ID: 1162478567

View in Genome Browser
Species Human (GRCh38)
Location 19:10915250-10915272
Sequence CTCCCCTTCTGCCCTGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 367}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162478561_1162478567 1 Left 1162478561 19:10915226-10915248 CCAGGGGCTGTGGGCCCCACTCT 0: 1
1: 0
2: 1
3: 37
4: 345
Right 1162478567 19:10915250-10915272 CTCCCCTTCTGCCCTGATGGTGG 0: 1
1: 0
2: 3
3: 38
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162478567 Original CRISPR CTCCCCTTCTGCCCTGATGG TGG Intronic
901314214 1:8294833-8294855 CATCCCGTCTGCCCTAATGGCGG - Intergenic
901716041 1:11155441-11155463 CTGCCCTTATGCCCTGAAGCAGG + Intronic
901922771 1:12548427-12548449 CTTCCCTTCTTCCCTGAAGGTGG + Intergenic
902227836 1:15007902-15007924 CTCCCTTCCTGTGCTGATGGGGG - Intronic
902921030 1:19665957-19665979 CTTCACGTCTGACCTGATGGTGG + Exonic
903883913 1:26530294-26530316 CTCCCCGTCTGCATTAATGGAGG - Intronic
904311794 1:29633955-29633977 CTCCCCTCCTTCCCTGAGGCTGG + Intergenic
904377844 1:30092988-30093010 CTCCCATTCTGACCTCCTGGAGG + Intergenic
904415557 1:30359172-30359194 CTCCCCCTCTGCCCTACAGGTGG - Intergenic
904917001 1:33977375-33977397 GTCCTGTTCTGCCCTGATGGAGG - Intronic
905444185 1:38014383-38014405 CTCCCCTGCTGCCCTACTGAAGG - Intronic
911228859 1:95338188-95338210 TTCACTTTCTGCCATGATGGAGG + Intergenic
912839879 1:113029916-113029938 GTCCCCTTGTGCCCTGATAATGG + Intergenic
914258421 1:145978971-145978993 CTTCCCTTCTACCCCCATGGTGG + Intergenic
914677495 1:149916166-149916188 CTCCCCTCCAGCCCTGAAGGAGG + Intronic
915024128 1:152811429-152811451 CTCCCCTCCTGCCCTGATCTAGG - Intronic
915695622 1:157738919-157738941 TTCACCTTCTGCCATGATAGTGG - Intergenic
915977278 1:160399858-160399880 CTCCCCTTCTTCCCTAAGGCAGG + Intergenic
919340458 1:196300435-196300457 CACCCCTTCTTCCCTGAAGCAGG + Intronic
919663934 1:200274312-200274334 CTCGACCTCTGCCCTGAAGGAGG - Intergenic
919761203 1:201099301-201099323 CTCCCCATGTGCCCCGCTGGAGG + Intronic
919812024 1:201414695-201414717 CTCCCCTCATTCCCTGATGCCGG - Intronic
919838696 1:201593964-201593986 CTTCCCACCTGCACTGATGGTGG - Intergenic
920254344 1:204644331-204644353 CTCCCTTTCTGTCCTGGTGATGG + Intronic
920342501 1:205284396-205284418 CTCCCCTGGGGCCCTGAGGGAGG + Intergenic
920390669 1:205598553-205598575 CTCCTCTTTTGCCCTGCTGGAGG + Intronic
920703743 1:208236713-208236735 TTCCGCTTCTGCTCTGGTGGTGG - Intronic
921075853 1:211699530-211699552 CTGCCCTTCTTCCCTGCTGGAGG + Intergenic
922592347 1:226786861-226786883 CTCCCCTTCCTCCCTGGAGGAGG + Intergenic
922667957 1:227488833-227488855 TTCACCTTCTGCCATGATTGTGG - Intergenic
923327793 1:232896428-232896450 CTGCCCTTCTCCCCTGGAGGAGG - Intergenic
923858303 1:237867941-237867963 CTCCCCTTTTGTCCTCAAGGAGG - Intergenic
924326622 1:242901273-242901295 CTCACCTTCTCCCCTGAAGCTGG + Intergenic
924667202 1:246085416-246085438 CTCCCCTTCTCCCCTGAAAAAGG + Intronic
1063288324 10:4713772-4713794 CTCCTCTTCTTTCCTGAAGGTGG + Intergenic
1065174290 10:23061940-23061962 CTCCCCTTCTTGCCTGAAGCAGG - Intergenic
1065681463 10:28237926-28237948 CTCCCCTTCTGATCTGATTCAGG - Intronic
1067269055 10:44773832-44773854 CTCCCCTCCTGCCCTGCTGCAGG + Intergenic
1068037785 10:51782794-51782816 CTTGCCTTCTGCCATGATTGTGG + Intronic
