ID: 1162474515

View in Genome Browser
Species Human (GRCh38)
Location 19:10891888-10891910
Sequence GTTCACACAATGGCAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162474510_1162474515 5 Left 1162474510 19:10891860-10891882 CCAACCTGCTGGGCTTCAAGTTA 0: 1
1: 0
2: 2
3: 13
4: 155
Right 1162474515 19:10891888-10891910 GTTCACACAATGGCAAAGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 198
1162474509_1162474515 8 Left 1162474509 19:10891857-10891879 CCTCCAACCTGCTGGGCTTCAAG 0: 1
1: 0
2: 6
3: 24
4: 395
Right 1162474515 19:10891888-10891910 GTTCACACAATGGCAAAGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 198
1162474511_1162474515 1 Left 1162474511 19:10891864-10891886 CCTGCTGGGCTTCAAGTTATGCA 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1162474515 19:10891888-10891910 GTTCACACAATGGCAAAGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162474515 Original CRISPR GTTCACACAATGGCAAAGGA GGG Intronic
902533148 1:17103299-17103321 ATGCACACAGTGGCACAGGAAGG - Intronic
904035206 1:27555356-27555378 GGTCACAAAATGGCACAGGAAGG + Intronic
904262921 1:29300767-29300789 CTTCAAACCATGGCACAGGAAGG + Intronic
904631588 1:31846907-31846929 ATTCCACCAATGGCAAAGGAAGG - Intergenic
905096319 1:35474107-35474129 GTTCTCACTATGGGAAACGATGG + Intronic
905273052 1:36799582-36799604 GTACACTGAATGGCATAGGATGG - Exonic
907788607 1:57638721-57638743 GTTCACCAAATGGCAAAGGCAGG + Intronic
907792443 1:57680460-57680482 CTACAAACAATGGAAAAGGAAGG - Intronic
913996138 1:143653141-143653163 GTGCAAACCCTGGCAAAGGAGGG - Intergenic
916122911 1:161544834-161544856 ATTTACAGAATGGCAAAGGCAGG - Exonic
916306988 1:163347370-163347392 GGTAACACAATGGCAGATGAGGG - Intronic
916583317 1:166127820-166127842 GTTAACCCAAAGGCTAAGGATGG + Intronic
919173114 1:193982865-193982887 CTACACACAATGGTAAAAGACGG - Intergenic
921784384 1:219211171-219211193 CTTCACACAATGTGGAAGGAGGG - Intronic
922687754 1:227659416-227659438 GTTCACACCATGGCCAGAGATGG + Exonic
924952784 1:248900193-248900215 TTTCAAACAATTGAAAAGGAGGG + Intergenic
1063139472 10:3243644-3243666 GTTCACATAATGGCATTGGGAGG - Intergenic
1064176721 10:13081449-13081471 GTTCACACAGCAGAAAAGGATGG + Intronic
1065310165 10:24408082-24408104 CATCACACAATGGCAGATGATGG - Intronic
1067986929 10:51159607-51159629 ATTGAGGCAATGGCAAAGGAAGG + Intronic
1069031836 10:63604673-63604695 GTCCAGACAATGGAAAAAGAAGG + Intronic
1071763482 10:88635058-88635080 TTTCAAACAATTGAAAAGGAGGG - Intergenic
1073869778 10:107849962-107849984 TTTCAAACAATTGAAAAGGAGGG - Intergenic
1075218348 10:120559965-120559987 GCTCACACAATAGCAATGGGAGG - Intronic
1077982889 11:7319108-7319130 GTTCAGACAATGAGAAAGGGAGG + Intronic
