CTTTAGTCATTCCCCATTGATGG + Intergenic
1138429043 16:56956337-56956359 GTTTATCCACTCATCATTGATGG + Intergenic
1140904474 16:79398706-79398728 GATTTGCCATTCATTATGGATGG - Intergenic
1203011268 16_KI270728v1_random:241224-241246 TTTTAGCCATTCATCAATAATGG - Intergenic
1143159155 17:4857841-4857863 CTTTAGCTACTCCTAATTGAAGG + Intronic
1144106542 17:11991496-11991518 CTTTAGCTATTGAGGATTGAGGG - Intronic
1148875152 17:50682844-50682866 CTTTACCCATTCATTGTTACTGG - Intronic
1149116235 17:53099687-53099709 CTTTATCCATTCATTGTTGATGG - Intergenic
1149156637 17:53638677-53638699 CTTTATCCATTCATCATTGATGG + Intergenic
1150000103 17:61430031-61430053 CCTTATTCATTCATTGTTGATGG + Intergenic
1150014922 17:61544773-61544795 CTTAAGCAATTCATTTTTGGGGG + Intergenic
1150853534 17:68728841-68728863 CTTTATCCAGTCTATATTGATGG - Intergenic
1153122581 18:1747690-1747712 CTTTACCCATTCCTTATTTTTGG + Intergenic
1153334995 18:3914438-3914460 CTTTATCCATTCATTGTTGATGG + Intronic
1153592191 18:6685300-6685322 CTTTATCTATTCATTTTTGGGGG + Intergenic
1153924392 18:9823017-9823039 GTTTAGCCATTCGTAACTGAAGG - Intronic
1154079464 18:11242064-11242086 GTTTACCCATTGCTTATTGAAGG - Intergenic
1155744458 18:29335339-29335361 ATTTAACCATTCTCTATTGATGG - Intergenic
1156341676 18:36215093-36215115 CGTTAGCCTCTCATTACTGAGGG - Intronic
1159044228 18:63353589-63353611 GTTTAGCTATTCATCATCGATGG - Intronic
1162465890 19:10840031-10840053 CTTTAGCCATTCATTATTGAGGG + Intronic
1162614850 19:11790749-11790771 CTTTATCCAATCATCATCGATGG - Intergenic
1163889256 19:19996439-19996461 CTTTATCCACTCAATATTGATGG - Intergenic
1164924505 19:32118631-32118653 CTTTATCCATTCATCAATGGTGG - Intergenic
1165303956 19:34991782-34991804 CTTTATCTATTCATCACTGATGG + Intergenic
1166050808 19:40257750-40257772 GTTTATCCATTCGTTGTTGATGG - Intronic
1167304454 19:48699147-48699169 CTTTAGGCCTTCATTTCTGAAGG - Intronic
1168580171 19:57548834-57548856 CTTTGTCCATTCATTGTTGATGG - Intronic
925014593 2:512841-512863 CTTTATTTCTTCATTATTGAAGG + Intergenic
926117153 2:10220693-10220715 TTTTATCCATTCATCACTGATGG - Intergenic
928489572 2:31767642-31767664 CTTAACCCATTTATTAATGAAGG - Intergenic
928807561 2:35178852-35178874 TTTTAGCCATTCATTAGTTCAGG + Intergenic
929331647 2:40689379-40689401 CTTTATCCAATCATGGTTGATGG + Intergenic
929912950 2:46107450-46107472 GTTTATCCATTCACTATTGAAGG + Intronic
930452733 2:51562522-51562544 CTTTATCCATTCATCATTGATGG + Intergenic
931073528 2:58683242-58683264 CTTTATCCATCCACCATTGATGG + Intergenic
931216967 2:60254433-60254455 CTTTATCCATTCATCTTTTATGG + Intergenic
931372844 2:61680150-61680172 CTTTAGCAGTCCATTACTGATGG - Intergenic
931710243 2:64983256-64983278 CTATAGCCATTCTTTAATGAGGG + Intergenic
931930931 2:67132463-67132485 CTTTAGCCAGTCATCATTGGTGG + Intergenic
932329968 2:70892805-70892827 GTCTATCCATTCATTATTGATGG - Intergenic