1068184078 10:53563268-53563290 TTCACCTTCTGCCATGATTGTGG + Intergenic
1068591046 10:58853311-58853333 CTCCGCTCCTGCCCTTGTGGTGG - Intergenic
1068621949 10:59195607-59195629 CTACCCTTCTCCCCTGAGGCAGG - Intronic
1068681524 10:59825382-59825404 CTTGCCTTCTGCCATGATTGTGG + Intronic
1069042761 10:63712058-63712080 CTCCCCACATGCCCTGATGGTGG - Intergenic
1069420825 10:68244966-68244988 CTGCCCTTCTCCCCTGAAGCAGG - Intergenic
1069794571 10:71043886-71043908 CTCCCCTTCTCCCCTGGGGCAGG + Intergenic
1070452925 10:76579946-76579968 TTCGCCTTCTGCCATGATTGTGG - Intergenic
1072246240 10:93546784-93546806 TTCCCCTGCTGCAGTGATGGTGG - Intergenic
1073387188 10:103135424-103135446 TTCACCTTCTGCCATGATGCTGG + Intronic
1073562111 10:104505834-104505856 CTCCTCTTCTCCCCTAGTGGTGG + Intergenic
1073582296 10:104679741-104679763 CTTTCCTTCTGCCTTGGTGGAGG + Intronic
1075089520 10:119435903-119435925 TTCACCTTCTGCCATGATTGTGG - Intronic
1075470412 10:122684710-122684732 CTTGCCTTCTGCCATGATTGTGG - Intergenic
1076732527 10:132445859-132445881 CGCCACTTCTCCCCTGATGATGG - Intronic
1079121409 11:17687977-17687999 TTCCCTTCCGGCCCTGATGGAGG + Intergenic
1079739325 11:24037307-24037329 CTTGCCTTCTGCCATGATTGTGG + Intergenic
1079796051 11:24804718-24804740 CACCCCTTCTCCCCTGAAGCAGG - Intronic
1080469962 11:32535886-32535908 CTCCACCTGTGCACTGATGGTGG - Intergenic
1081577647 11:44329177-44329199 CTCCCTTTCTTCCCAGATTGTGG - Intergenic
1081657805 11:44868773-44868795 CTCACTTTCTGCCCTGGTGTGGG - Intronic
1081670122 11:44938133-44938155 CTAACCTTCTCCCCTAATGGTGG + Intronic
1083535246 11:63461060-63461082 CTGCCCTGCTGCCCCTATGGTGG + Intergenic
1083659090 11:64243949-64243971 CTCCCCTTCTCCCCTACAGGTGG + Exonic
1084488345 11:69464006-69464028 TTCCCCACCTGCCCTGCTGGGGG - Intergenic
1084772701 11:71354285-71354307 CTCCCTCTGTGCCCTGAAGGAGG + Intergenic
1086078724 11:82880814-82880836 TTTCCCATCTGCCCTTATGGAGG + Intronic
1086224501 11:84491380-84491402 CTTGCCTTCTGCCATGATTGTGG + Intronic
1088116990 11:106323653-106323675 TTCGCCTTCTGCCATGATTGAGG - Intergenic
1088302255 11:108371843-108371865 CAACCCTTGTGCACTGATGGTGG - Intronic
1089306222 11:117527986-117528008 TTCCCCACCTGCCCTGGTGGAGG + Intronic
1090194060 11:124800121-124800143 GTCTCCTTCTCCCCTGGTGGCGG - Exonic
1091812232 12:3409270-3409292 CACCCCTTCTTCCCTGAAGCTGG - Intronic
1091964290 12:4724844-4724866 CTCCCCTGCTTCCCTCTTGGGGG + Intronic
1093362812 12:18252805-18252827 CTGCCCTTCTCCCCTGAAGCAGG - Intronic
1095710627 12:45284432-45284454 ATCCCCTTCTCCCCTGAGGCTGG - Intronic
1096124626 12:49110339-49110361 CCGCCCTTCTGCCCGGACGGAGG + Intronic
1096612728 12:52813736-52813758 TTCCCCGTCTGCCCCGCTGGGGG - Exonic
1098461256 12:70735340-70735362 TTCACCTTCTGCCATGATTGTGG - Intronic
1099686264 12:85893128-85893150 CCCTCCTTCTTCCCTGAGGGAGG - Intergenic
1099746093 12:86707022-86707044 CTTGCCTTCTGCCATGATGGTGG + Intronic
1102659707 12:114515167-114515189 CTGCCCTTCTCCCCTGAAGCAGG - Intergenic
1102709844 12:114916248-114916270 CTCGCCTTCAGCCATGATGTTGG - Intergenic
1103024224 12:117560401-117560423 CTCCCCTTCTGCACTCTCGGTGG - Intronic
1104196694 12:126546695-126546717 CTTGCCTTCTGCCATGATTGTGG + Intergenic
1106653515 13:31717643-31717665 CTGCCCTTCTACCCTGAAGGAGG + Intergenic
