ID: 1162475483

View in Genome Browser
Species Human (GRCh38)
Location 19:10896879-10896901
Sequence GTGGGTGGCGAGGATGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 361}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162475474_1162475483 4 Left 1162475474 19:10896852-10896874 CCGAGTGCCTAGTGAGCAGATAG 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1162475483 19:10896879-10896901 GTGGGTGGCGAGGATGCTGAGGG 0: 1
1: 0
2: 4
3: 37
4: 361
1162475473_1162475483 10 Left 1162475473 19:10896846-10896868 CCATTGCCGAGTGCCTAGTGAGC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1162475483 19:10896879-10896901 GTGGGTGGCGAGGATGCTGAGGG 0: 1
1: 0
2: 4
3: 37
4: 361
1162475477_1162475483 -3 Left 1162475477 19:10896859-10896881 CCTAGTGAGCAGATAGGGAAGTG 0: 1
1: 0
2: 3
3: 20
4: 179
Right 1162475483 19:10896879-10896901 GTGGGTGGCGAGGATGCTGAGGG 0: 1
1: 0
2: 4
3: 37
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162475483 Original CRISPR GTGGGTGGCGAGGATGCTGA GGG Intronic
900562082 1:3312232-3312254 CAGTGGGGCGAGGATGCTGACGG - Intronic
900996960 1:6127983-6128005 GTGGGGGGCGGGGCTGCGGATGG + Intronic
902383688 1:16064625-16064647 TTGGGTTGCCAGGATGCTGACGG - Intronic
902542734 1:17166200-17166222 GTGGGTGGTGGGGATGTTGGTGG - Intergenic
902950280 1:19877331-19877353 GTGGGTGCAAAGGATGCGGAAGG - Intergenic
903085463 1:20853596-20853618 GTGGATGGCGTGGACCCTGAGGG + Exonic
903659147 1:24966308-24966330 GTTGGTGGCCAGGCTGCAGAGGG - Intergenic
903812685 1:26043618-26043640 GTGGGTGGGGAGGATCCTGAAGG - Intronic
903933271 1:26876847-26876869 ATGGGTGCAGAGAATGCTGAGGG + Exonic
903999919 1:27333065-27333087 GTGAGTGGCAGGGAAGCTGATGG - Intronic
904439250 1:30519169-30519191 GATGATGGAGAGGATGCTGATGG + Intergenic
905157872 1:36002658-36002680 GTGGGTGGTGAGGCTACTGTGGG - Intronic
907515632 1:54991639-54991661 GTGGGTGGCGGGAAGGCTGAGGG + Intronic
908110110 1:60888375-60888397 GTGTTTGGCGAGGGTGCTGATGG - Intronic
912380649 1:109246430-109246452 GTGGGGAGGGAGGCTGCTGATGG - Intergenic
912455446 1:109793609-109793631 GTGGGTGGCGAGGGTTGAGAGGG + Intergenic
912958026 1:114169693-114169715 GGGGGTGTTGAGGTTGCTGAGGG + Intergenic
913131178 1:115839240-115839262 GAGGGAGGAGAGGATGCAGAGGG + Exonic
916065641 1:161133272-161133294 GGGGGTGGGGAGGATGGTGCGGG + Intergenic
916078722 1:161218629-161218651 CTGGGTGGGGCAGATGCTGAGGG + Intronic
917977665 1:180250766-180250788 GAGGGTGGAGAGGAAGGTGATGG + Intronic
919325039 1:196097019-196097041 GGGGGTGGCGGGAGTGCTGAAGG - Intergenic
920109208 1:203575318-203575340 GGGGGTGGTGTGGATGGTGAGGG - Intergenic
920131685 1:203736910-203736932 GTGGGTGGAGAGAAGGGTGAGGG - Intronic
920202826 1:204270493-204270515 GTGGGTGGCTAGGTGGCTCATGG - Intronic
920251464 1:204624932-204624954 CTGGGTGGGAGGGATGCTGAGGG + Intronic
921168286 1:212523258-212523280 GCGGGTGGTGAGGGTGCTGGTGG + Intergenic
921266598 1:213425853-213425875 GTGGCCGGGGCGGATGCTGAAGG + Intergenic
922800268 1:228361888-228361910 GTGGACGGGGAGGCTGCTGAGGG + Intronic
922873689 1:228923273-228923295 GATGGTGGCGATGATGATGATGG + Intergenic
923039191 1:230307757-230307779 TTGGGTAGAGAGGATGCTCAGGG + Intergenic
923043097 1:230333733-230333755 GTGGGTGGAGAGCTTCCTGAGGG + Intronic
924454326 1:244206486-244206508 GTGGGTGGAGAGGAGGAAGAAGG - Intergenic
1062912371 10:1219908-1219930 GGTGGTGGCGATGATGGTGATGG + Intronic
1065099962 10:22322076-22322098 GTGCGTCGCGAGGGTGCGGAGGG - Intronic
1065117568 10:22497487-22497509 GTGATTGGAGAGGATGCTGAAGG + Intergenic
1067163565 10:43846945-43846967 GTGGGTGGTGAGGAAGCAGGAGG + Intergenic
