ID: 1162472641

View in Genome Browser
Species Human (GRCh38)
Location 19:10881631-10881653
Sequence CAGCCAGATGGCAGGTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 255}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162472631_1162472641 5 Left 1162472631 19:10881603-10881625 CCCTGGAGGGCTGGGGTGGGGGA 0: 1
1: 2
2: 14
3: 137
4: 978
Right 1162472641 19:10881631-10881653 CAGCCAGATGGCAGGTCTTGGGG 0: 1
1: 0
2: 2
3: 27
4: 255
1162472629_1162472641 6 Left 1162472629 19:10881602-10881624 CCCCTGGAGGGCTGGGGTGGGGG No data
Right 1162472641 19:10881631-10881653 CAGCCAGATGGCAGGTCTTGGGG 0: 1
1: 0
2: 2
3: 27
4: 255
1162472620_1162472641 20 Left 1162472620 19:10881588-10881610 CCTCAGAGAGCAGTCCCCTGGAG 0: 1
1: 0
2: 2
3: 21
4: 238
Right 1162472641 19:10881631-10881653 CAGCCAGATGGCAGGTCTTGGGG 0: 1
1: 0
2: 2
3: 27
4: 255
1162472632_1162472641 4 Left 1162472632 19:10881604-10881626 CCTGGAGGGCTGGGGTGGGGGAG 0: 1
1: 0
2: 15
3: 195
4: 1276
Right 1162472641 19:10881631-10881653 CAGCCAGATGGCAGGTCTTGGGG 0: 1
1: 0
2: 2
3: 27
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162472641 Original CRISPR CAGCCAGATGGCAGGTCTTG GGG Intronic
900158821 1:1213893-1213915 CAGCCAGGAGGCTGGTCCTGGGG - Intronic
900415558 1:2532919-2532941 GGGCCAGATGGCAGCTCTGGCGG + Intergenic
900749693 1:4387569-4387591 CAGACAGATGGCATGTGATGAGG - Intergenic
900755128 1:4429286-4429308 CAGCCAGATGGGAGGTGCTTAGG - Intergenic
901305262 1:8228192-8228214 CATCCACATGTCAGCTCTTGGGG - Intergenic
902090378 1:13898278-13898300 CAGCCAAATGCCAGGTCAGGGGG - Intergenic
904311136 1:29630245-29630267 CAGCATGACGGCAGGTCCTGGGG - Intergenic
904493458 1:30874124-30874146 GAGCCAGAAGGCAGGTCCTGGGG + Intronic
905437746 1:37969581-37969603 CAGCCAAGTGGCAGGTTTTTGGG + Exonic
906013174 1:42548769-42548791 CAGTATGATGGCAGGACTTGGGG + Intronic
906953249 1:50351079-50351101 CATGCAGAGGGCAGGTCATGGGG - Intergenic
907238127 1:53065201-53065223 TAGCCAGATGCCAGGTGTGGAGG + Intronic
907438066 1:54462185-54462207 CAGCCAGCTGGGAGGAGTTGGGG + Intergenic
910592523 1:88941829-88941851 CAGCCAGAGGTCAGGTGTAGTGG - Intronic
910624361 1:89290919-89290941 CATCCAGAGGGCAGGTCTGCAGG + Intergenic
912189763 1:107324215-107324237 CAGCAATATGGCAAGACTTGTGG + Intronic
913372725 1:118118393-118118415 CAGCGAGCTGGCAGTGCTTGGGG + Intronic
914805178 1:150986258-150986280 CAGGCATTTGGCAGGTCCTGGGG + Intronic
915129997 1:153689361-153689383 GAACCAGAAGGCAGGTCTGGTGG - Intronic
915285570 1:154849978-154850000 CAGTTAGATCCCAGGTCTTGTGG + Intronic
915294970 1:154913829-154913851 CAGCCTGATGGGAGGTGTTTGGG + Intergenic