1107045824 13:35991102-35991124 CTCCCCTTCTCCCATGAAGCAGG + Intronic
1107184839 13:37505912-37505934 CTTTCCTCCTGCCCTGATAGCGG + Intergenic
1108331186 13:49386315-49386337 CTCCCCTTTTCATCTGATGGTGG + Intronic
1109967168 13:69715421-69715443 TTCCCCTTCTCCCATGATTGAGG + Intronic
1111396806 13:87676147-87676169 CTCCTATTCAGCCCTGGTGGGGG + Exonic
1114847934 14:26346597-26346619 TTCGCCTTCTGCCATGATTGTGG - Intergenic
1117639121 14:57778191-57778213 CTTGCCTTCTGCCATGATTGTGG + Intronic
1117993716 14:61459224-61459246 ATCCCCTACTTCCTTGATGGTGG - Intronic
1118391004 14:65295308-65295330 CTTCCTTTCTGCCCTGAAAGAGG + Intergenic
1118875923 14:69784865-69784887 CTCCCCTTCCCGCCTGCTGGAGG - Intronic
1119330818 14:73792280-73792302 CTCCCTTTCTGGCCTGCTGGGGG + Intergenic
1120397481 14:83986137-83986159 CTGCCCTTCTTCCCTGAAGTAGG + Intergenic
1121777628 14:96600862-96600884 CTCCCCCACTTCCCTGCTGGCGG + Intergenic
1122008019 14:98721842-98721864 CTTGCCTTCTGCCATGATTGAGG + Intergenic
1122230384 14:100303974-100303996 CTCCCCCTCTCCCCTACTGGGGG - Intronic
1122738440 14:103856954-103856976 CTTCCTTCCAGCCCTGATGGTGG - Intergenic
1122880268 14:104687719-104687741 CACCTTTCCTGCCCTGATGGGGG - Intergenic
1123933280 15:25182130-25182152 CCCACCTTCTGCCCCCATGGAGG + Intergenic
1124370931 15:29104239-29104261 CTCCCCAACTGCCCTCAAGGGGG - Intronic
1125829665 15:42705164-42705186 CTCTCCTTCTGCCATGTGGGCGG + Intronic
1126385343 15:48088271-48088293 CTCCCTTTCTGTCCTTAGGGTGG + Intergenic
1127078792 15:55354348-55354370 TTCCCTTTCTGCTCTGATAGGGG - Intronic
1128709998 15:69864582-69864604 CTTGCCTTCTGCCATGATTGTGG - Intergenic
1130524260 15:84690314-84690336 TTCACCTTCTGCCATGATTGTGG + Intronic
1131111451 15:89767424-89767446 AACACCTTCTGCCCTGAGGGAGG + Intronic
1131302020 15:91207963-91207985 TGCCCCTTCTTCCCTGATGCAGG - Intronic
1132548679 16:545286-545308 CTGCCCTTCTGCCCTGGTTCTGG - Intronic
1132745621 16:1435005-1435027 CTCCCCGCCTGCCCTGCTGCAGG - Intronic
1132832012 16:1933047-1933069 CTCCATCTCTGCCCTGCTGGGGG - Intergenic
1133410102 16:5561120-5561142 CACCCCTCCTGCCCTGAGGATGG - Intergenic
1133500021 16:6357103-6357125 CTCCCCTCCTGCCCTGCTTGCGG + Intronic
1134342801 16:13360561-13360583 TTCCCCTTCCGCCATGATTGAGG + Intergenic
1139472436 16:67185332-67185354 CTCCCATCCTGACCTGAAGGAGG + Intronic
1141566619 16:84906647-84906669 CGCCCCTTCTCCCCTGGTGCTGG - Exonic
1141663572 16:85454304-85454326 CTCGCCCTCAGCCCTGGTGGTGG + Intergenic
1142186524 16:88697434-88697456 CTCCCCTTCTGCGCGGGTGCAGG + Exonic
1142218066 16:88839597-88839619 CACCCCTACTGCCCTGAGAGGGG + Intronic
1143179778 17:4977285-4977307 TTCCCCTACTGCCCTGCTGTGGG + Intronic
1143352933 17:6302248-6302270 CTCCCATTCTGCACAGATGTGGG - Intergenic
1143665866 17:8359730-8359752 CTGCCTTTCTGCCCTGAATGGGG - Intergenic
1144213287 17:13033091-13033113 CACGCATTCTGCCCTGATGCTGG + Intergenic
1144275908 17:13667904-13667926 CGCCACTTCAGCCCTGCTGGCGG - Intergenic
1144787930 17:17842160-17842182 CTCCCCTTCTCCCCTGGGTGTGG + Intergenic
1145053426 17:19681807-19681829 CTCCCTTTCTTCCCTGAGGGTGG + Intronic
1145990864 17:29078740-29078762 CTGCCCTTCTTCCATGGTGGGGG + Exonic
1146057014 17:29586541-29586563 CTCCTCTTCCTCCCTTATGGAGG - Intronic
1146261973 17:31427822-31427844 CTCCCCTGCAGCCCTGCAGGTGG + Intronic