1078183763 11:9033826-9033848 GTGGACACAAAGGCCAAGGAAGG + Intronic
1081416226 11:42819613-42819635 GTACAAACAATTGCAAAGTAGGG + Intergenic
1084605903 11:70171475-70171497 GTTCACAAAAGAGAAAAGGAAGG + Intronic
1086522718 11:87688864-87688886 TTTCAAACAATTGAAAAGGAGGG + Intergenic
1088206948 11:107403493-107403515 GTTGACAGTATGGCAGAGGAAGG - Intronic
1088703031 11:112431392-112431414 TTTCAAACAATTGAAAAGGAGGG - Intergenic
1089202230 11:116731496-116731518 GATCATACCATGGCAAAGGGCGG - Intergenic
1089628041 11:119764143-119764165 GCTCACACAATGGCTGAGGAAGG - Intergenic
1091320342 11:134645011-134645033 GTTCACAGATAGGCACAGGAAGG - Intergenic
1092744892 12:11664067-11664089 GTTCCCACGTTGGCAAAGCAGGG + Intronic
1093557678 12:20496303-20496325 TATACCACAATGGCAAAGGATGG - Intronic
1095489267 12:42716192-42716214 TTACACACACTGGCAAATGATGG - Intergenic
1097528997 12:60775091-60775113 TTTCAAACAATCGAAAAGGATGG - Intergenic
1100740372 12:97584986-97585008 TTCCACACAATGGAAAAAGAGGG + Intergenic
1104806017 12:131589933-131589955 TATTACAAAATGGCAAAGGAGGG + Intergenic
1106517243 13:30465675-30465697 ATCCACACAAAGGCAAATGAGGG - Intronic
1107301377 13:38969330-38969352 GATCACAGAAAGGCAAGGGAGGG - Intronic
1108832372 13:54496385-54496407 GGTTACACAATAGAAAAGGAAGG + Intergenic
1109611727 13:64774068-64774090 TTTCAAACAATTGAAAAGGACGG + Intergenic
1109784052 13:67151615-67151637 TTTCACACAGTGACTAAGGATGG + Intronic
1110836595 13:80090643-80090665 TTTCAAACAATTGAAAAGGAGGG - Intergenic
1111067216 13:83109319-83109341 GTTCACACACTTGCAAACAAAGG - Intergenic
1114562036 14:23600233-23600255 AATCACACAAAGGCAAAGGGAGG - Intergenic
1114706298 14:24730107-24730129 TTTCAAACAATTGAAAAGGAGGG + Intergenic
1116175770 14:41468711-41468733 GTGCACACAATGAGAAAAGAAGG - Intergenic
1118479319 14:66147717-66147739 TTTCAAACAATTGAAAAGGAAGG + Intergenic
1119921206 14:78447990-78448012 GAACACACAAAGGCACAGGATGG - Intronic
1121003485 14:90470223-90470245 TTCCAAACAATGGAAAAGGAGGG - Intergenic
1121844376 14:97160032-97160054 GTTCACACATTGGTAAATGAAGG - Intergenic
1124231152 15:27947431-27947453 GGTGGCACAATGGCAAAGAAGGG - Intronic
1124239575 15:28018631-28018653 CTTCACACACTGTCAGAGGAGGG - Intronic
1124362261 15:29046392-29046414 CTTCAAACAAGGGCAAAGGTGGG - Intronic
1126428053 15:48550638-48550660 GTTCACTCAGTGTCAATGGAGGG - Intronic
1126552669 15:49950194-49950216 TTTCAAACAATTGAAAAGGAGGG - Intronic
1127475825 15:59332106-59332128 GGACACAAAATGGTAAAGGAAGG - Intronic
1127545413 15:59990119-59990141 GGTCACACAATAGCAAAGCAGGG - Intergenic
1127695400 15:61441893-61441915 GTTCAACCAATGGCTAAGGATGG + Intergenic
1128923716 15:71634961-71634983 GTGCAAACAATGGCAAACAATGG - Intronic