933318296 2:80741263-80741285 CTTTATCCAGTCTATATTGATGG - Intergenic
933884922 2:86710177-86710199 CTTTAGCCATTCTTTTTGGTAGG + Intronic
933912537 2:86955602-86955624 CCTTAACCATTCACTTTTGAGGG + Intronic
933925251 2:87086511-87086533 CTTTAGCCATTCTTTTTGGTAGG - Intergenic
933947920 2:87303369-87303391 CTTTAGTCATTCTTTAATGCTGG - Intergenic
934010458 2:87814293-87814315 CCTTAACCATTCACTTTTGAGGG - Intronic
934905621 2:98199245-98199267 GTTTACCCATTCCTTGTTGAAGG + Intronic
935265537 2:101390420-101390442 CTTTATCCATTCATCATTGATGG + Intergenic
935716710 2:105945464-105945486 GTTTATCCATTCATTAATCAAGG - Intergenic
935774028 2:106454998-106455020 CCTTAACCATTCACTTTTGAGGG - Intronic
935896951 2:107747959-107747981 CTTTATCCACTCATCCTTGATGG - Intergenic
935906037 2:107840915-107840937 CCTTAACCATTCACTTTTGAGGG + Intronic
935992511 2:108733431-108733453 CCTTAACCATTCACTTTTGAGGG + Intronic
936127824 2:109806065-109806087 CCTTAACCATTCACTTTTGAGGG + Intronic
936216873 2:110565420-110565442 CCTTAACCATTCACTTTTGAGGG - Intronic
936332277 2:111558203-111558225 CTTTAGTCATTCTTTAATGCTGG + Intergenic
936426012 2:112420000-112420022 CCTTAACCATTCACTTTTGAGGG - Intronic
937674570 2:124575855-124575877 TTATATCCATTCCTTATTGAGGG + Intronic
938963630 2:136365483-136365505 TTTTATCCATTCATCATTGATGG + Intergenic
939208947 2:139146362-139146384 CATTACCCATTTATTATTGTGGG + Intergenic
939211964 2:139187262-139187284 CTTTACCCGTTCATAGTTGATGG + Intergenic
939402328 2:141710412-141710434 CTTTACTCTTTAATTATTGAAGG - Intronic
939479835 2:142734059-142734081 CTTTAGCCATTTCTTAATGGCGG - Intergenic
940935265 2:159486783-159486805 ATTTAACAATTCTTTATTGATGG - Intronic
941644173 2:168022652-168022674 CTATTACCATTCATTAGTGAGGG + Intronic
941961671 2:171260056-171260078 TTTTAGCCATTCAGTAGTTATGG - Intergenic
942167975 2:173261365-173261387 CTTCAGTCATTCATTAGTTATGG + Intronic
942375977 2:175338387-175338409 CTTTATCCATCTATCATTGATGG + Intergenic
942485205 2:176431994-176432016 CTTTAGCCCTTCCTTAAAGAAGG - Intergenic
942593908 2:177574276-177574298 CTTCAGCCATTGAATATAGAAGG - Intergenic
943100636 2:183481823-183481845 CTTTATCCATCTATCATTGATGG - Intergenic
943133243 2:183882755-183882777 CCTTATCCATTCACCATTGATGG + Intergenic
943687173 2:190830785-190830807 CTCTATCCATTCATTCTTCAAGG + Intergenic
947123472 2:226841680-226841702 CTTTATCCATCTATCATTGATGG + Intronic
947828626 2:233123724-233123746 CTTTATCCAGTCATCACTGATGG - Intronic
948780941 2:240321262-240321284 ATTTAACCATTCCTTCTTGATGG - Intergenic
948998019 2:241594029-241594051 GTTTATCCATTCCTCATTGATGG - Intronic
1168983620 20:2028422-2028444 CTTTATCCATTCATTCTTGCTGG + Intergenic
1171064397 20:21999857-21999879 CTTTACCCATTGTTCATTGATGG - Intergenic
1171859998 20:30390587-30390609 TTTTAGTAATTTATTATTGAAGG + Intronic
1173882592 20:46427976-46427998 CTTTATCAATTCATCGTTGATGG - Intronic