1146655960 17:34635319-34635341 CTCCCCCTCTGCTCTCAGGGAGG - Intronic
1146722377 17:35132443-35132465 CTTCCCTTCTCCACAGATGGAGG - Exonic
1147577225 17:41609813-41609835 CTCCCCTGCTCCTCTGCTGGTGG - Exonic
1148147315 17:45373934-45373956 GGCCCCTTCTCCCCTGCTGGGGG - Intergenic
1148232276 17:45943953-45943975 CCCAACTTCTGCCCTGATGGTGG - Intronic
1148687411 17:49508592-49508614 TAGCCCTTCTGCCCTGAGGGTGG - Intronic
1148758649 17:49987881-49987903 CTCTTCATCAGCCCTGATGGGGG - Intergenic
1148792665 17:50182289-50182311 ATCCCCATCTGCCCTCGTGGGGG - Intergenic
1148807706 17:50272547-50272569 CTCCCCTCCTCCCCTGCAGGTGG - Intronic
1149386318 17:56146412-56146434 CTTCCATACTGCCCTGGTGGAGG + Intronic
1151135705 17:71944133-71944155 TTTCCCTTCTGCCATGATTGTGG + Intergenic
1151135980 17:71946071-71946093 CTTGCCTTCTGCCATGATTGTGG + Intergenic
1151540725 17:74763413-74763435 GTCCCCGCCAGCCCTGATGGCGG - Exonic
1152395876 17:80032886-80032908 CTCCCCTTCTTCCCTGGCTGAGG - Intronic
1152624805 17:81383343-81383365 CTCCCCTTCTTCCCGTTTGGTGG + Intergenic
1152788879 17:82267414-82267436 CCCCTCGTCTGCCCAGATGGCGG + Intronic
1153077428 18:1180923-1180945 TTCACCTTCTGCCATGATTGAGG - Intergenic
1153716496 18:7855122-7855144 TTCTCCTTCTCCCCTGGTGGAGG + Intronic
1156486708 18:37471093-37471115 CTCCCTCTCTGCCCTGAAGCTGG - Intronic
1157104137 18:44757210-44757232 CTCCCCCTCTGCCCTGAATTTGG + Intronic
1157581576 18:48776937-48776959 CAGGCCTTCTACCCTGATGGTGG + Intronic
1157709210 18:49837708-49837730 ATCCCCATCTGCCATGCTGGAGG + Exonic
1158197129 18:54900586-54900608 CCCTCCTTCTGCCCTGAAGCAGG - Intergenic
1159920310 18:74221658-74221680 CTCCCCTTCTTCCCCCATGCTGG + Intergenic
1160146491 18:76369829-76369851 CTCCCATTTTGCCCTCCTGGAGG - Intronic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1161266902 19:3368300-3368322 CTCCCAACCAGCCCTGATGGGGG - Intronic
1162311823 19:9912639-9912661 CTCTCCTTCTTCCCTGATCCAGG + Intronic
1162453850 19:10770645-10770667 CTTGCCTTCTGCCATGATTGTGG - Intronic
1162478567 19:10915250-10915272 CTCCCCTTCTGCCCTGATGGTGG + Intronic
1163500779 19:17674884-17674906 CCTCCCTTGTGCCCTGAGGGTGG - Intronic
1164591700 19:29511097-29511119 CTCCCCTGCTGCCTGGAAGGTGG - Intergenic
1164934373 19:32199749-32199771 CTCCCCTTCTGCCAGGAAAGTGG + Intergenic
1165004899 19:32796722-32796744 ATCCCCTTCTGCCCTGAGCCTGG - Intronic
1165079838 19:33300920-33300942 CTCCCCTCCTTCTCTCATGGGGG + Exonic
1165319137 19:35075092-35075114 CACCCCTTGCGCCCTGCTGGTGG + Intergenic
1165336958 19:35177548-35177570 TTCACCTTCTGCCATGATTGAGG - Intergenic
1165648247 19:37463433-37463455 CACCCCTACTGCACTGATAGTGG + Intronic
1166713051 19:44949259-44949281 CTCCCCTTGTCCACTGATGGGGG - Exonic
1166735193 19:45079746-45079768 CTCCCCTTCTCCCCTGGGGCCGG - Intronic
1166740183 19:45109878-45109900 CTCCCCCTCTGCCCTGTTGGAGG + Intronic
1166772893 19:45294938-45294960 CTGCCCTACAGCCCTGGTGGGGG - Intronic
1166811239 19:45515874-45515896 CTCCCCCACTGCCCTGGAGGTGG + Intronic
1166999797 19:46739099-46739121 CTCCCCTTCGGCCCTCGTTGTGG - Intronic
1167432958 19:49463928-49463950 CTCCCCATGTGCCCAGGTGGAGG + Exonic
1167504302 19:49863044-49863066 CCCCGCTTTTGCCCTGAGGGAGG - Intronic
1167689784 19:50978246-50978268 TTCCCCTTCTCCCCTGGTGAGGG - Intronic