1130968937 15:88717535-88717557 GATCAGACGATGGCAATGGAGGG + Intergenic
1132138615 15:99369409-99369431 GCTCACACAATTGCAAAGGCTGG + Intronic
1137807638 16:51322413-51322435 GTTCCCACAATGTGATAGGATGG - Intergenic
1141875451 16:86820948-86820970 GTTCACACAATAGCAGAGCAGGG - Intergenic
1143013259 17:3878012-3878034 TTTCACAGAATGGAAAAGAATGG - Intronic
1144262993 17:13541461-13541483 GTACACACATTGGGAATGGAAGG + Intronic
1145734467 17:27217658-27217680 GTTAGCACAAAGGCAAATGAAGG - Intergenic
1148143245 17:45342972-45342994 ATTCACACAGTGGCAAAGCTGGG - Intergenic
1148143582 17:45345368-45345390 ATTCACACAGTGGCAAAGCTGGG - Intergenic
1149257126 17:54839079-54839101 GATCACACTGTGGGAAAGGAGGG + Intergenic
1149360373 17:55888967-55888989 GTTCACAGAATGCCTAATGATGG - Intergenic
1150132794 17:62678413-62678435 TTTCCCACCATGGCAGAGGAGGG - Intronic
1150689341 17:67351042-67351064 GATCAAACATTGGCAAATGATGG - Intronic
1151081829 17:71338176-71338198 GTTCACACAATTTCACAAGAGGG + Intergenic
1152280363 17:79381716-79381738 GTTCAGAAAATGGGAAAAGAGGG - Intronic
1153107274 18:1542301-1542323 GTTAACTCAATAGGAAAGGAAGG - Intergenic
1153914240 18:9731969-9731991 GTGCACACATTTGCAAAGGTAGG + Intronic
1157584261 18:48791127-48791149 GTTGACACCAGGCCAAAGGAGGG + Intronic
1159168236 18:64729037-64729059 GTTCACAGAAAGGAAAAGAAAGG + Intergenic
1159179915 18:64889541-64889563 GTTCTCACATTTGCAAAGTAAGG + Intergenic
1159414092 18:68121449-68121471 CTTCACACAATGGCCAAATAAGG + Intergenic
1160892792 19:1388028-1388050 GTCCACGCAGTGGCAAAGGCTGG + Intronic
1162474515 19:10891888-10891910 GTTCACACAATGGCAAAGGAGGG + Intronic
1163075216 19:14884730-14884752 TTTCAAACAATGGAAAAAGAGGG + Intergenic
1163168249 19:15512203-15512225 TTTCACAGATTGGCAAAGGGAGG + Intronic
1163417065 19:17193273-17193295 GTGCAGCCAATGGCAAAGCAGGG - Intronic
1163990198 19:20991804-20991826 TTTCAAACAATAGCAAAAGAGGG + Intergenic
1166946425 19:46399818-46399840 GGTCGCACAATGCCCAAGGATGG - Intergenic
1167150558 19:47706969-47706991 GTTCACACAAAGGCATACTAGGG - Intergenic
1168306763 19:55440220-55440242 GGTCACACAATGGCAGAGTCAGG + Intronic
925145301 2:1578828-1578850 GTTCATACATTTGGAAAGGAGGG - Intergenic
927568108 2:24132362-24132384 TTTCAAACAATTGAAAAGGAGGG - Intronic
928606987 2:32952283-32952305 ACTCACACAAGGGCAAAGAATGG + Intronic
933052367 2:77615549-77615571 TTTCAAACAATTGAAAAGGAGGG + Intergenic
933972612 2:87482324-87482346 GTTCCCACAATGGTAAGGGCTGG - Intergenic
935114875 2:100126893-100126915 GTTGACACACTGGGAAAGGAGGG + Intronic
936034358 2:109098960-109098982 GTTCATACATTTGGAAAGGAGGG + Intergenic
936321118 2:111467856-111467878 GTTCCCACAATGGTAAGGGCTGG + Intergenic