915702797 1:157811995-157812017 CAGGCACATGGCTGGTCTTCTGG - Intronic
915830818 1:159128293-159128315 CAGAAAAATGGCAGGGCTTGGGG - Intronic
916197689 1:162240157-162240179 CAGTCAGCTGGCAGTTGTTGTGG - Intronic
918533329 1:185547219-185547241 AAGCCAGATGACATGTCATGAGG - Intergenic
920054246 1:203181104-203181126 CTGGCAGATGGCAGGTCTTGCGG + Intronic
920767038 1:208843298-208843320 TAGCCACATGGCAGGTCTTCAGG - Intergenic
920987309 1:210902578-210902600 CAGCCATATGGCGGGTCTGTGGG - Intronic
921070971 1:211657092-211657114 CAGCCCCATGGCATGTCTGGTGG + Intergenic
922157088 1:223049020-223049042 CAGCAAGACGCCAGGTCTTTTGG - Intergenic
1063293475 10:4776557-4776579 CAGCCAGACTGCAGGACTTAGGG - Intergenic
1063622592 10:7662693-7662715 CAGCCATATGCCATTTCTTGAGG - Intronic
1064074490 10:12257967-12257989 CAGACAGATGTGAGGTCCTGAGG - Intergenic
1064801781 10:19083318-19083340 CAGCCAGATGTTAGGGCTTAGGG + Intronic
1070365216 10:75730100-75730122 CAGCCAGAGGCCAGGTGTGGTGG - Intronic
1071511565 10:86265545-86265567 CAGCCACGTGGCAGGGCTGGTGG - Intronic
1071993868 10:91127857-91127879 CAGCCAGAGGGAAGATCATGTGG - Intergenic
1074065238 10:110007794-110007816 CTGCCAGAGGCGAGGTCTTGAGG + Intronic
1074710995 10:116177426-116177448 CAGCAACAGGGCAGGCCTTGGGG + Intronic
1076014490 10:127016405-127016427 CAGCCAGAGGACAGGGCGTGAGG + Intronic
1077226233 11:1440186-1440208 CAGCCACATGGAGGGTCCTGAGG - Intronic
1077882594 11:6363202-6363224 CAGCCAGCAGGCAGTCCTTGGGG - Intergenic
1080637679 11:34138158-34138180 CTGCCAGAGTGCAGGCCTTGAGG + Intronic
1084441011 11:69173417-69173439 CAGCCAGAAAGCATGTCCTGGGG - Intergenic
1084580354 11:70019480-70019502 CACCCAGAGGGCAGGTCTGAAGG - Intergenic
1084943439 11:72626359-72626381 CAGACAGATGGCAGGGCCTCAGG + Intronic
1085522510 11:77146736-77146758 CCCCCAGAAGGCAGGTCCTGGGG + Intronic
1087441139 11:98185289-98185311 CAGCCATGTGGGAGCTCTTGGGG + Intergenic
1089422274 11:118340801-118340823 CAAGCAGAGGACAGGTCTTGGGG + Intronic
1090998792 11:131890861-131890883 CAGTGGGATGGCAGGTCTAGGGG + Intronic
1092604353 12:10102241-10102263 AATCCAGATGGCAGGTCTTAAGG + Intronic
1097679294 12:62633646-62633668 CAGCCTGATGGCAGGAGATGGGG + Intergenic
1099970938 12:89499930-89499952 CTTCCAGATCGCAGCTCTTGCGG + Intronic
1100019303 12:90050240-90050262 CAGCCAAATGGGAGGTGTTTGGG + Intergenic
1101823505 12:108202454-108202476 CAGCCTGATGCCTGGTCTGGTGG + Intronic
1101862445 12:108494109-108494131 CAGGCAGGGGACAGGTCTTGAGG - Intergenic
1104118264 12:125771690-125771712 GAGCCTGATGGCAGGTGTTTGGG - Intergenic
1104935135 12:132360406-132360428 GAGCCAGAAGGCCGGACTTGAGG + Intergenic
1106485596 13:30169569-30169591 CAGCCAGAAGTGAGCTCTTGGGG - Intergenic