1168584681 19:57583264-57583286 CCTCCCTACTGCCCTGAGGGCGG + Intronic
925083228 2:1086469-1086491 CCCCACATCTGCCCTCATGGGGG + Intronic
925171664 2:1754029-1754051 CTCCCCTGCTGCCGTCGTGGGGG - Intergenic
925746765 2:7050361-7050383 TTCACCTTCTGCCATGATTGTGG + Intronic
926816269 2:16800874-16800896 CTGCCCTTCTCCCCTGAAGCAGG + Intergenic
927573018 2:24175966-24175988 TTCCCCTTTTGCCCTAGTGGCGG + Intronic
927683340 2:25154518-25154540 CTCCTCGTCTTCCCTGAGGGAGG + Exonic
928027871 2:27754697-27754719 CTCACCTTCTGCCCCTAAGGAGG - Intergenic
929149657 2:38736142-38736164 CTCCCCTGCTGCCACTATGGGGG + Intronic
929428769 2:41869812-41869834 CTCCCCTTCTTCCCAGGTTGAGG - Intergenic
929824704 2:45301050-45301072 CTGCCCTGCTCCCCTCATGGAGG - Intergenic
931171917 2:59812742-59812764 CCTCCGTTCTGCCCTGATGTTGG + Intergenic
932039577 2:68285061-68285083 CTTCCCTTGTTCCCTGAGGGAGG + Intronic
932288186 2:70554017-70554039 CCCCCCTCCCGCCCCGATGGGGG + Intronic
932602044 2:73134254-73134276 CCCCCCTTCTGCACTGGTGAGGG + Intronic
932907868 2:75773447-75773469 CTGCCCTTCTTCCCTGAAGCAGG - Intergenic
933973911 2:87492535-87492557 CTCCACTCCTGTCCTGAGGGTGG + Intergenic
935081134 2:99795759-99795781 CTCCTCTTCTGCCCTCCAGGTGG + Intronic
935088137 2:99868396-99868418 CTCCCCTCCCGGCCTGATGTTGG - Intronic
935423235 2:102892765-102892787 CTCCCCGGCTGTCCTGAGGGAGG + Intergenic
936319810 2:111457669-111457691 CTCCACTCCTGTCCTGAGGGTGG - Intergenic
936970394 2:118171261-118171283 ATCCTCTTCTGCCCTGTTAGAGG + Intergenic
937358660 2:121213902-121213924 CTGACCTTCTGGCCTGCTGGTGG - Intergenic
937653509 2:124347447-124347469 GTGTCCTTCTGCCCTGGTGGAGG - Intronic
937910223 2:127072061-127072083 GTCGCCTCCTGCCCTGAAGGAGG + Intronic
938072935 2:128317920-128317942 ACCCCCTTCTGCCCTCTTGGGGG - Intronic
939757864 2:146136670-146136692 TTCACCTTCTGCCATGATAGTGG - Intergenic
941493518 2:166172051-166172073 CTCCAATGCTGCCTTGATGGAGG + Intergenic
941882651 2:170497094-170497116 CTGCCCTTCTGCCCTGAAGCAGG + Intronic
944602996 2:201321929-201321951 CTCCCCTACTGGCCTGAAGCTGG + Intronic
944678216 2:202052153-202052175 CTCCCCTCCTGCCTTCATCGCGG - Intergenic
944911620 2:204315892-204315914 CACACCTGCTGCCTTGATGGTGG + Intergenic
945298901 2:208197773-208197795 CTACCCTTCTCCCCTGAAGCAGG - Intergenic
945655000 2:212612315-212612337 CACCCCTTCAGCCCTAGTGGTGG + Intergenic
945913823 2:215681655-215681677 CTGACCTTGTGCCCAGATGGGGG - Intergenic
946339062 2:219056928-219056950 CTCCCCCTGTGCCCTGAAGCTGG - Intronic
947237079 2:227952076-227952098 CTTGCCTTCTGCCATGATTGAGG + Intergenic
947274347 2:228373381-228373403 TTCACCTTCTGCCATGATTGAGG - Intergenic
947682492 2:232047726-232047748 TTCCCCTTCTTCCCAGATGCTGG + Intronic
948133807 2:235620903-235620925 CTCCCCATCACCTCTGATGGAGG + Intronic
1168779339 20:475675-475697 CTTCCCTACTGCACTGATGTTGG + Intronic
1168855187 20:1002865-1002887 CTCCCCTTCTCCCCTCCTGCAGG + Intergenic
1168973922 20:1949941-1949963 CTGCCCTTCAGCCCTCCTGGAGG + Intergenic
1170548911 20:17458713-17458735 CTCCCCTACAGTCATGATGGGGG - Intronic
1170575594 20:17659541-17659563 CTCCCTTTTTGCCCTGATTCTGG + Intronic
1171367485 20:24635732-24635754 CTCCCCTTCTGTGTTGAGGGTGG + Intronic
1172107213 20:32523959-32523981 TCCTCCTTCTGCCCTGAGGGTGG + Intronic
1175372041 20:58498808-58498830 ATCCCCATGTGCCCTCATGGCGG + Intronic