1173947281 20:46961624-46961646 CTTTTTCCATTCATTGCTGATGG - Intronic
1175685734 20:61027107-61027129 CCTTAGCCTTTTATTATTGAAGG - Intergenic
1176923374 21:14716970-14716992 ATTTCCCCATTCATTCTTGAAGG - Intergenic
1177204048 21:17991189-17991211 CTTTATCCATTCATCATTGATGG + Intronic
1177416888 21:20805644-20805666 CTTTAACCCTTTATTATTTATGG + Intergenic
1178243862 21:30933788-30933810 CTTTATCCATTCACCATTGTTGG - Intergenic
1178662191 21:34516891-34516913 CTTTCCCCATTCATTCCTGATGG - Exonic
1181655161 22:24291529-24291551 CTTTAGTCATTCCTTATAAAGGG + Intronic
1183033607 22:35123965-35123987 CTTCATCCATTATTTATTGAAGG + Intergenic
1185257462 22:49843409-49843431 GTTTAGCCATTCACTGCTGAAGG - Intergenic
949145486 3:694473-694495 CTTTATCCACTCATCGTTGATGG + Intergenic
949160339 3:874704-874726 CTTTAGCCATTATTTATGGTAGG - Intergenic
949216110 3:1569140-1569162 GTTTATCCATTCACTGTTGATGG + Intergenic
951094581 3:18613786-18613808 CTTTGTCCACTCATGATTGATGG - Intergenic
951386316 3:22047631-22047653 CTTTATTCATTCATCATTGGTGG + Intronic
951626978 3:24676254-24676276 CTTTAGCTTTTCATTGTAGATGG + Intergenic
951782752 3:26382985-26383007 CTTTCTCCATTTTTTATTGATGG + Intergenic
952814516 3:37435627-37435649 CTTTGGCCATTCAATTTGGATGG + Intergenic
953530435 3:43735617-43735639 CTCTGGCCACTCATTAGTGAGGG - Intergenic
953857890 3:46515179-46515201 CTTTGGGCCTTCATTTTTGAAGG + Intergenic
954595695 3:51822185-51822207 GCTTATCCATTCATCATTGATGG + Intronic
954770694 3:52965630-52965652 ATTTCCCCATTCATTGTTGAGGG - Intronic
954857226 3:53655201-53655223 CTTTATCCAATCTGTATTGATGG + Intronic
955994391 3:64664658-64664680 GTTTATCCATTCATCATTGGTGG + Intronic
956361515 3:68452827-68452849 CTTTGGGCAATCATTATTTAAGG + Intronic
957578892 3:82045125-82045147 CTTTAGCCAGTCTTTCTTTATGG + Intergenic
957656558 3:83085689-83085711 CTTTAACCCTTTATTTTTGAAGG + Intergenic
957801237 3:85085491-85085513 CTTTATTCATTCATCATTGATGG + Intronic
958444138 3:94194408-94194430 CTTTGGCTCTTCATTTTTGAAGG - Intergenic
958517911 3:95144193-95144215 CTATAGCTATTCATTAGGGACGG + Intergenic
959304392 3:104642198-104642220 CTTTACCCATTCATCCTTGATGG - Intergenic
959354890 3:105313298-105313320 TTTTATCCATTCATTGTTGATGG - Intergenic
959474747 3:106796029-106796051 CTTCATCAATTCACTATTGATGG - Intergenic
959654237 3:108782963-108782985 ATTTATCCATTCATCATTGATGG + Intergenic
960854508 3:122088934-122088956 GTTTATCCATTCATTTTTGATGG - Intronic
961575103 3:127829119-127829141 CTTTAGCCATTCTTTGAGGATGG + Intergenic
961994405 3:131226433-131226455 CTTTATCCACTCATCAGTGATGG - Intronic
966057029 3:175706237-175706259 CATTAGCCCCTCCTTATTGATGG + Intronic
967386726 3:188919331-188919353 CTTTAGGCTTTCATTTCTGAAGG - Intergenic
969100877 4:4767359-4767381 ATTTATCCATTCATCAGTGATGG - Intergenic
969447610 4:7254276-7254298 CTTTATCCATTCATCATGGATGG - Intronic