1107481592 13:40789891-40789913 CAGCCAAATGACAGGACTTGGGG - Intronic
1109304011 13:60618867-60618889 AAGCCAGCTGCCAGGTCATGAGG - Intergenic
1110450597 13:75635484-75635506 CAGCGAGGTGGCAGGTTATGCGG - Intronic
1112604890 13:100894699-100894721 CACCCAGACTGCAGCTCTTGGGG - Intergenic
1113541284 13:111111813-111111835 CAGCCAGATGGCACGGCCTTAGG + Intergenic
1117435848 14:55714599-55714621 GATCCAGATGGCACATCTTGTGG - Intergenic
1120734890 14:88041794-88041816 CAGTGAGTTGGAAGGTCTTGGGG + Intergenic
1120817164 14:88873147-88873169 GAGCCAGAGGGCAGGTCACGTGG - Intronic
1121363761 14:93287739-93287761 CAGCCACACAGTAGGTCTTGTGG - Intronic
1121864482 14:97349894-97349916 CAGGCAGATGTCATGTCTAGGGG + Intergenic
1122371107 14:101229486-101229508 CACACAGAGGGCAGGTCATGGGG + Intergenic
1122718543 14:103709246-103709268 TCCCCAGATGGCAGGTCCTGGGG - Intronic
1122900816 14:104781661-104781683 CAGAGAGAGGGCTGGTCTTGTGG - Intronic
1125452300 15:39822020-39822042 AAGCCAAATGACACGTCTTGAGG + Intronic
1126169428 15:45682522-45682544 CAGCCACAGGACTGGTCTTGAGG - Exonic
1129275404 15:74442154-74442176 GAGCCAGATAGCAGGGGTTGAGG - Intergenic
1130717847 15:86353680-86353702 CATCCAGATGATAGGTCTTGTGG - Intronic
1132236009 15:100222277-100222299 CAGCCGGATGCCAGGACTTAAGG - Intronic
1133536434 16:6706472-6706494 CAGCCTGATGGCTGGTAATGAGG + Intronic
1134218769 16:12337148-12337170 CACCCAGCTGGCAGGTGATGGGG + Intronic
1135010413 16:18872864-18872886 CAGCCACAGGTCAGGTGTTGTGG + Intronic
1135317290 16:21460460-21460482 CAGCCACAGGTCAGGTGTTGTGG + Intergenic
1135370188 16:21892272-21892294 CAGCCACAGGTCAGGTGTTGTGG + Intergenic
1135441601 16:22478429-22478451 CAGCCACAGGTCAGGTGTTGTGG - Intergenic
1135817917 16:25652819-25652841 CAGCCAGAATGAAGGTCTTGAGG - Intergenic
1136314077 16:29440200-29440222 CAGCCACAGGTCAGGTGTTGTGG + Intergenic
1136327516 16:29541965-29541987 CAGCCACAGGTCAGGTGTTGTGG + Intergenic
1136367078 16:29813798-29813820 CTCCCAGTTGGCAGGTCCTGGGG + Exonic
1136413992 16:30092501-30092523 CAGCCAGATCGCAGGAGGTGCGG + Exonic
1136442205 16:30281965-30281987 CAGCCACAGGTCAGGTGTTGTGG + Intergenic
1138340786 16:56287750-56287772 CAGCAAGAGGGCAGGTGCTGAGG - Intronic
1139302104 16:65954246-65954268 CAGGGATATGGCAGGTCTGGAGG - Intergenic
1139430662 16:66909444-66909466 CAGCCAGGTGGCTGGGCTGGGGG - Intronic
1139889016 16:70235683-70235705 CAGCCACAGGTCAGGTGTTGTGG + Intergenic
1140452999 16:75086815-75086837 CACACAGATGGGAGGTCCTGGGG - Intronic
1141186747 16:81793087-81793109 CTGCCAGAGGCCAGGCCTTGGGG - Intronic
1141386905 16:83630010-83630032 CTGTCAGATGACAGGTCATGTGG - Intronic