1175419192 20:58820676-58820698 CTTGCCTTCTGCCATGATTGTGG - Intergenic
1176064484 20:63187577-63187599 CTCACCTCCTGCCCTGATGTAGG + Intergenic
1176915400 21:14620011-14620033 CTCTCCTTCTACCCTGAAGCAGG - Intronic
1178003640 21:28192527-28192549 TTCACCTTCTGCCATGATTGTGG - Intergenic
1179105719 21:38398560-38398582 CTCCCATGCCGCTCTGATGGTGG - Intronic
1179808308 21:43854123-43854145 GTCCCCTTCTGCAGTGCTGGGGG - Intergenic
1179916740 21:44482537-44482559 ATCCCCTTCAGCCCTGTTGTAGG - Intergenic
1180799640 22:18625810-18625832 CTGGCCTTCTGCCCTGAGGGCGG - Intergenic
1180957807 22:19748846-19748868 CGACCCTTCTCCCCTGAGGGTGG - Intergenic
1181014558 22:20061722-20061744 CTTTCCCTCTGCCCTGGTGGCGG - Intronic
1181115954 22:20632663-20632685 CTACCCTGATGCCGTGATGGTGG + Intergenic
1181222076 22:21369456-21369478 CTGGCCTTCTGCCCTGAGGGCGG + Intergenic
1183286224 22:36965904-36965926 CTCCCCCACTGCCCGGCTGGAGG + Intergenic
1183323726 22:37180397-37180419 CTGCCCTTCTCCCCAGAGGGAGG - Exonic
1183360110 22:37378966-37378988 CTCCCCTACTCCCATGAGGGTGG + Intronic
1183512616 22:38244937-38244959 CACCCCTGCTGCCCTGCGGGAGG - Intronic
1183521936 22:38300632-38300654 CTCACCCCCTACCCTGATGGAGG - Intronic
1183780884 22:39998153-39998175 CTCCCCTTTCGCCCTGAGGGAGG + Intronic
1184374519 22:44103296-44103318 CTCCCCGACTTCCCTGATGTGGG + Intronic
1184486444 22:44782937-44782959 CTCCACTTGTGCAGTGATGGGGG + Intronic
1185231533 22:49686822-49686844 GTCCCCACCTGCCCTGTTGGTGG - Intergenic
950767448 3:15283809-15283831 CACCTCTACTGCCCTGATGGAGG + Intronic
951354545 3:21648315-21648337 TTCGCCTTCTGCCATGATTGTGG + Intronic
952267941 3:31804522-31804544 CTCCCCTTCTGTCCTAATACGGG - Intronic
953358484 3:42274681-42274703 CTTGCCTTCTGCCATGATTGTGG - Intergenic
953483578 3:43273650-43273672 CTGTCCTCCTGCCCTGATGGTGG - Intergenic
954710669 3:52503745-52503767 TTCCCCTCCTGCCCTGTCGGGGG + Intronic
955039150 3:55298072-55298094 CTCCCATGCTCCCATGATGGAGG - Intergenic
955927334 3:64021000-64021022 CCCCTCTGGTGCCCTGATGGTGG + Intronic
957396066 3:79640360-79640382 TTTGCCTTCTGCCATGATGGTGG + Intronic
958603922 3:96333525-96333547 CGCCCTTTCTCCCATGATGGGGG + Intergenic
959811414 3:110624662-110624684 CTCCCCTGCTTCTCTTATGGGGG + Intergenic
960873325 3:122273015-122273037 CCCCACTTCTACCCTGATGCTGG + Intronic
962175714 3:133152399-133152421 CTTCTCTTCTGCCCTTATGAAGG - Intronic
963985409 3:151587887-151587909 CTTGCCTTCTGCCATGATTGTGG + Intergenic
964574634 3:158151479-158151501 TTCCCCTTCTCCCCTGAAGTAGG - Intronic
964767140 3:160190195-160190217 CCCCCCTTCTGCCTAGAAGGGGG - Intergenic
965682154 3:171262724-171262746 CTTCCCTTCTTCCTTGATGAGGG + Intronic
967875892 3:194268258-194268280 CTCCTCTCCTGCCTTGATGGAGG - Intergenic
967875902 3:194268297-194268319 CTCCTCTCCTGCCTTGATGGAGG - Intergenic
967875912 3:194268336-194268358 CTCCTCTCCTGCCTTGATGGAGG - Intergenic
967875922 3:194268375-194268397 CTCCTCTCCTGCCTTGATGGAGG - Intergenic
968521509 4:1036609-1036631 CCCACCCTCTGCCCCGATGGGGG + Intergenic
968601388 4:1511611-1511633 CGCCCCAGCTGCCTTGATGGCGG - Intergenic
969114305 4:4861383-4861405 CCCCGCTTCTTCCCTGCTGGAGG - Intronic
969693970 4:8724609-8724631 CTCCCCATTAGCCCTGCTGGTGG - Intergenic
969695590 4:8732431-8732453 CTGTCCTTCTGGCTTGATGGTGG - Intergenic