969728036 4:8937022-8937044 TTTTATCCATTCATCATTGATGG - Intergenic
970163561 4:13213407-13213429 CTGTGGCCATTTATTGTTGATGG - Intergenic
970629835 4:17928257-17928279 ATTTAGCCAGGCATTAGTGATGG + Intronic
970806313 4:20038523-20038545 CTTTATACATTCATTTTTGATGG + Intergenic
971155861 4:24082282-24082304 CTTTAGCCTTTAAATTTTGATGG - Intergenic
971923877 4:32980764-32980786 CTTTTGCAATCCATAATTGATGG + Intergenic
972221916 4:36965682-36965704 GTTTATCCATTCACTATTAAAGG + Intergenic
972225116 4:37003535-37003557 TGTGAGCCATTCATCATTGATGG + Intergenic
974853892 4:67436060-67436082 CTTTACTCCTGCATTATTGAAGG + Intergenic
975088599 4:70373491-70373513 CTTTATCTACTCATGATTGATGG + Intronic
975409161 4:74028354-74028376 TTTTACCCATTTATTATTCAAGG + Intergenic
975954948 4:79826155-79826177 CTGTAGCACTTCCTTATTGAGGG + Intergenic
976017682 4:80578036-80578058 CTTTAGCTATTGATTAATCATGG + Intronic
977274745 4:94962712-94962734 CTTTATCCATTCATTGTTGATGG + Intronic
979584412 4:122398362-122398384 CTTTATCCACTCATGATTGATGG + Intronic
981524653 4:145697742-145697764 CTTTATCCATTCATTATTGATGG + Intronic
983429340 4:167628581-167628603 AATTAGTCTTTCATTATTGAGGG + Intergenic
983647097 4:170002954-170002976 CTTTAACTTTTCATTTTTGAAGG - Intronic
983744055 4:171172469-171172491 CTTTATCCATTCATCATCAATGG + Intergenic
983862381 4:172723614-172723636 CATTAGCCATTCATTCTTCAAGG - Intronic
984677322 4:182564661-182564683 CTTTAGCCATTCATTAACTCAGG - Intronic
988434272 5:31155228-31155250 CTTTTGTAAATCATTATTGAGGG - Intergenic
989162561 5:38405568-38405590 ATTTAGTCATTCTTTGTTGATGG + Intronic
990102961 5:52215801-52215823 CTTTATCCAGTTATTACTGATGG + Intergenic
990174884 5:53096848-53096870 CTTTAGAAGTTCCTTATTGAGGG - Intronic
990745231 5:58952189-58952211 CTTTAACCATTCATCCATGATGG - Intergenic
991552804 5:67860676-67860698 CTTTATCCAGTCATCATTGTTGG - Intergenic
991699624 5:69305147-69305169 GTTTATCCATTCATTCCTGATGG - Intronic
991717905 5:69469094-69469116 GTTGAGCCATTCAATATTTAAGG - Intergenic
992513714 5:77469607-77469629 CTTCAGGCAGTGATTATTGATGG - Intronic
993298232 5:86171559-86171581 CTTGAGCCATGGATTATTGAGGG + Intergenic
995212997 5:109561816-109561838 CTTTATCCATTCTCTGTTGATGG + Intergenic
996656203 5:125940056-125940078 ATTTATCCATTCACTACTGAAGG - Intergenic
996872850 5:128211209-128211231 CTTTATCCATTCATTGTCAATGG - Intergenic
998253150 5:140566055-140566077 CTTCAGCAAGTGATTATTGAGGG + Intronic
999460465 5:151753480-151753502 ATGTAGCCATTGATTTTTGAAGG - Intronic
1000016961 5:157286578-157286600 ATTTAGCCTTTCACTGTTGATGG + Intronic
1000357588 5:160415652-160415674 CTTGAGATATTCATTCTTGAAGG - Intronic
1000612936 5:163395167-163395189 CTTTATCCACTCATGATGGATGG - Intergenic
1000816614 5:165930492-165930514 CTTTATCCAGTTATCATTGATGG - Intergenic
1001166397 5:169372955-169372977 CTTTATCCACTCATTGTTGATGG - Intergenic