1141674153 16:85508842-85508864 CAGCCTGGTGTCAGGTCCTGGGG + Intergenic
1142593701 17:1019420-1019442 CAGGAAGATGTCAGGGCTTGAGG - Intronic
1143045060 17:4071617-4071639 CAGTCAGCTTGCAGGTCCTGTGG - Intronic
1144576653 17:16433880-16433902 CAGGCAGATGGCCAGTCATGTGG - Intronic
1144649034 17:16995915-16995937 CAGCCAGAGAGGAGGCCTTGGGG - Intergenic
1145232817 17:21186980-21187002 CAGCTACATGGCAGGTCTGCAGG + Intronic
1145881153 17:28353666-28353688 AAGCAAGATGGCTGGGCTTGGGG - Intronic
1146157258 17:30535030-30535052 AAGAGAGATGACAGGTCTTGAGG - Intergenic
1148665848 17:49374257-49374279 GAGCCTGATGGGAGGTATTGGGG + Intronic
1148810601 17:50288451-50288473 AAGCCAGATGGCTGGGCATGTGG - Intergenic
1149792607 17:59492541-59492563 AAGACAGATGAAAGGTCTTGAGG + Intergenic
1150966457 17:69974771-69974793 AAACCAGCTGCCAGGTCTTGAGG - Intergenic
1152344203 17:79741725-79741747 CAGGCTGAGGGCAGGTCTGGTGG - Intronic
1152668108 17:81583514-81583536 CAGCCAGGTGGCAGGACGTGGGG - Intronic
1153123704 18:1764168-1764190 CTGCCAAATGGCAAGACTTGGGG + Intergenic
1155192976 18:23447698-23447720 CAGCAAGATGGCAGGACTTGAGG - Intergenic
1156514978 18:37671687-37671709 CAGGCAGAGGGCAGGTCGTGGGG - Intergenic
1157591098 18:48836860-48836882 CAGGCTGATGGCAGGTGATGTGG - Intronic
1158071946 18:53481034-53481056 AAGCCAGGTGTCATGTCTTGGGG - Intronic
1159298814 18:66534351-66534373 CAGGCAGATGGCAGGTGATATGG - Intronic
1160584416 18:79904476-79904498 CAGCCAGGCGGCAGCTCTTGCGG - Intronic
1160668148 19:343215-343237 CAGCCACATGGCAGCTCTGGGGG + Intronic
1161194425 19:2978166-2978188 CAAGGAGACGGCAGGTCTTGAGG - Intronic
1161202668 19:3024729-3024751 CAGCCAACTTGCAGGGCTTGAGG + Intronic
1161295585 19:3518590-3518612 CTGCGAGGTGCCAGGTCTTGGGG + Intronic
1162061379 19:8097485-8097507 CAACCAGATTGCAGGGCTAGTGG - Intronic
1162410016 19:10500008-10500030 CAGCCAGATCCCAGGCCTAGCGG - Exonic
1162472641 19:10881631-10881653 CAGCCAGATGGCAGGTCTTGGGG + Intronic
1162547838 19:11341484-11341506 CATCCACGTGGCAGCTCTTGAGG - Intronic
1162708535 19:12574084-12574106 CGGCCAGGTGGCAGGTGTTTGGG + Intronic
1163287464 19:16357554-16357576 GGGCCAGATGGCAGGGCTGGGGG + Intronic
1163400175 19:17087323-17087345 AGGCCAGATGGAAGGTCTGGGGG + Intronic
1165949445 19:39465797-39465819 CACCCAGATGGCAGTGCTGGTGG + Intronic
1166364467 19:42271642-42271664 CAGCCAGAGAGGAGGCCTTGGGG + Intronic
926936683 2:18092867-18092889 TAGCCAGGGGGCAGGTCATGTGG - Intronic
928274449 2:29887235-29887257 CTGGCAGATAGCTGGTCTTGAGG + Intronic
928329655 2:30347981-30348003 CAGCCAGGAAGCAGCTCTTGGGG - Intergenic
929958701 2:46480048-46480070 CAGTTAGATGCCAGGTCTTCAGG - Intronic