1067181089 10:43986498-43986520 GTGGGTGGGGAGGGTGGGGAAGG - Intergenic
1067691846 10:48507089-48507111 GTGGATGGCTAAGATGATGATGG - Intronic
1067730728 10:48809448-48809470 GCTGGTGGTGAAGATGCTGATGG - Intronic
1067730751 10:48809616-48809638 GTTGGTGGTGATGATGATGATGG - Intronic
1069613617 10:69792143-69792165 GTGGGTGGTGGTGATGGTGACGG - Intergenic
1069875973 10:71563071-71563093 GTGGGTGGGGAGGCAGCTGTTGG + Intronic
1070157730 10:73846401-73846423 GTGGGTGGTGGGGTTACTGAAGG - Intronic
1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG + Intergenic
1072954075 10:99873613-99873635 TTGGGTGGAGAGGGTGCTGTGGG + Intergenic
1074268970 10:111934065-111934087 GAGGGTGACGAGAATGCAGATGG - Intergenic
1074275093 10:111993451-111993473 GTGGGTGGCTAGGATTCAAAAGG - Intergenic
1074454772 10:113587636-113587658 GAAGGTGGCGAGGATGATGATGG - Intronic
1074568373 10:114601932-114601954 ATGGGTGGTGAGGGTCCTGAGGG + Exonic
1075527490 10:123198823-123198845 GTGGGTGGTGAGGAGGGTTAGGG + Intergenic
1076753411 10:132555092-132555114 GTGGGTGGCATGGCTGCTGTGGG + Intronic
1076798557 10:132810357-132810379 GTGGCTGCAGAGGGTGCTGAAGG + Intronic
1076994511 11:291523-291545 GGGGGTGACGGGGACGCTGAGGG + Intronic
1077479663 11:2807688-2807710 GTGGGTGGGGAGGAGGCTGAGGG - Intronic
1077546698 11:3174415-3174437 ATGGCTGGCGATGATGGTGATGG - Intergenic
1077865997 11:6222469-6222491 GAGGGTGTCGAGGATGGTGTGGG + Exonic
1078246293 11:9574825-9574847 GCGGTTCGCGAGGATGCTGGAGG + Intronic
1079240813 11:18721152-18721174 GTGGGTGGCGAGGTGCCGGAGGG - Intronic
1080036537 11:27718449-27718471 GTGGGTGGCGATGGTGATGCGGG + Intronic
1080788008 11:35493616-35493638 GAAGGTGGTGAGCATGCTGATGG - Intronic
1080934084 11:36843381-36843403 AGGGGTGGTGAGGATGCTGCTGG + Intergenic
1081528283 11:43942096-43942118 GGGGGTGGCAAGGATCCAGAAGG + Intronic
1081670150 11:44938226-44938248 GTGGGCGGGGAGGATGACGACGG - Exonic
1081763022 11:45590482-45590504 GTGGGTGGGGAGCAGGCTGTTGG - Intergenic
1084266469 11:68007945-68007967 GTGGGTGGAGGGGTTGCTCAGGG - Intergenic
1084531747 11:69731534-69731556 GTGGATGGCGAGGATGTCGGAGG - Intergenic
1084687006 11:70702355-70702377 GTTGGTGGTGATGATGGTGATGG - Intronic
1084858594 11:72004055-72004077 GGGTGTGTTGAGGATGCTGAAGG + Exonic
1084934483 11:72579567-72579589 GTGGGTGTTGAGGATGGCGATGG + Exonic
1085419153 11:76340755-76340777 GTGAGAGTGGAGGATGCTGATGG + Intergenic
1085884084 11:80501579-80501601 GAGGGTAGTGAGGATGATGACGG + Intergenic
1086279094 11:85164923-85164945 GTGGGTGGTGCTGATGCTGCTGG - Intronic
1086279185 11:85166016-85166038 CTGGGTGGCGCTGATGCTGCTGG - Intronic
1086330729 11:85751496-85751518 GTGTGTGGAGAGGATGGTAAAGG - Intronic
1088751036 11:112842264-112842286 GTGGGTTGGGATCATGCTGAGGG + Intergenic
1088873371 11:113911894-113911916 GTGGGTGAAGAGGATGGGGATGG - Intronic
1090063096 11:123480495-123480517 GTGGGTAGAGAGAATGCTGGAGG + Intergenic
1090204332 11:124876327-124876349 GCGGCTGGCGAGGGTGCTGCGGG + Exonic
1090205909 11:124884314-124884336 GGGTCTAGCGAGGATGCTGAAGG - Exonic
1090406554 11:126479237-126479259 GGGGATGGAGAAGATGCTGAAGG - Intronic
1090458453 11:126869279-126869301 CTTGGTGGGGATGATGCTGAGGG + Intronic
1091301580 11:134511184-134511206 GTGGCCGGCAAGGATGCTGTGGG + Intergenic
1091813561 12:3419531-3419553 GTGGGTGGCGAGGGGGCAAAGGG - Intronic
1092040293 12:5378321-5378343 GTGGGGAGGGAGGAGGCTGAAGG - Intergenic
1093046856 12:14456554-14456576 GTGGGTTGGGTGGATGCTGGGGG - Exonic
1093412744 12:18886258-18886280 GTGGCTGGGGAGGCTGCTGCAGG - Intergenic
1094352898 12:29546292-29546314 GAGGGTGGCCAGAAAGCTGAGGG + Intronic