937860384 2:126703564-126703586 GTTCTCACATGGGCACAGGATGG - Intergenic
939975865 2:148716775-148716797 GTTCAAAAAATTGAAAAGGAGGG - Intronic
940258898 2:151760334-151760356 GTCCACCCTCTGGCAAAGGACGG + Intergenic
941088212 2:161143849-161143871 ATTCAAACAATTGAAAAGGAGGG - Intronic
943074978 2:183183393-183183415 GAACACATAATGGAAAAGGACGG - Intergenic
943158695 2:184218106-184218128 TTCCAAACAATGGAAAAGGAGGG - Intergenic
945018297 2:205543622-205543644 GGTCACACAGTGGCAAAGCCAGG - Intronic
946534748 2:220614540-220614562 GGTCTCACAATGGCAAATGAAGG - Intergenic
946650445 2:221887517-221887539 CTTCACACAGTGGCAGAGAATGG - Intergenic
946990034 2:225318356-225318378 GCTCACACAATGGGAATAGATGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947406210 2:229780238-229780260 GTTTAAAGAATGGCCAAGGACGG - Intronic
948636768 2:239343400-239343422 GTTCACAAAAAGACAGAGGAAGG + Intronic
948684487 2:239661663-239661685 GAACAAACAAGGGCAAAGGAAGG - Intergenic
1169978861 20:11361084-11361106 TTTCAAACAATTGAAAAGGAGGG - Intergenic
1170118182 20:12883980-12884002 TTTCATACAAGGACAAAGGAAGG + Intergenic
1170275646 20:14583944-14583966 GGTAACACAAGGGCAAAGGCTGG - Intronic
1171334458 20:24370895-24370917 GTTCACACAAAGGCAGGTGAGGG + Intergenic
1178082521 21:29079632-29079654 GTGCACTCAATGGCAAACGAGGG + Intronic
1179398183 21:41060240-41060262 GTTGACAAGCTGGCAAAGGAAGG - Intergenic
1181883838 22:26003143-26003165 GATCACACAGGGGCAAAGGTTGG + Intronic
1184415604 22:44350266-44350288 GTCCCCAGAAAGGCAAAGGAAGG + Intergenic
1184562416 22:45270837-45270859 TGTCACACAGTGGCTAAGGATGG + Intergenic
1185310991 22:50154104-50154126 GTTCTCACATTTGGAAAGGAAGG + Intronic
952775816 3:37045182-37045204 TTTCAGAAAATGGAAAAGGAGGG - Intronic
954600340 3:51862804-51862826 GTGCCCACAGTGGCAGAGGAAGG + Intronic
955896681 3:63707776-63707798 CTTCAGACATTTGCAAAGGATGG + Intergenic
959205504 3:103301718-103301740 TTTCAAACAATTGAAAAGGAGGG - Intergenic
960679773 3:120235537-120235559 TTTCAAACAATTGAAAAGGAGGG - Intronic
961154346 3:124666238-124666260 GTTCACACAAGGGCCCTGGAGGG - Intronic
961617610 3:128195349-128195371 ATTAACACCATGGCAATGGAGGG + Intronic
962696615 3:137954263-137954285 ATTCAAACAATTGAAAAGGAGGG - Intergenic
964900672 3:161655092-161655114 TTCCAAACAATGGAAAAGGAGGG - Intergenic
965507827 3:169535539-169535561 TTTCATACAGTGGTAAAGGAAGG - Intronic
965617356 3:170608281-170608303 GCTCACACATTGGCAAACAAGGG + Intronic
969246852 4:5940251-5940273 GTTCATACATTTGGAAAGGAGGG - Intronic
969308749 4:6340065-6340087 GTTCCTACAATGGCACAGGTGGG + Intronic
971593738 4:28500460-28500482 TTACACAGAATGGCAAAGGAGGG + Intergenic
971655378 4:29337457-29337479 TTTCACACAATGTCTGAGGAAGG + Intergenic