970465816 4:16321842-16321864 TTCACCTTCTGCCATGATTGAGG - Intergenic
971142335 4:23937773-23937795 CTGCCCCTCTGCCCTGGAGGAGG + Intergenic
972447902 4:39164316-39164338 CTTGCCTTCTGCCATGATTGTGG + Intergenic
973604862 4:52576534-52576556 GTTGCCTTCTGCCATGATGGTGG - Intergenic
976441607 4:85082220-85082242 TTCACCTTCTGCCATGATTGTGG + Intergenic
976726723 4:88222544-88222566 CTGGCCTTCTGCCATGATTGAGG + Intronic
977060464 4:92252932-92252954 CTTGCCTTCTGCCATGATTGTGG - Intergenic
977124463 4:93147645-93147667 CTCCCCTTCTGTTCTGCTGTTGG - Intronic
977197696 4:94082933-94082955 TTCACCTTCTGCCATGATGAAGG - Intergenic
979845368 4:125502998-125503020 CTCGTCTTCTGCCATGATTGTGG - Intergenic
983186534 4:164706866-164706888 GTCCCCTGCTGCCCTGATTCTGG - Intergenic
983236567 4:165187171-165187193 TTCACCTTCTGCCATGATTGTGG - Intronic
984483609 4:180337324-180337346 TTCACCTTCTGCCATGATTGTGG - Intergenic
985009731 4:185570123-185570145 CTCCCCCACTGCCCAGGTGGGGG - Intergenic
985814369 5:2115637-2115659 TTCTCCTTCTGCCATGATTGAGG - Intergenic
987455737 5:18144030-18144052 TTCACCTTCTGCCATGATGGTGG - Intergenic
988177000 5:27741885-27741907 TTCACCTTCTGCCATGATTGTGG - Intergenic
988435322 5:31167691-31167713 CTTCCCTTCTTCCCTGAAGCAGG + Intergenic
990660295 5:58006667-58006689 CTTGCCTTCTGCCATGATTGTGG + Intergenic
992641834 5:78774439-78774461 CTCCTCTTCTGCCATCCTGGCGG + Intergenic
993045219 5:82858670-82858692 CTATCATTCTGCCCTGAGGGAGG + Intergenic
993885620 5:93412062-93412084 CTTCCATGCTGCCCTCATGGGGG - Intergenic
993940694 5:94054673-94054695 CTCCTCTTTTTCCCTGAGGGTGG - Intronic
994161603 5:96562939-96562961 CTGCCCTTCTCTCCTGAAGGAGG + Intronic
997262490 5:132475454-132475476 CTCCCCATCTGCCCTCCTGCTGG - Intronic
997573937 5:134958391-134958413 CTTGCCTTCTGCCCTGAGGTGGG + Intronic
998692026 5:144597865-144597887 CTCTCCTTCTACCCTGTTGCGGG + Intergenic
998821269 5:146059993-146060015 CTCCCCCTCAGCCGTGGTGGTGG + Exonic
999246858 5:150159727-150159749 CTTCCCTCCAGCCCTGATGGTGG - Intergenic
1000846998 5:166294044-166294066 TTTCCCTTCTGCCCAGATGTTGG - Intergenic
1001035450 5:168293003-168293025 CTCTCTTTCTTCCCTGATCGGGG + Intronic
1001287928 5:170437278-170437300 CTGCCCTTCTCCCCTGAAGCAGG - Intronic
1002328982 5:178428792-178428814 CTGCTCATCTGCCCAGATGGGGG + Intronic
1003068003 6:2919636-2919658 CTTCCCTGCTGCCCTTGTGGCGG - Intergenic
1004139626 6:13005102-13005124 TTCCCCTTCTTCCCTGCTAGTGG + Intronic
1004279060 6:14265083-14265105 CTGCCCTTCTTCCCTGAGGCAGG - Intergenic
1004348791 6:14872695-14872717 CTGCCCTTCTCCCCTGAAGCAGG - Intergenic
1004357472 6:14942539-14942561 CTGCCCTTCTCCCCTGAAGCAGG + Intergenic
1004442744 6:15669619-15669641 ATCCCCTTCTCCCCTGAAGCAGG + Intergenic
1005901080 6:30216732-30216754 CGCCCCTTCTTCCCTGAAGCAGG + Intergenic
1006368839 6:33632307-33632329 CTCCCATGGTGCTCTGATGGTGG + Intronic
1006424926 6:33957974-33957996 CTCCCTTCCTCCCCTGCTGGTGG - Intergenic
1007226826 6:40321040-40321062 CTTCCCTTCTCCCCTGCTGGTGG - Intergenic
1007386518 6:41523738-41523760 GTCCCCACCTGCCCTGAAGGAGG + Intergenic
1007777429 6:44231544-44231566 CTCCCTTTCTGACCTGAGAGTGG + Intronic
1007872316 6:45054231-45054253 CTACCCTTCTCCCCTGAAGCAGG + Intronic
1010791922 6:80075032-80075054 CACCCCTTCTTCCCTGGAGGTGG - Intergenic