1095159938 12:38904963-38904985 GTGGGTGGGGAGGAAGCTGCCGG + Intronic
1096968084 12:55644484-55644506 GTGGTTGGCTAGGATGCTGCAGG - Intergenic
1101248871 12:102911701-102911723 GTGGGTGGGGAGGAAGATGGGGG - Intronic
1102147592 12:110666614-110666636 GAGTGTGGCGAGGAGGCTGTGGG - Intronic
1102676894 12:114665312-114665334 GTGGGGGTCGGGGATGGTGAGGG + Intergenic
1103199549 12:119076003-119076025 GATGGTGGCGATGATGATGATGG + Intronic
1103934261 12:124467092-124467114 GAGGATGACGAGGATGATGAGGG - Intronic
1103934399 12:124467706-124467728 GAGGGTGATGAGGATGATGAGGG - Intronic
1103934478 12:124468029-124468051 GAGGGTGATGAGGATGATGAGGG - Intronic
1103934545 12:124468304-124468326 GAGGGTGATGAGGATGATGAGGG - Intronic
1103934658 12:124468771-124468793 GAGGGTGATGAGGATGATGAGGG - Intronic
1104798898 12:131539850-131539872 GACGGTGGTGATGATGCTGATGG + Intergenic
1104927704 12:132322182-132322204 CTGGGTGGCGGGGATGGTTACGG - Intronic
1105899724 13:24744395-24744417 GTGGAAGGCCAGGCTGCTGATGG - Intergenic
1106569587 13:30915150-30915172 GTGGGGGGTGAGGATACAGAGGG - Intronic
1108246607 13:48521719-48521741 GTGGGTATGGAGAATGCTGAAGG - Intronic
1108962448 13:56251673-56251695 ATGGGTAGGGAGGATGGTGATGG - Intergenic
1111042607 13:82769918-82769940 GTGGGAAGTGAGGATGCTTAAGG - Intergenic
1113717859 13:112526435-112526457 ATGGGTGGCGACGGTGATGATGG - Intronic
1115222924 14:31074817-31074839 GTGGGTGGAGGGGATAATGAGGG - Intronic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1119633698 14:76256846-76256868 GTGGGTGTTGGGGAGGCTGATGG - Intergenic
1121438039 14:93931823-93931845 GTGGGTGTCGGGGATGGTGAAGG - Intergenic
1121449014 14:93996168-93996190 GTGGGGGACGTGGATGCAGAGGG - Intergenic
1121847079 14:97181088-97181110 GTGGGTGGTGAGGAAGGCGAAGG + Intergenic
1122044557 14:99014120-99014142 GTGGGTGTCATGGATGGTGAAGG - Intergenic
1122344763 14:101051595-101051617 GTAGGTAGCCTGGATGCTGAGGG - Intergenic
1122371198 14:101229950-101229972 GGGGGGGGCGAGGCTGCGGAGGG - Intergenic
1122371230 14:101230020-101230042 GTGGGGGGCGAGGCTGCGGAGGG - Intergenic
1122867988 14:104617910-104617932 GAGCTGGGCGAGGATGCTGAGGG - Intergenic
1122970648 14:105150823-105150845 GTGTGTGGCGTGGGTGCTGCGGG - Intronic
1123695703 15:22877739-22877761 GTGGGTGGCCAGGACAATGAAGG + Intronic
1124047560 15:26164141-26164163 GTGGGTGGCAAGGAAGGTGGTGG + Intergenic
1124171097 15:27374745-27374767 ATGGAGGACGAGGATGCTGAGGG + Intronic
1125505664 15:40266244-40266266 GTGGGGGGCGAGGCTCCTGGTGG - Exonic
1126243812 15:46478549-46478571 GTGTGTGACGAGAATGCTTAAGG + Intergenic
1126800192 15:52291258-52291280 GAAGGTGGCCTGGATGCTGAGGG + Intronic
1126861758 15:52891155-52891177 TTGGCTGGGGAGGATGCTGGAGG + Intergenic
1128776986 15:70328154-70328176 GGGGGTGGTGGGGATGGTGAGGG - Intergenic
1129718937 15:77867138-77867160 GTGGGCAGTGAGGAGGCTGAGGG - Intergenic
1129851522 15:78796546-78796568 GCGGGTGGCGGGGATGGTGTTGG - Intronic
1130056716 15:80532606-80532628 GTGAGTGGCCAGCATGCTGTTGG + Intronic
1130459997 15:84153722-84153744 GTGGGCAGTGAGGAGGCTGAGGG + Intergenic
1131299725 15:91186714-91186736 GTGGGGGGTGAGGAGGTTGAGGG + Intronic
1132152972 15:99475394-99475416 GCTTGGGGCGAGGATGCTGAAGG - Intergenic
1132207714 15:99997917-99997939 GTGAGTGAAGAGGATGCTGGCGG + Intronic
1132406500 15:101544371-101544393 GTGGGTGGAAAGGAGTCTGAAGG + Intergenic
1132697128 16:1206994-1207016 GTGCATGCCCAGGATGCTGAGGG - Exonic
1132763757 16:1524286-1524308 GTGGGTGGTGAGGCTGCTCACGG - Intronic
1132771925 16:1568217-1568239 CTTGCTGGGGAGGATGCTGATGG + Exonic
1133018513 16:2955747-2955769 GAGGGTGGCCAGGACTCTGAGGG + Intergenic