973204930 4:47549815-47549837 GTTCACAGATTGGAAAAGGAAGG + Intronic
974768993 4:66386174-66386196 TTTCAAACAATTGAAAAGGAGGG + Intergenic
974836298 4:67255135-67255157 TTTCAAACAATAGAAAAGGAAGG - Intergenic
975724939 4:77282717-77282739 CTTCACACTTAGGCAAAGGAAGG + Intronic
976068799 4:81218632-81218654 CTTCAGTCAATGGCAAAGAAAGG - Intergenic
976527533 4:86111762-86111784 GTCCAAACAATTGAAAAGGAGGG - Intronic
977687737 4:99868454-99868476 GAACACACAATGGAAGAGGAAGG + Exonic
979064843 4:116117776-116117798 ATTCACAAATGGGCAAAGGAGGG + Intergenic
979823174 4:125199767-125199789 GTTGACACAAAGGCTAAGGCAGG - Intergenic
979825957 4:125232482-125232504 GCTCATACAATGGAAAAGTATGG + Intergenic
981180720 4:141740831-141740853 AAACACACAATGGGAAAGGATGG + Intergenic
981187351 4:141819289-141819311 TTCCAAACAATTGCAAAGGAGGG + Intergenic
982561191 4:156930105-156930127 ATTCACACAATGGCATATAAGGG - Intronic
983134607 4:164065185-164065207 TTTCAAACAATTGAAAAGGAGGG - Intronic
984076059 4:175181459-175181481 TTTCAAACAATTGAAAAGGAGGG - Intergenic
986328799 5:6702557-6702579 TCTCAGTCAATGGCAAAGGAAGG - Intergenic
986409530 5:7463433-7463455 GTTCCCTCAAGTGCAAAGGAAGG - Intronic
988110793 5:26816310-26816332 TTTCAAACAATTGAAAAGGAGGG + Intergenic
990920026 5:60953382-60953404 GTTAAAACAAAGGCAAATGAAGG + Intronic
991027402 5:62044978-62045000 GTTCACAGAATGATAAATGATGG - Intergenic
993375624 5:87146699-87146721 TTCCAAACAATGGAAAAGGATGG - Intergenic
993589897 5:89781379-89781401 TTTCAAACAATTGAAAAGGAAGG + Intergenic
993808228 5:92439418-92439440 TTCCAAACAATTGCAAAGGAGGG + Intergenic
993876019 5:93307945-93307967 GTTCTTACAATAGCAAAAGATGG + Intergenic
995197447 5:109387953-109387975 GGTCACATAATGGAAAAAGAGGG + Intronic
995330692 5:110942642-110942664 TTTTAGACAATGGCAAAGGAAGG + Intergenic
996347057 5:122498891-122498913 GGTCACACAATGGCACAGCTGGG + Intergenic
1000509936 5:162168216-162168238 TTCCAAACAATGGAAAAGGAGGG + Intergenic
1000592539 5:163175971-163175993 GTGCACACATTGGGAAAGGGAGG + Intergenic
1001077530 5:168641692-168641714 GACCACACAGTGGCAGAGGATGG - Intergenic
1002296784 5:178235821-178235843 GGCCACACACTGGCTAAGGAGGG - Intergenic
1003682347 6:8268619-8268641 GTTCCCACAGTGACAGAGGAAGG + Intergenic
1006053130 6:31358666-31358688 CTTTACACAATAGCAAAGAATGG + Intergenic
1007970301 6:46045380-46045402 GTTCCCACATTGCAAAAGGAAGG - Intronic
1008072379 6:47110825-47110847 GGTCTCAAAATGGCAAAGAATGG - Intergenic
1011796187 6:90955207-90955229 GATGACACAATGACAAAGCAAGG + Intergenic
1011802870 6:91037386-91037408 GTCCACACAGTGGCTTAGGAGGG + Intergenic
1012740850 6:103015049-103015071 TTTCAAACAATTGAAAAGGAAGG - Intergenic