932443072 2:71750185-71750207 TTGCCAGATGGCAGGACTTTAGG - Intergenic
932445533 2:71778716-71778738 TAGCCACATGGCAAGTCTTGTGG - Intergenic
932809010 2:74808243-74808265 GAGCATGATGCCAGGTCTTGGGG - Intergenic
932910593 2:75802077-75802099 CAGCCACATGGCAGGAGTAGGGG + Intergenic
934692574 2:96372975-96372997 GAGGCAGATGGGAGGTCATGAGG - Intronic
934857755 2:97739554-97739576 CAGCCAGACTGCAGGACCTGGGG - Exonic
935502159 2:103855107-103855129 CAGCTAGATGGGAGGACTAGTGG - Intergenic
935510569 2:103967459-103967481 CTGCCAGATGCCAGTCCTTGTGG - Intergenic
937914838 2:127093850-127093872 GATCCAGATGGTAGGGCTTGAGG - Intronic
938977697 2:136495299-136495321 CAGCCAGATGGCAGGTGGCATGG - Intergenic
941273518 2:163460492-163460514 CAGCAAGATGGCAGATGTTTAGG - Intergenic
941693859 2:168529890-168529912 AAGCTAAATGTCAGGTCTTGGGG - Intronic
944606432 2:201355744-201355766 CAGCCACTTGGCAGGTGGTGCGG + Intronic
944868869 2:203889752-203889774 TAGCCAGTTGGCAGTTCCTGTGG - Intergenic
944989563 2:205220332-205220354 CAGCCAAATGGAAGATCTTAGGG + Intronic
945037982 2:205720689-205720711 AAGCCAGCTGGCGGGTCTTCAGG - Intronic
945276049 2:207988773-207988795 TAGCCAGAGGCCAGGTCATGTGG - Intronic
945305250 2:208254182-208254204 CCGCCCGTTAGCAGGTCTTGGGG + Exonic
946342625 2:219081047-219081069 CAGCCGGATGGCAGGTGATCTGG - Intronic
946416126 2:219540612-219540634 CGGCCAGATGGCTGGTATTCTGG + Exonic
947644416 2:231727824-231727846 GAGCCAGATGGCAGTGTTTGAGG + Intergenic
947821774 2:233076859-233076881 CAGCCAGTTGGCAGGGTGTGGGG + Intronic
948253755 2:236551358-236551380 CAGCCACAAGGCTGGACTTGGGG - Intergenic
1169173762 20:3489876-3489898 CAGCCAAGTGGCAGGTTTTTGGG + Intronic
1169682120 20:8227181-8227203 CAGCCACATTGCAGGACTAGAGG + Intronic
1170429215 20:16261370-16261392 CAGCCTAAGGGCAGGTCCTGGGG + Intergenic
1170941018 20:20848088-20848110 CAGGCAGGTGGCTGGCCTTGGGG + Intergenic
1172117735 20:32582566-32582588 GAGCCAGCTGCCAGGTCTGGGGG + Intronic
1173330190 20:42069463-42069485 CAGGTATATGGCAGGTCTTGGGG + Intergenic
1173626042 20:44473811-44473833 CTGCCAAATGGCAGCTCTTGTGG - Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174107890 20:48175835-48175857 CAGCGAAATGGCAGGTCTGTGGG - Intergenic
1175251115 20:57610742-57610764 GAGCCAGATGGCAGGAGCTGGGG - Intronic
1176101936 20:63368379-63368401 CAGCCAGAGGGCAGGGTGTGAGG - Intronic
1177277495 21:18932205-18932227 CATCCACATGACAGGTATTGTGG + Intergenic
1178240090 21:30889260-30889282 CAGGCACATGGAAGCTCTTGGGG + Intergenic
1182039237 22:27223606-27223628 AAGCCAGATGCCATGTCATGAGG - Intergenic
1183688458 22:39375221-39375243 CAGGCTGAAGGCAGGTCATGAGG + Intronic