1133732879 16:8591147-8591169 GTTGGTGGTGATGATGGTGATGG - Intergenic
1134233237 16:12445693-12445715 GAGGTTGGAGAGGAAGCTGATGG - Intronic
1134271961 16:12740703-12740725 GTGGGTGATGAGAATGCTGGGGG + Intronic
1134564362 16:15238239-15238261 CTGAGTGGCCAGGATGCTCAGGG + Intergenic
1134738133 16:16518460-16518482 CTGAGTGGCCAGGATGCTCAGGG - Intergenic
1134929367 16:18193703-18193725 CTGAGTGGCCAGGATGCTCAGGG + Intergenic
1135354952 16:21761323-21761345 GTTGGTGGGGAGGAGGCAGATGG - Intergenic
1135453436 16:22577465-22577487 GTTGGTGGGGAGGAGGCAGATGG - Intergenic
1135504384 16:23023341-23023363 GTGGATGGAGAGGATGCAGAGGG - Intergenic
1135539090 16:23316284-23316306 GATGGTGGTGAGGATGGTGATGG - Intronic
1136548940 16:30971584-30971606 CTGGGGGGCGGGGAGGCTGAGGG - Exonic
1139893498 16:70269711-70269733 GTTGGTGCTGAGGATGCCGATGG - Exonic
1141683578 16:85557406-85557428 GTGGGTGGGGAGGGTGATGTGGG + Intergenic
1141785016 16:86193648-86193670 CTGGATGGCGAGGTGGCTGAGGG - Intergenic
1142267346 16:89070716-89070738 GGGGGTGGTGAGGGTGCTGGTGG - Intergenic
1142778130 17:2157907-2157929 GTGGGAGGAGAGCTTGCTGATGG - Intronic
1143158206 17:4852414-4852436 GTGGGAGGAGAGGATTGTGAGGG + Intronic
1143474886 17:7196836-7196858 GTGGGTGGCGAGGACGGTGAAGG - Exonic
1144693906 17:17288268-17288290 GAGGGGGAGGAGGATGCTGAAGG + Intergenic
1145093875 17:20008725-20008747 GAGGGTAGGGAAGATGCTGAGGG + Intergenic
1146910202 17:36643530-36643552 GTGGGTGGAGAGGATGGTGGGGG + Intergenic
1147181076 17:38686090-38686112 GGGGGTGGAGTGGGTGCTGATGG - Intergenic
1148034263 17:44646645-44646667 CTGGGTGGTGATGATGCTGTTGG + Intergenic
1148645915 17:49219685-49219707 GTGGGTGGCGAGGCTGGGGGAGG - Intronic
1148700350 17:49583070-49583092 GTGGGTGGCAGGGATCCTGGGGG + Intronic
1150837494 17:68577501-68577523 GTTGGTGGGGAGAGTGCTGAGGG + Intronic
1150917563 17:69451951-69451973 GTGGGTGGCAAGGAGGCTGTTGG + Intronic
1151702786 17:75752315-75752337 CTGGGTGGCCAGGTTGATGATGG - Exonic
1152293087 17:79451912-79451934 CTGGGTGGCAGGGATGCTGTGGG - Intronic
1152565468 17:81098291-81098313 GAGAGTGGCGAAGAAGCTGAGGG - Intronic
1152659384 17:81535366-81535388 GGGGATGGCGATGATGGTGATGG - Intronic
1152758342 17:82096502-82096524 CTGGGTGCCGAGGCTGTTGACGG - Intronic
1153942034 18:9986747-9986769 GCGGGAGCCGAGGATGCTAAGGG + Intergenic
1155881202 18:31150565-31150587 GACGGTGGCGATGATGATGACGG - Intronic
1158637863 18:59177282-59177304 GTGGGTGGAGAGGGTGCCCAAGG - Intergenic
1159002952 18:62989287-62989309 CTGGGTGGGGAGAGTGCTGATGG - Intergenic
1159116197 18:64115466-64115488 GTGTGTGGGGAGGCTGCTTATGG + Intergenic
1160828295 19:1090830-1090852 GTGGGTGGCCAGGAAGATGTGGG - Intronic
1160862293 19:1242511-1242533 GTGGGCCGCCAGGATGCCGAAGG - Exonic
1162043018 19:7981802-7981824 CTGGGTGGTGAGGATGAGGAAGG + Intronic
1162070829 19:8151340-8151362 GTGGGGGGGGAGCCTGCTGAGGG - Intronic
1162183530 19:8887165-8887187 GTGGGTGGTGCTGATGCTGGTGG - Intronic
1162309167 19:9895021-9895043 GGGGGTGGGGAGGATGGAGATGG - Intronic
1162475483 19:10896879-10896901 GTGGGTGGCGAGGATGCTGAGGG + Intronic
1162826957 19:13258696-13258718 GAGGGAGGTGAGGATGCTGAGGG + Intronic
1163054243 19:14706375-14706397 GTGGATGGCCAGGAGGTTGAGGG - Intronic
1163241039 19:16064140-16064162 GGAGGTGGCTGGGATGCTGATGG + Intergenic
1164578595 19:29420604-29420626 GTGGGTGGAGAGGAGGCCGGGGG - Intergenic
1164578624 19:29420751-29420773 GTGGGTGGAGAGGAGGCCGGGGG - Intergenic
1164578635 19:29420800-29420822 GTGGGTGGAGAGGAGGCCGGGGG - Intergenic
1164578645 19:29420837-29420859 GTGGGTGGAGAGGAGGCTGGGGG - Intergenic
