ID: 1162470725

View in Genome Browser
Species Human (GRCh38)
Location 19:10871025-10871047
Sequence GGCGTGGCCCAGCCGCGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162470725_1162470737 14 Left 1162470725 19:10871025-10871047 CCTCGTCGCGGCTGGGCCACGCC No data
Right 1162470737 19:10871062-10871084 CTCACAAAGCCGGGCGGGCCCGG No data
1162470725_1162470739 16 Left 1162470725 19:10871025-10871047 CCTCGTCGCGGCTGGGCCACGCC No data
Right 1162470739 19:10871064-10871086 CACAAAGCCGGGCGGGCCCGGGG No data
1162470725_1162470738 15 Left 1162470725 19:10871025-10871047 CCTCGTCGCGGCTGGGCCACGCC No data
Right 1162470738 19:10871063-10871085 TCACAAAGCCGGGCGGGCCCGGG No data
1162470725_1162470735 9 Left 1162470725 19:10871025-10871047 CCTCGTCGCGGCTGGGCCACGCC No data
Right 1162470735 19:10871057-10871079 GCTGCCTCACAAAGCCGGGCGGG No data
1162470725_1162470746 24 Left 1162470725 19:10871025-10871047 CCTCGTCGCGGCTGGGCCACGCC No data
Right 1162470746 19:10871072-10871094 CGGGCGGGCCCGGGGGGGTGGGG No data
1162470725_1162470740 17 Left 1162470725 19:10871025-10871047 CCTCGTCGCGGCTGGGCCACGCC No data
Right 1162470740 19:10871065-10871087 ACAAAGCCGGGCGGGCCCGGGGG No data
1162470725_1162470733 5 Left 1162470725 19:10871025-10871047 CCTCGTCGCGGCTGGGCCACGCC No data
Right 1162470733 19:10871053-10871075 GAGGGCTGCCTCACAAAGCCGGG No data
1162470725_1162470742 19 Left 1162470725 19:10871025-10871047 CCTCGTCGCGGCTGGGCCACGCC No data
Right 1162470742 19:10871067-10871089 AAAGCCGGGCGGGCCCGGGGGGG No data
1162470725_1162470743 22 Left 1162470725 19:10871025-10871047 CCTCGTCGCGGCTGGGCCACGCC No data
Right 1162470743 19:10871070-10871092 GCCGGGCGGGCCCGGGGGGGTGG No data
1162470725_1162470745 23 Left 1162470725 19:10871025-10871047 CCTCGTCGCGGCTGGGCCACGCC No data
Right 1162470745 19:10871071-10871093 CCGGGCGGGCCCGGGGGGGTGGG No data
1162470725_1162470734 8 Left 1162470725 19:10871025-10871047 CCTCGTCGCGGCTGGGCCACGCC No data
Right 1162470734 19:10871056-10871078 GGCTGCCTCACAAAGCCGGGCGG No data
1162470725_1162470741 18 Left 1162470725 19:10871025-10871047 CCTCGTCGCGGCTGGGCCACGCC No data
Right 1162470741 19:10871066-10871088 CAAAGCCGGGCGGGCCCGGGGGG No data
1162470725_1162470732 4 Left 1162470725 19:10871025-10871047 CCTCGTCGCGGCTGGGCCACGCC No data
Right 1162470732 19:10871052-10871074 TGAGGGCTGCCTCACAAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162470725 Original CRISPR GGCGTGGCCCAGCCGCGACG AGG (reversed) Intergenic
No off target data available for this crispr