1183831543 22:40420771-40420793 CAGGCAGGTGCCAGGTCTGGTGG - Intronic
1184183658 22:42848996-42849018 AAGCCAGGTGCCATGTCTTGAGG + Intronic
1184628279 22:45755039-45755061 AAGCCAGGTGGCAGGGCATGGGG + Intronic
1185047948 22:48538315-48538337 CAGCCTGAGGGCAGGGCTCGGGG - Intronic
1185129336 22:49028791-49028813 CAGCCAGCTGGCAGCTGTGGAGG + Intergenic
1185198287 22:49486304-49486326 GAGCCAGGTGGCAGGACCTGGGG - Intronic
1185310283 22:50150505-50150527 CGGGCAGATGGCAGGACTTCGGG + Intronic
1185310288 22:50150528-50150550 GAGGCAGATGGCAGGACTTCAGG + Intronic
1185342313 22:50297179-50297201 CTTCAAGATGGCAGGTCTGGGGG - Intronic
949511748 3:4772504-4772526 CAGCCAGTTGGCATGTGTTTGGG + Intronic
949824775 3:8154103-8154125 CTGGCAGAGAGCAGGTCTTGTGG + Intergenic
950793674 3:15493634-15493656 CAGCCAGGTGACAGGTCATGGGG + Intronic
950899803 3:16487228-16487250 GGGCCAGATGCCATGTCTTGGGG - Intronic
953112134 3:39953170-39953192 CTACCAGCTGGCAGGTGTTGGGG + Intronic
953263335 3:41361178-41361200 CAGGCAGTTGGCAGATATTGGGG + Intronic
953720312 3:45349403-45349425 AAGCCAGATGACAGGGCTTAGGG - Intergenic
953983081 3:47422413-47422435 CATCCAGGTGGCAGGCCTTGGGG + Intronic
954130516 3:48558411-48558433 CAGCCAGGAGCCAGGTGTTGAGG + Intronic
955607081 3:60716498-60716520 CATCCAACTGGCAGGTCTTCAGG + Intronic
955829398 3:62985152-62985174 CAGTCAGTTGGCAGGTCTTCTGG - Intergenic
956924957 3:73975850-73975872 CAGCCTGATGACAGGACTTCAGG + Intergenic
960022151 3:112966885-112966907 CAGCGAGATTGCTGGTATTGAGG - Intronic
961129429 3:124452110-124452132 CAGGCATTTGGCAGGTCATGTGG + Intronic
961937649 3:130602590-130602612 AAGCAAGTTGGCAGGGCTTGAGG + Intronic
963258409 3:143169343-143169365 CACCAAGATGGCATTTCTTGAGG - Intergenic
964311800 3:155401912-155401934 CAGCCAGATGAAGGTTCTTGGGG + Intronic
965418511 3:168427128-168427150 CAGCAGGATGGCAGGGGTTGGGG + Intergenic
966631911 3:182085442-182085464 CACCCAGATAGCATGTTTTGGGG - Intergenic
968672768 4:1861005-1861027 CAGCCAGCTGCCAGGTCATGAGG + Intergenic
969358649 4:6647212-6647234 CAGGACGATGGCAGGGCTTGGGG + Intergenic
969680821 4:8642439-8642461 AAGCCAGATTGCAGGGCCTGGGG - Intergenic
969839921 4:9873675-9873697 CATCCAGCTGGCAGGTCATCTGG - Intronic
975101834 4:70522503-70522525 CAAGCAGATGGGATGTCTTGTGG - Intronic
975844348 4:78508997-78509019 CAACCACATGGTAGGTCTGGGGG + Intronic
976085180 4:81400635-81400657 CTGGCAGGTGGCAGGTCTTCTGG + Intergenic
977770204 4:100849050-100849072 CAGCTAGATGGCAGGCCCTGTGG + Intronic
978348325 4:107795454-107795476 GAGCCAGATGGCAGGAATCGTGG - Intergenic
979558424 4:122076631-122076653 AAGCCAGGTGGCAGGGCCTGGGG - Intergenic