1164926031 19:32130659-32130681 GTAGCTGACGAGGATGCTGTGGG - Intergenic
1165808670 19:38597173-38597195 GTGGGTGGCGAGGAGGATAGAGG - Intronic
1166075257 19:40410438-40410460 GTGGGGGGCGTGGGTGCTGTGGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166774202 19:45302664-45302686 GCGGGTGACGAGGGTGCGGAAGG - Exonic
1167254624 19:48419720-48419742 GTAGCTGGCGAGGAAGATGACGG - Exonic
1167605150 19:50477865-50477887 GTGGGTGACTACTATGCTGAGGG + Intronic
1168180514 19:54659717-54659739 GAGGGTGGTGAAGAAGCTGAAGG - Intronic
925130183 2:1488893-1488915 GTGAGTTGGGAGGATGCAGAAGG + Intronic
925405901 2:3605383-3605405 GTGGGTGCCGAGGAGGGGGAGGG + Intronic
925717377 2:6796825-6796847 GGGGCAGGTGAGGATGCTGAGGG - Intergenic
926035338 2:9631294-9631316 CGGGGTGGCGGGGAGGCTGAGGG - Intergenic
926926865 2:17995988-17996010 GTGGGTGGGGAAGATGCCTAGGG - Intronic
927129935 2:20050703-20050725 GTAGGTGGCCAGGATGGAGAGGG + Intronic
927216673 2:20671337-20671359 GTCGATGTAGAGGATGCTGATGG - Exonic
927441252 2:23119625-23119647 GTGGATGGGGAGGGTGATGATGG - Intergenic
928937963 2:36700372-36700394 GTTGGTGGTGATGATGATGATGG + Intronic
930571140 2:53088570-53088592 GGGGGTGGCTGGGATGCTGATGG - Intergenic
932490306 2:72115923-72115945 GAGGGTGGGGCTGATGCTGAAGG + Intergenic
932625578 2:73293373-73293395 GCGGGTGGCGGGGAGGCTGGCGG + Exonic
933215910 2:79629717-79629739 GAGGGAGGAAAGGATGCTGAAGG + Intronic
934066047 2:88343006-88343028 GTGGGAGGCTGGGAGGCTGAAGG - Intergenic
934629184 2:95897107-95897129 GTGGGTGATGATGATGCTGCTGG - Intronic
935147255 2:100404258-100404280 GCTGGTGGTGAGGATGCTGTTGG - Intronic
936344674 2:111666265-111666287 GAGGGTGGTGAGGATGCTGCTGG + Intergenic
937226052 2:120369488-120369510 GGGGGTGTGGAGGTTGCTGAGGG - Intergenic
938260909 2:129894885-129894907 GTTTGTGGTGAGGGTGCTGAGGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
939466363 2:142562006-142562028 GAGGGAGGCCAGGAGGCTGAGGG + Intergenic
940398967 2:153224336-153224358 GGGGGTGGGGAGGAGGCTGTGGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
944770639 2:202911250-202911272 GTGAGTGTGGAGGAGGCTGAAGG - Intronic
945185103 2:207132522-207132544 GTGGGTGGTGAGGATGTTGGAGG + Intronic
945930593 2:215851136-215851158 CTGGGTGGAGAGGAAGCTGAAGG + Intergenic
946202802 2:218080743-218080765 GAGGGAGGGAAGGATGCTGATGG - Intronic
946386667 2:219387966-219387988 GTGGGCGGGGCGGATGCCGAGGG - Exonic
946389779 2:219408520-219408542 GGGGGTGACGAGGACGATGAAGG + Intergenic
946662808 2:222019276-222019298 ATGGATGGCCAGGAGGCTGAGGG + Intergenic
946788832 2:223277778-223277800 GTGGGTGAGGAGGATGATGAAGG - Intergenic
948531882 2:238614327-238614349 ATGGGTGGGGTGGATGCAGATGG - Intergenic
948599178 2:239098465-239098487 GTGGGTGCCGGTGATGCTCAGGG - Intronic
948886704 2:240888406-240888428 GTGGGTGGCGTGGATGCGCAGGG + Exonic
1169126289 20:3129541-3129563 GGGGGTGGTGAGGGTGGTGATGG - Intronic
1169235381 20:3926038-3926060 GTGGGTGGCCAGAATGGAGAGGG + Intronic
1169924152 20:10765664-10765686 TTGGGTGGCTAGGAGGGTGATGG + Intergenic
1170614555 20:17938294-17938316 TTGGGTGGGGTGGTTGCTGAAGG + Intergenic
1171446428 20:25207582-25207604 GTGAGTGGTGACCATGCTGAAGG + Intronic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1171878910 20:30602367-30602389 GATGGTGGTGAGGATGATGATGG - Intergenic
1172114922 20:32568127-32568149 GATGGTGGTGAGGATGGTGATGG - Intronic
1172129747 20:32647849-32647871 GTGGGTGGTGAGGCTGGGGAAGG - Intergenic
1172567145 20:35939345-35939367 GTGGGGGGCGCGGGTGCAGAGGG + Intronic
1172779050 20:37424970-37424992 GCGGGTGGTGAGGATGGGGAAGG + Intergenic
1172940653 20:38651712-38651734 GTTGATGGCGATGCTGCTGATGG + Intergenic