1002514524 5:179747449-179747471 CTTTATCCATTCATCTGTGATGG - Intronic
1003142921 6:3486469-3486491 GTTTATTCATTCATCATTGATGG - Intergenic
1003339973 6:5210897-5210919 GTTTATCCATTCATTGTTGATGG + Intronic
1004565610 6:16793709-16793731 CTTTAGCCATTCTTTTTGGTAGG - Intergenic
1004639776 6:17503966-17503988 TTTTAGCTATCCATTACTGAAGG - Intronic
1004845615 6:19638589-19638611 CTTTATCCAGTCATCATTGATGG + Intergenic
1004868035 6:19873540-19873562 CTTTATCCATCAGTTATTGAAGG + Intergenic
1005368495 6:25104977-25104999 CTTTAACATTTCATTTTTGAGGG - Intergenic
1005749183 6:28867469-28867491 CTTTAGGTCTTCATTTTTGAAGG + Intergenic
1005769828 6:29057161-29057183 CTTTATCCATTTTTTGTTGATGG + Intergenic
1006500715 6:34457381-34457403 CTTTGGCCCTTCATTTCTGAAGG - Intergenic
1008324521 6:50161618-50161640 CTTTATCCATCTATCATTGATGG + Intergenic
1008766443 6:54922449-54922471 CATTAGCTATGCATTAATGAGGG - Intronic
1010064896 6:71670865-71670887 CTTTATCCATTCAAGTTTGATGG - Intergenic
1010134796 6:72538850-72538872 CTTTATCCATTATCTATTGATGG + Intergenic
1010366184 6:75054590-75054612 CTTTATCCATTCATCCATGAAGG + Intergenic
1010977547 6:82332789-82332811 CTTTATCCATTCATCGTTGATGG + Intergenic
1012866156 6:104620704-104620726 CTTTTGCCATTCATTTGTGCTGG - Intergenic
1012958589 6:105597812-105597834 CTTTATCCATTCATTTGTCAAGG + Intergenic
1015506022 6:133989433-133989455 GTTTAGCCCTTCATTATAAATGG - Exonic
1015885868 6:137917974-137917996 GTTTATCCATTCACTATTGAAGG - Intergenic
1016177042 6:141092511-141092533 ATTTATCTATTCATTACTGAAGG + Intergenic
1016226242 6:141742098-141742120 CTTTATCCATCTATAATTGATGG - Intergenic
1016405690 6:143727343-143727365 CTTTATCCATTCATCTTTGATGG + Intronic
1016524085 6:144980413-144980435 CTTTATTCATTCATCGTTGATGG + Intergenic
1016698222 6:147022956-147022978 CTTTGGCCTTTCATTACTGAGGG - Intergenic
1016849684 6:148604965-148604987 CTTTAGCCATTTATATTTCAAGG + Intergenic
1019006438 6:168800998-168801020 CTTTATCCATTCATCTGTGATGG + Intergenic
1021183764 7:17538794-17538816 CTTTATCCACTCATCGTTGATGG - Intergenic
1021246387 7:18267680-18267702 CTTTATTCTTTCTTTATTGATGG + Intronic
1022346545 7:29521074-29521096 CTTTATCAATTCATCGTTGATGG - Intergenic
1022579634 7:31538015-31538037 TAATAGCAATTCATTATTGATGG + Intronic
1023159181 7:37280958-37280980 CTTTATCCATTCGTTGATGATGG - Intronic
1024168235 7:46756506-46756528 CTTTATCAATTCATCTTTGATGG - Intronic
1024502033 7:50120158-50120180 CTTTGGCCTTTGATTATGGAAGG - Intronic
1024514597 7:50234942-50234964 CTTTATCCAGTTATCATTGATGG + Intergenic
1027570188 7:79856492-79856514 CTTTATCCATTCATCACTGATGG + Intergenic
1027735069 7:81921126-81921148 TTTATGCTATTCATTATTGATGG - Intergenic
1030344466 7:108416799-108416821 CTATTGCCATTCATAATTAAGGG + Intronic
1030416867 7:109255902-109255924 CTCTTGGCATTCATTATTTATGG + Intergenic
1030522950 7:110620717-110620739 CTTTAAGCATTCATTTTTAAGGG - Intergenic