1014852028 6:126352350-126352372 GTTGCCAAAATGGCAAAAGAGGG + Intergenic
1015789663 6:136953595-136953617 ATCTACACAATTGCAAAGGATGG + Intergenic
1016770582 6:147845902-147845924 GTTCACACAAAAACAAAGCATGG + Intergenic
1016790052 6:148059063-148059085 TTTCAAACAATGGAAAAGGAGGG - Intergenic
1023192420 7:37597054-37597076 GTTCACACAGTGGCCAGAGATGG - Intergenic
1024659572 7:51480153-51480175 GTGCACAAAATGGCAAAGGAAGG + Intergenic
1025524780 7:61791368-61791390 ATTCACACAAAGGCGAAGAACGG + Intergenic
1027174865 7:75896885-75896907 TTTCACACATTTTCAAAGGATGG + Intergenic
1027606195 7:80301848-80301870 CTTTACACAAAGGCAAGGGATGG + Intergenic
1027944410 7:84726506-84726528 TTTCAAACAATTGAAAAGGAGGG + Intergenic
1028793717 7:94881199-94881221 GTTCGTACAGTGGAAAAGGATGG + Intergenic
1028884177 7:95912786-95912808 ATTCAGACAAAGGCAGAGGAAGG - Intronic
1030482667 7:110123729-110123751 TTTCAAACAATGGAAAAAGAGGG + Intergenic
1031960837 7:127988431-127988453 GTAGACACAAAGGCAAAGAAGGG - Intronic
1036064611 8:5365341-5365363 GCTCAGGAAATGGCAAAGGATGG + Intergenic
1042320450 8:67469751-67469773 GTTCACACAATTACAGAGGTTGG - Intronic
1043948967 8:86286584-86286606 GTTGTTACAATGGAAAAGGAAGG - Intronic
1045721076 8:105111577-105111599 GTGCATAGAATGGCAAAGGCTGG + Intronic
1046175056 8:110564724-110564746 GAATACAAAATGGCAAAGGAGGG - Intergenic
1051973504 9:22920588-22920610 ATTCAGACAATGAAAAAGGAAGG - Intergenic
1052210895 9:25901936-25901958 ATTAACACAATGGATAAGGATGG + Intergenic
1053378770 9:37631134-37631156 GATCACTGAATGGAAAAGGAAGG + Intronic
1055343010 9:75305513-75305535 TTCCAAACAATGGAAAAGGAGGG - Intergenic
1055696708 9:78892611-78892633 GTTAACACAATTGCACTGGATGG - Intergenic
1060617049 9:125026590-125026612 GATGTCACAATGCCAAAGGAGGG - Intronic
1060919722 9:127411746-127411768 GTTCACATGATGGCCAAGCACGG + Intergenic
1187891466 X:23939293-23939315 GTTTTCACAATGTCAAAAGATGG - Exonic
1188229549 X:27644715-27644737 GTCCAAACAATTGAAAAGGAGGG + Intronic
1189439347 X:41020398-41020420 GTTCACCAAATGGAAAAGCAGGG + Intergenic
1190897735 X:54638128-54638150 TTTCAAAAAATTGCAAAGGATGG - Intergenic
1191865130 X:65697904-65697926 TTTCACAGAATGGAACAGGAAGG - Intronic
1194021678 X:88699109-88699131 TTTCAAACAATTGAAAAGGAGGG - Intergenic
1194580901 X:95669407-95669429 TTTCAAACAATTGAAAAGGAGGG + Intergenic
1195890885 X:109693729-109693751 GTTCAGACAAAGGCAATTGATGG + Intronic
1197314982 X:124954609-124954631 GATGACATAATGGCAAGGGAGGG + Intronic
1197516271 X:127433785-127433807 TTTCAAACAATTGAAAAGGAGGG - Intergenic
1199042291 X:143127723-143127745 GGTCACACTGTGGCAAAAGATGG - Intergenic
1199541637 X:148964448-148964470 ATCCACACAATGGAAAAGGAAGG + Intronic