1175408257 20:58749262-58749284 GTGGGTGGCTGGGATGGTGGTGG + Intergenic
1175912967 20:62413428-62413450 GTGGGTGGGGAGGCGGCTGTGGG + Exonic
1178859159 21:36274685-36274707 GTGGGTGGTCAGGATGGTGAGGG + Intronic
1179128299 21:38611775-38611797 CTGGGTGCCGAGGATGCAGCGGG - Intronic
1179167221 21:38944481-38944503 GAGGGTGGAGAGGGCGCTGATGG - Intergenic
1179411525 21:41167307-41167329 GTGGGGGGCGTGGCTGCTGCTGG - Intergenic
1179543761 21:42100900-42100922 GTGGGTGGGGAGGGTGAGGAGGG - Intronic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1179879842 21:44288862-44288884 ATGGCGGGCGAGGATGCTGCAGG - Intronic
1180743076 22:18067277-18067299 GTGGATGGCGAGGCTGGAGAGGG - Intergenic
1181002455 22:19994267-19994289 ATGGGTCGGGGGGATGCTGAAGG + Intronic
1181268082 22:21642674-21642696 GAGGGTGTCGAGGATATTGAGGG + Intronic
1182679002 22:32063666-32063688 GTGGGTGGGGAGGTGACTGATGG + Intronic
1183749640 22:39712545-39712567 CTGGGTGCAGAGGATGCAGAAGG + Intergenic
1183949699 22:41345933-41345955 CGGGGTGGCGAGGGTGCTGCGGG + Intronic
949327873 3:2887399-2887421 GTGGGGGGCAAGGGTGTTGACGG + Intronic
949919500 3:8990092-8990114 GTTGGTGGCTAGCATGGTGACGG + Intronic
950406673 3:12809227-12809249 GTGTGTGGGGAGGAAGGTGATGG + Intronic
950538209 3:13594172-13594194 GTGGGTGGGTAGGATACTGAGGG + Intronic
952277141 3:31887916-31887938 GTGGTTTGGGAGGATGGTGATGG - Intronic
952708597 3:36406142-36406164 CTGGGTGGGGAGGGGGCTGAGGG - Intronic
953023295 3:39129701-39129723 GTGGGAGGTGGGGATGCTGAGGG + Intronic
953658320 3:44871606-44871628 GTGGGGGAGGGGGATGCTGATGG + Intronic
953661583 3:44894859-44894881 GTGTGAGGAGAGGATGCTGAGGG - Intronic
954128917 3:48549822-48549844 GTGGGGGGAGAGGTTGCTGGGGG - Intronic
954748039 3:52798091-52798113 GTTGGGAGTGAGGATGCTGAGGG + Intronic
957835923 3:85589145-85589167 GTGTGTGGGGAGGAGGCTGGGGG + Intronic
957866548 3:86031980-86032002 CTGAGTGGGGAGGATGTTGACGG + Intronic
958531769 3:95341586-95341608 GGGGGTGGCGGGGAGGGTGACGG - Intergenic
964290024 3:155168015-155168037 GTGGTTGGCAAGGAAGCTGTAGG + Intronic
965081766 3:164041900-164041922 GGGGGTTGAGAGGAGGCTGAAGG - Intergenic
965083735 3:164067386-164067408 ATGGGTGCAGAGGATGATGAGGG + Intergenic
967390201 3:188947800-188947822 GGGGGTGGGGAGGAGGCTGCAGG - Intronic
967853593 3:194100157-194100179 GTGGGTGGTGGGGAGGCTCAAGG - Intergenic
968460899 4:724240-724262 GTGGGTGACAAGGAGGCTCAGGG + Intronic
969676582 4:8617737-8617759 GTGGGGTCCAAGGATGCTGAAGG - Intronic
969703841 4:8781638-8781660 GTTGGGGGGGAGGGTGCTGAGGG - Intergenic
970132358 4:12885653-12885675 GTGGGTGGGGAGGGGGCTGTCGG - Intergenic
971459464 4:26878940-26878962 GTGTGGGGGGAGGATCCTGATGG - Intronic
971470275 4:27017841-27017863 GCGGGTGGTGAGGGTGCCGAGGG - Exonic
972532790 4:39976730-39976752 GCGGGTGGCGAGGCCGCTGCCGG - Intronic
976367479 4:84246754-84246776 GTGGGTGCTGAGGACACTGAGGG - Intergenic
981037858 4:140190934-140190956 GAGGGGAGAGAGGATGCTGAGGG + Intergenic
982468532 4:155759566-155759588 GGGGGTGGGGCGGATGGTGACGG + Intronic
982495898 4:156091832-156091854 GTGGGTGTGGAGGATGAGGAGGG + Intergenic
985014801 4:185623049-185623071 GTGGGTGGAGAGGCTGGTGCAGG + Exonic
985662548 5:1164331-1164353 GTGGGTGGGAAGGATGGTGTGGG + Intergenic
986606190 5:9525519-9525541 GGGGATGGCGAGGATGATAATGG + Intronic
987241780 5:16007331-16007353 TTGGGTGAGGAGGAAGCTGAAGG + Intergenic
991114514 5:62938674-62938696 GTGGGTGGAGCAGATGCTGTAGG - Intergenic
992773567 5:80070706-80070728 GCTTGTGACGAGGATGCTGACGG + Exonic
992826489 5:80554587-80554609 GTTGGTGGCAAGGATGGTGGGGG + Intergenic