1030848773 7:114456778-114456800 CTTTATCCATTCATTGCTGGTGG - Intronic
1032665318 7:134030335-134030357 GTTTATCCACTCATCATTGATGG - Intronic
1033435564 7:141330508-141330530 CTTTATCCAGTCTATATTGAAGG + Intronic
1033502262 7:141963834-141963856 TCTTATCCATTCATTGTTGATGG + Intronic
1033889281 7:145989524-145989546 ATATATCCATTCATTATTGATGG + Intergenic
1033901812 7:146151605-146151627 CTTTGTCCATTCATCAGTGATGG - Intronic
1035586804 8:782415-782437 ATTTAGGTATTCATAATTGATGG - Intergenic
1035942543 8:3918632-3918654 CTTTATCCACTCGTTTTTGATGG - Intronic
1036273422 8:7329039-7329061 GTTTCGACATTCACTATTGAAGG + Intergenic
1036347927 8:7981313-7981335 GTTTCGACATTCACTATTGAAGG - Intergenic
1036508059 8:9374194-9374216 GTTTAATCATTCATCATTGAAGG - Intergenic
1036522231 8:9502220-9502242 CTTTAGCCATTCATCCGTGATGG + Intergenic
1036790180 8:11712141-11712163 CTTTAGCCCTTCATAAATGATGG + Intronic
1038238226 8:25783033-25783055 TTTTAACAGTTCATTATTGAGGG - Intergenic
1038309133 8:26432110-26432132 CTTTATCCATTCATCACTGATGG + Intronic
1038716000 8:29991743-29991765 CTTAAGCCATGGATTATTAAGGG - Intergenic
1039148467 8:34477137-34477159 CATTTGCCATTCATTGTTGCAGG - Intergenic
1039601828 8:38845588-38845610 CTATAGCATTTCTTTATTGATGG + Intronic
1041147842 8:54896860-54896882 CTTTTGCTATTCATTTCTGAAGG + Intergenic
1041577597 8:59417786-59417808 CTTTATCCATTCATCGGTGATGG - Intergenic
1042330513 8:67575490-67575512 CTTTATACATTCATCAGTGATGG - Intronic
1042858454 8:73290954-73290976 CTTTTCCCATTAAATATTGATGG - Intronic
1043179520 8:77069171-77069193 CTTTATCCATTCATCATTAATGG + Intergenic
1044187991 8:89279458-89279480 CTTGAGACATTCATTAAAGAAGG - Intergenic
1044458029 8:92411774-92411796 CTTTAACCATTCACTGTTGATGG + Intergenic
1044510913 8:93077452-93077474 CTTTCTCCATTTATCATTGATGG - Intergenic
1044592415 8:93927098-93927120 ATTTATCCATTCTCTATTGATGG + Intergenic
1046188124 8:110749532-110749554 CTTTATCCATTCATAAGTAATGG - Intergenic
1046199425 8:110903522-110903544 CTTCATCCATTCATCATTAATGG - Intergenic
1049914672 9:305884-305906 GTTTATCCATTCATTATGGATGG - Intronic
1050152568 9:2631418-2631440 CTTTACCCTTTCATTATTGATGG - Intronic
1050650459 9:7770363-7770385 CTGCAGCCATGCATTATGGATGG - Intergenic
1050838782 9:10119587-10119609 TTCAAGTCATTCATTATTGAGGG + Intronic
1051294378 9:15579848-15579870 ATTTATCCATTTATTATTGATGG + Intronic
1051321560 9:15910929-15910951 CTTTATCCAGTCTTCATTGATGG + Intronic
1051478669 9:17536320-17536342 TTTTATCCATTCGTCATTGATGG + Intergenic
1051875848 9:21792565-21792587 CTTTATCCATTCATTCATAATGG - Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1055742871 9:79408709-79408731 CTTTAGACATTCATTACTTGTGG + Intergenic
1057507558 9:95648271-95648293 CTTTAGCGTTTCAGCATTGAGGG - Intergenic
1057699271 9:97351041-97351063 GTTTACCCATTCATCTTTGATGG + Intronic