981652982 4:147079880-147079902 CTGCCAAATGCCAGGTCTTTTGG + Intergenic
986654649 5:9999378-9999400 CACCCAGAGGGCAGGGCATGCGG + Intergenic
986976805 5:13403987-13404009 AAGCTTGATGGCAGGCCTTGAGG + Intergenic
987230862 5:15892193-15892215 CAACCAGAGGGTAGGTCCTGAGG + Intronic
988794137 5:34636830-34636852 CCACCAGATGGCAGGTATTGCGG + Intergenic
990255844 5:53967984-53968006 AAGCCAGATTCCAGGTCTAGAGG + Intronic
992944229 5:81793976-81793998 CTGCCAGATGACTGGTGTTGGGG - Intergenic
993814089 5:92519291-92519313 GAGCCAGAGGGCTGGTCTTAGGG + Intergenic
996137996 5:119868894-119868916 CAGCCTGATGGAAGGTGCTGAGG + Intergenic
997341353 5:133147527-133147549 CAGCCTGATGGCAGGTGTCCAGG - Intergenic
997597837 5:135119023-135119045 CAGCCAGAGGGCAGGGCATGTGG + Intronic
997757455 5:136412689-136412711 CAGCCACATAGAAGGTCTTTGGG + Intergenic
998146267 5:139730604-139730626 CAGCCAGGTTGCAGATCTTTAGG - Intergenic
998565662 5:143213846-143213868 CAGCCAGATGGCAAGACATGAGG - Intronic
999742740 5:154568877-154568899 CATCCAGATGCCAGGCTTTGAGG - Intergenic
1001540264 5:172533006-172533028 CAGCCACATGGCTGGTGTAGTGG - Intergenic
1001813910 5:174651678-174651700 CAGGCAGTTGGCAGGTTCTGAGG - Intergenic
1002443101 5:179274503-179274525 CATCCAGATGGCAGGTGCCGGGG - Intronic
1002974074 6:2056711-2056733 CTGCCACATGGCTGGACTTGAGG + Intronic
1003447941 6:6201587-6201609 CAGCCAAATGGAAACTCTTGAGG - Intronic
1006427712 6:33976538-33976560 AAGCCTGGTGGCAGGTCTTGGGG + Intergenic
1007656031 6:43451491-43451513 CAGCCAGAAGGCAGGGCTCAGGG + Intronic
1009196993 6:60698462-60698484 CAGACACATAGCATGTCTTGTGG + Intergenic
1010490871 6:76475309-76475331 CAGGCACTTGGCAGTTCTTGAGG + Intergenic
1011536270 6:88379674-88379696 CAGCAAGGTGGCAGGTTTTGCGG + Intergenic
1012381972 6:98630883-98630905 CAGCCAAAGTGCAGGTTTTGTGG + Intergenic
1013883588 6:114934175-114934197 GAGGGAGATGGGAGGTCTTGGGG + Intergenic
1016934105 6:149436207-149436229 AAGCCAGATGGCAGAGCTTTGGG - Intergenic
1016938773 6:149467813-149467835 GATCCAGATGGCAGTTCTTTTGG + Intronic
1017256434 6:152338711-152338733 CAGACAGATGGCAGCACTGGAGG - Intronic
1018958467 6:168429980-168430002 CAGCAAAATGGCAGGTGTTACGG + Intergenic
1019548635 7:1591306-1591328 CTGGCAGCTAGCAGGTCTTGTGG + Intergenic
1020067628 7:5201091-5201113 CAGCCAGGTGACAGGACTTCAGG - Intronic
1021981038 7:26055844-26055866 CAGCCATATGGCAGTTCTCTTGG - Intergenic
1022260846 7:28703525-28703547 CTGGCAGATGGCAGATCATGGGG - Intronic
1022913626 7:34924672-34924694 GAGCCAAATGGCAATTCTTGGGG - Intergenic
1024251462 7:47508802-47508824 CAGCCAGATGCCATGTTGTGAGG + Intronic
1025858868 7:65307906-65307928 CAGCAAAATGGCAGGGTTTGAGG - Intergenic