994493265 5:100475644-100475666 GTGGGTGGTGATGGTGGTGAAGG + Intergenic
997363598 5:133311333-133311355 GTGGGCGGGGAGGAGGATGACGG + Intronic
997417178 5:133738087-133738109 CAGGCTGGCTAGGATGCTGATGG - Intergenic
997617884 5:135264913-135264935 GTGGCAGGCGAGGCTGTTGAAGG + Intronic
997659631 5:135579312-135579334 GACGGTGGAGAGGCTGCTGAAGG + Intergenic
999234222 5:150080858-150080880 GTTGGTGCTGAGGATGCTGCTGG + Exonic
999420332 5:151436390-151436412 GTGGTTGGAGTGGATGTTGAGGG + Intergenic
1000210128 5:159100681-159100703 GGGCGCGGCGAGGATGCTAAAGG - Intergenic
1000386023 5:160675478-160675500 GAGGGAGGAGAGGATGCTGAAGG + Intronic
1001407197 5:171484540-171484562 CTGGGTGGGGAGGATAGTGAAGG - Intergenic
1001562343 5:172677831-172677853 GTGGCTGGTGAGGGGGCTGATGG - Intronic
1002092738 5:176814450-176814472 TTGGGTGGGGAGCATGCTGGCGG - Intronic
1002191353 5:177479406-177479428 GAGGGTGGGGAGGATGTGGAAGG - Intergenic
1002302591 5:178265897-178265919 GCAGGTGGCGTGGATGCTGGTGG - Intronic
1002400508 5:178989212-178989234 GAGGGTGGGGAGGGTGGTGAGGG - Intronic
1002473947 5:179453402-179453424 GTGTGTGGGGATGATGGTGATGG - Intergenic
1004347823 6:14864656-14864678 GAGGGTGGCCAGGTTGTTGACGG - Intergenic
1005294672 6:24413529-24413551 GTGGTTGGGGAGGCTGCTGAGGG - Intronic
1006267162 6:32935123-32935145 GTCTGTGGAGAGGAGGCTGAAGG - Intronic
1007004019 6:38342909-38342931 GTGGGTGGTGAGGAAGTTCAGGG - Intronic
1007227946 6:40328026-40328048 GTGGGAGGCAGGGCTGCTGAGGG + Intergenic
1007343409 6:41208604-41208626 GTGGGAGGGGAGGAGGGTGAGGG + Intergenic
1007367384 6:41404594-41404616 GTGGGAGGCGGTGATGGTGATGG - Intergenic
1007835625 6:44671658-44671680 GAAGGAGGTGAGGATGCTGAAGG - Intergenic
1007957416 6:45930131-45930153 GTAGGTGGGGAGGAGGGTGAGGG - Intronic
1008427424 6:51375752-51375774 GTGGGTGGAGATGATGCTGATGG + Intergenic
1017139693 6:151179444-151179466 GTGGGTGGGGAGGAGGTTGGTGG + Intergenic
1018028796 6:159826082-159826104 GGGGGTTACGAGGATGCTGCTGG + Intergenic
1018202675 6:161410187-161410209 GTGGGTGGCCAGGAATCTGAAGG + Intronic
1018871913 6:167790219-167790241 GGGGTTGGGGAGGATGGTGAGGG - Intronic
1018961011 6:168448498-168448520 GGGGATGGTGAGGATGGTGATGG + Intronic
1019446117 7:1072187-1072209 GTGGGCAGCCAGGATGCTTACGG - Intronic
1019522733 7:1468012-1468034 GAGGATGGGGAGGGTGCTGAGGG - Intergenic
1019824268 7:3270545-3270567 GTTGGTGGTGATGATGATGATGG + Intergenic
1022537337 7:31106375-31106397 GGGAGTGGGGAGGGTGCTGAGGG + Intronic
1023232533 7:38050015-38050037 GTGGGGGGCGGGGATCCTGCAGG - Intergenic
1023603245 7:41901736-41901758 TTGGGAGGGGAGGATACTGAGGG - Intergenic
1023863397 7:44228002-44228024 GTGCGTGGAGAGGAGGCTGCAGG + Intronic
1024334979 7:48197612-48197634 GGGAGTGGTGAGGATGCTGATGG - Intronic
1024532499 7:50405516-50405538 GTGGGAGCCTAGGATGCTGAGGG - Intergenic
1025854268 7:65264377-65264399 GGGGCTGCCGAGGATGCTGGGGG + Intergenic
1025997115 7:66534967-66534989 GTGGGTGGGAAGGAGGCTGCTGG - Intergenic
1026738559 7:72964361-72964383 GTGTGTGGCAAGGAGGGTGAGGG - Intronic
1026789574 7:73323004-73323026 GTGTGTGGCAAGGAGGGTGAGGG - Intronic
1027105175 7:75400708-75400730 GTGTGTGGCAAGGAGGGTGAGGG + Intronic
1028656465 7:93213748-93213770 GAGAGTGCCTAGGATGCTGAAGG + Intronic
1029092168 7:98056923-98056945 GGGGGTGGCGGGGGTGATGACGG + Intergenic
1032509355 7:132459700-132459722 GTTGGTGGTGGGGATGCTGGGGG + Intronic
1032876174 7:136040792-136040814 GTGAGTGGGGAGGTTGTTGATGG + Intergenic
1033657290 7:143382277-143382299 GGGGATGGCGACGATGCAGAGGG + Exonic
1034412030 7:150946898-150946920 GAGGGTGGGGAGGGGGCTGACGG + Exonic