1058359864 9:104132103-104132125 CTTTTGCCATGCAATATTTAGGG - Exonic
1058832488 9:108831681-108831703 CTCCAGACATTCATTATTCATGG + Intergenic
1058874756 9:109234390-109234412 ATTTAACCAATCAATATTGATGG - Intronic
1059878272 9:118660564-118660586 GTTGAGGCATTCATTATTAAAGG + Intergenic
1185984134 X:4811520-4811542 CTTTATCCAGTCATTATTGATGG + Intergenic
1186372578 X:8962330-8962352 CTTTATCCAGCCATCATTGATGG - Intergenic
1186553049 X:10527376-10527398 CATTATCCATACATTATGGATGG - Intronic
1186915761 X:14218509-14218531 CCTTATTCATTCATTGTTGATGG + Intergenic
1187180966 X:16943557-16943579 CTTTATCCATGCACTATTGAGGG + Intergenic
1189709749 X:43797038-43797060 CTTCAGCAGTTCATGATTGAAGG + Intronic
1189805525 X:44731982-44732004 CATTTGCCATTGATTATTAACGG - Intergenic
1190442440 X:50488583-50488605 ATTTAGCCATTTTGTATTGAAGG - Intergenic
1190486021 X:50926131-50926153 CTTTATCCATTCATCGCTGATGG + Intergenic
1190653060 X:52585585-52585607 TTTTAGCAATTCACTGTTGAGGG + Intergenic
1190685029 X:52865482-52865504 CTTTAGCAATTCACTGTTAAGGG - Intronic
1190869936 X:54416026-54416048 TTTTGGCCATTCATTTTGGAGGG + Intergenic
1191652796 X:63559783-63559805 TTTTACCAATTCACTATTGATGG + Intergenic
1192033556 X:67540958-67540980 GTTTATCCATTCACTTTTGATGG - Intergenic
1192699113 X:73448513-73448535 CTTTAGCCATTTATTAGTGCTGG - Intronic
1192760070 X:74087369-74087391 CTTTATCCATTCACAATTAATGG - Intergenic
1192856174 X:75014603-75014625 CTTTATCCATCTATCATTGATGG + Intergenic
1193423935 X:81317802-81317824 CTTTATCCTTTCGTTGTTGATGG + Intergenic
1193679149 X:84496649-84496671 TTTTAACCATTTATTAGTGATGG + Intronic
1194280884 X:91952795-91952817 CTTTAGCCATTCATCTGTTATGG - Intronic
1195032410 X:100938917-100938939 TTTTAGCAGTTCTTTATTGATGG - Intergenic
1196238934 X:113317546-113317568 CTTTATCTGTTCATTTTTGAAGG - Intergenic
1196693242 X:118583036-118583058 CTTTATCCAGTCATCATTGTTGG - Intronic
1197296591 X:124726675-124726697 TTTTCTCCAGTCATTATTGAAGG + Intronic
1197862023 X:130980892-130980914 CTTTATCCATTCATTGTTGATGG - Intergenic
1197901392 X:131377077-131377099 CTTTAGCCATTCTTTAGGGTAGG - Intronic
1197906792 X:131434010-131434032 CTTTATCCATCTATCATTGATGG - Intergenic
1198365266 X:135933590-135933612 CTTTAGTCATACATTACTGCAGG + Intergenic
1198502398 X:137264531-137264553 CTTTAGCCTTACAGTATTCAGGG - Intergenic
1198880050 X:141271068-141271090 CTTTATCCACTCATCATGGAGGG + Intergenic
1199702263 X:150390825-150390847 CTTTAGGCATTCATTAAGGGTGG + Intronic
1199774531 X:150999167-150999189 CTTTATCCATTCATTGATCAAGG + Intergenic
1200253270 X:154564957-154564979 ATTTAACCAGTCACTATTGATGG + Exonic
1200264497 X:154639458-154639480 ATTTAACCAGTCACTATTGATGG - Intergenic
1200598476 Y:5177455-5177477 CTTTAGCCATTCATCTGTTATGG - Intronic
1201743774 Y:17349646-17349668 CTTTATTCATTCCTTACTGAGGG + Intergenic
1201955417 Y:19617439-19617461 CTTTAGGCTATCATTATTGAGGG - Intergenic