1034309642 7:150075692-150075714 CAGCCACATGGGAGAACTTGAGG - Intergenic
1034797216 7:154024949-154024971 CAGCCACATGGGAGAACTTGAGG + Intronic
1035210350 7:157323377-157323399 AGGGCAGATGGCAGGTCTTAAGG + Intergenic
1035240196 7:157524194-157524216 CAGCCAGATGGCAGGAGTCGGGG - Intergenic
1037475615 8:19254026-19254048 AAGCCAGCTGCCAGGTCCTGAGG + Intergenic
1038675334 8:29617685-29617707 CAGCCAGTTAGCAGCCCTTGGGG + Intergenic
1045061154 8:98412278-98412300 CAGCCAGATGTCTGTTCTAGTGG - Intronic
1048202244 8:132384118-132384140 GAGTCAGAGGGCAGGTCTTAGGG - Intronic
1048257566 8:132916730-132916752 AAGCCATATGGCTGGCCTTGAGG - Intronic
1048433458 8:134392349-134392371 CAGCCAGAAGCCAGGTGTGGTGG - Intergenic
1048705393 8:137147794-137147816 TAGCCAGGTGGCAGGTGATGGGG - Intergenic
1049794771 8:144492092-144492114 CAGCCGGAGGGCAGGTGGTGTGG + Intronic
1050735093 9:8752736-8752758 CAACCAGCTGTCAGGTCTTCTGG - Intronic
1050768954 9:9172699-9172721 CAACCAGATGGGAGGTATAGAGG - Intronic
1053752067 9:41266782-41266804 CAGGCACAGGGCAGGTATTGGGG - Intergenic
1054257590 9:62831112-62831134 CAGGCACAGGGCAGGTATTGGGG - Intergenic
1056706142 9:88954036-88954058 CAGCCAGGTTGCAGCTGTTGTGG - Intergenic
1058824100 9:108759415-108759437 CATCCAGAAGGCAGGGCTGGAGG + Intergenic
1058890537 9:109357055-109357077 CAGCAAGGTGGCAGGGCTTGGGG - Intergenic
1058903628 9:109462736-109462758 CTCACAGATGGCAGGGCTTGGGG - Intronic
1060798321 9:126527431-126527453 CAGGGAGATGGCAGGCCCTGTGG - Intergenic
1061264456 9:129497213-129497235 AAGCCAGCTGGCAGGGCCTGGGG + Intergenic
1061579197 9:131526566-131526588 CAGCCAGATGGTGGGGGTTGGGG + Intronic
1062055459 9:134467590-134467612 CTGCCAGATGGAAGGTCTGGGGG + Intergenic
1203744597 Un_GL000218v1:34917-34939 CAGGCAGCTGGCAGGGCTGGTGG + Intergenic
1185611811 X:1397572-1397594 CTTCCAGGGGGCAGGTCTTGGGG - Intergenic
1187641287 X:21292804-21292826 CCCCCAGATGGCAGGGCGTGTGG - Intergenic
1189910335 X:45804624-45804646 CATCCAAATGCCAGGTGTTGTGG - Intergenic
1190056815 X:47185964-47185986 TAGCCAGATGGCATGCCCTGTGG + Intronic
1190321779 X:49184108-49184130 GAGCCAGAGGACAGGTCGTGGGG + Intronic
1190888413 X:54548933-54548955 AAGCCAGATGGCAGGATTGGTGG + Intronic
1197988717 X:132294611-132294633 AAGCCAGATGGAAGGTGCTGAGG - Intergenic
1199298866 X:146189430-146189452 AAGCCAGCTGCCACGTCTTGAGG + Intergenic
1200759948 Y:7028444-7028466 CAGGCAGATGTCAGGTCATCTGG + Intronic
1200827127 Y:7657448-7657470 CAGCCAGGAGGCAGGGCATGGGG + Intergenic
1200884090 Y:8251991-8252013 CAGCCAGAAGGCAGGGGATGGGG + Intergenic
1201157930 Y:11149900-11149922 CAGGCAGCTGGCAGGGCTGGTGG + Intergenic