1034455229 7:151166729-151166751 CTTGATGGCTAGGATGCTGAGGG + Intronic
1035202402 7:157276079-157276101 GAGGGGGGCGAGGGTGCTGCAGG - Intergenic
1035342460 7:158172685-158172707 GTGGATGGTGAAGATGATGATGG - Intronic
1035342708 7:158174380-158174402 GTGGATGGTGAAGATGATGATGG - Intronic
1035342725 7:158174505-158174527 GTGGATGGTGTGGATGATGATGG - Intronic
1036619541 8:10415567-10415589 GTGGATGGAGAGGCTGCTGGAGG - Intronic
1036784505 8:11677102-11677124 GTGGGAGGCTGGGATGCTGGGGG + Intronic
1037417278 8:18665709-18665731 GTGGGTGGCGTGCATGCCAATGG + Intronic
1037901187 8:22690510-22690532 GGGGGCGCCGAGGATGCAGAGGG + Exonic
1038436644 8:27541146-27541168 GAGGCTGGGGAGGTTGCTGATGG - Intronic
1038555667 8:28512038-28512060 GTGGTTGGTGGGGATGGTGATGG + Intronic
1039879080 8:41612458-41612480 GTGGCTGGAGAGGATGCCAAGGG + Intronic
1039921263 8:41896119-41896141 GCGGGTGGCCGGGAGGCTGAGGG - Intronic
1040017710 8:42713286-42713308 GTGGGCGCCGAGGACCCTGAGGG + Intronic
1040419148 8:47222740-47222762 GGTGGTGGTGAAGATGCTGAGGG - Intergenic
1040895772 8:52366685-52366707 GTGGCTGGTGAGGAGGCTGATGG - Intronic
1043513678 8:80976281-80976303 GTGGGTGGTGAGGGTGCAGCAGG + Exonic
1044386517 8:91595323-91595345 ATGGCTGGTGAGGAAGCTGAAGG - Intergenic
1049264176 8:141658203-141658225 GATGGTGGCGATGATGATGATGG - Intergenic
1049444962 8:142625736-142625758 ATGGGTGGTGATGGTGCTGATGG - Intergenic
1049514012 8:143044044-143044066 GAGGGTGCTGAGGGTGCTGAGGG + Intronic
1049514014 8:143044053-143044075 GAGGGTGCTGAGGGTGCTGAGGG + Intronic
1049587870 8:143440337-143440359 GTGGGGCGCTGGGATGCTGAAGG + Exonic
1049691026 8:143959094-143959116 GTGTGAGGCGAGGCTGCTGAGGG + Intronic
1049805544 8:144537177-144537199 GTGGGTGGGAAGGGTGCTGGTGG + Intronic
1050306010 9:4306754-4306776 GGGGGTGGGGAGGATGTTCAAGG - Intronic
1053512613 9:38701554-38701576 GTGGGTGGCCTCGAGGCTGAAGG + Intergenic
1057265517 9:93614778-93614800 GGTGGTGGCGAGGATGATGATGG + Intronic
1057304570 9:93904741-93904763 CTGGGTGGCGGGGATGCAGGAGG + Intergenic
1057415727 9:94860557-94860579 CTGGGTGGAGAGGGTGCTGGTGG + Intronic
1057518410 9:95740461-95740483 GTGGGAGGCAAGGAGGTTGAAGG + Intergenic
1057929910 9:99184433-99184455 GTGGGTGGGGTGGGTGTTGAGGG + Intergenic
1058058603 9:100473397-100473419 GGGTGGGGCGGGGATGCTGACGG + Exonic
1060990662 9:127846875-127846897 ATGGGTGGCGAGGGTGGAGAGGG - Intronic
1061406039 9:130393585-130393607 GGGGATGGAGAGGATGCTGTGGG + Intronic
1061996289 9:134187863-134187885 GTTGGTGGTGACGATGCTGTAGG + Intergenic
1062647322 9:137555287-137555309 GCAGGTGGCCAGGAGGCTGAAGG + Exonic
1203774381 EBV:64672-64694 GGGGGTGGTGAGGATGCAGCTGG - Intergenic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1185731761 X:2467397-2467419 GAGGCTGGTGAGGATGCTGTGGG - Intronic
1185732539 X:2473097-2473119 GAGGCTGGTGAGGATGCTGTGGG - Intronic
1185733141 X:2477319-2477341 GAGGCTGGTGAGGATGCTGTGGG - Intronic
1185739622 X:2520769-2520791 GATGATGGCGAGGATGATGATGG - Intergenic
1188395706 X:29680555-29680577 GTGGGTGGGGAGGCTGGTAATGG + Intronic
1199086245 X:143633800-143633822 GCGGGCGGCGAGGAGGCTGGAGG + Intronic
1199458314 X:148054252-148054274 GAGGGTGCTGAGGATGCTGAGGG + Intergenic
1199545666 X:149005313-149005335 GGGGGTGGCCAGGATGCTTTGGG - Intergenic
1199863311 X:151821334-151821356 GGGGCTGGCGAGGATGATGCAGG - Intergenic
1201501322 Y:14645994-14646016 GTTGGTGATGAGGATGCTGAAGG + Intronic
1201691711 Y:16774666-16774688 CTGGGTGGCCACCATGCTGATGG + Intergenic
1202379249 Y:24261451-24261473 GTGGGCAGTGAGGAGGCTGAGGG - Intergenic
1202491533 Y:25408670-25408692 GTGGGCAGTGAGGAGGCTGAGGG + Intergenic