1013020105 6:106206237-106206259 TGCCCCTTCTGCCATGTTGGGGG + Intronic
1013129126 6:107214722-107214744 CTCCTCTTCTGCCATGTTGAGGG + Intronic
1013232399 6:108169763-108169785 CTCCCCTCCCGCCCTGTGGGAGG + Intronic
1013717337 6:112977044-112977066 CTTGCCTTCTGCCATGATTGTGG + Intergenic
1014887528 6:126799757-126799779 CACCCCTTGTGCACTGTTGGTGG + Intergenic
1014986987 6:128023434-128023456 CTCTCCTTCTGCCCTGGAGCTGG + Intronic
1015085626 6:129287752-129287774 CTCCCCTTCTCCCAGGATGATGG - Intronic
1015326897 6:131933699-131933721 GTCCCTTCTTGCCCTGATGGTGG - Intergenic
1015795226 6:137004556-137004578 CTCCTCTTCTGTCCTCCTGGAGG + Intronic
1016987366 6:149905434-149905456 CTCCTAGGCTGCCCTGATGGAGG + Intergenic
1018328688 6:162704179-162704201 GTCCCCTGCTGCCCAGGTGGAGG - Intronic
1018476522 6:164147803-164147825 TTCCCCTTCTGCCATGATTGAGG + Intergenic
1019307875 7:344386-344408 CTCCCCATCTCCCCTGTTAGTGG - Intergenic
1019326336 7:440141-440163 CTTCCCTTCTGCAGTGATCGTGG - Intergenic
1019415787 7:926002-926024 CTCCCCATCTGCCCGGACGGTGG - Intronic
1019578857 7:1750323-1750345 CTCCCCTGCTGCCCTGAGCCGGG - Intergenic
1020008123 7:4792952-4792974 CTCCCCTCCTGCCCTGGGGCGGG + Intronic
1020029764 7:4924636-4924658 CTTCCCCTCTGCCCAGATGCTGG - Intronic
1021981078 7:26056179-26056201 CTCCCCTACTGCCATGAGGATGG + Intergenic
1022568142 7:31424051-31424073 CTCCACTTCTACACTGCTGGTGG - Intergenic
1024576152 7:50766226-50766248 ATCCCCCTCTGCCCTTGTGGAGG + Intronic
1026687522 7:72524076-72524098 TTCACCTTCTGCCATGATTGTGG + Intergenic
1026880034 7:73902097-73902119 CTCCTCTTCCGCCTTGAAGGGGG - Intergenic
1028829061 7:95306830-95306852 CTCCTCTTCTGCCCTGAGTGTGG + Intronic
1029183395 7:98720887-98720909 TTCACCTTCTGCCATGATTGTGG - Intergenic
1029736413 7:102468133-102468155 CTCCCCGTCGGCCCAGGTGGAGG + Exonic
1030713202 7:112778116-112778138 CTGCCCTTGTGTCCTGTTGGTGG - Intronic
1031211778 7:118838203-118838225 TTCCCCTTCTGCCATGAAGAAGG - Intergenic
1031702456 7:124942869-124942891 CTTCCATACTGCCCTGGTGGAGG - Intergenic
1031850449 7:126856851-126856873 CTTTCCTTCTGCCCTGTAGGTGG + Intronic
1032410390 7:131690050-131690072 GTCCCTTTCAGCCATGATGGGGG + Intergenic
1033036713 7:137882364-137882386 CTCCTCTAGTGCACTGATGGTGG - Intronic
1033782668 7:144691458-144691480 CTCACCTTCTGCCCTCAAGTAGG - Intronic
1033833209 7:145277437-145277459 TTCACCTTCTGCCATGATTGTGG + Intergenic
1034037188 7:147837211-147837233 TTCACCTTCTGCCATGATTGTGG - Intronic
1035064995 7:156097810-156097832 CTCCTCTTCTGCCATGACAGAGG + Intergenic
1035885153 8:3283607-3283629 TGCCCCTTCTGCCCTGAAGCAGG + Intronic
1035968603 8:4222736-4222758 CACTCTTTCTGCCCAGATGGAGG + Intronic
1037820442 8:22132443-22132465 CTCCCCAGCTCCCCTGAGGGTGG + Intronic
1038075354 8:24066978-24067000 CTCCCACTATTCCCTGATGGAGG + Intergenic
1039448151 8:37648860-37648882 CACCCATTCTGACCTGGTGGCGG + Intergenic
1039884028 8:41645490-41645512 CTCCCTTCCTGCCTTGTTGGAGG + Exonic
1041183324 8:55271622-55271644 CTCCAGGTGTGCCCTGATGGCGG + Intronic
1042646835 8:70996758-70996780 CTACCCTTCTACCCTGAAGCAGG + Intergenic
1044010000 8:86983279-86983301 TTCACCTTCTGCCATGATTGAGG + Intronic
1045058701 8:98392917-98392939 CTCCCTTTCTGAACTGAAGGGGG - Intergenic
1046359331 8:113130485-113130507 TTCACCTTCTGCCATGATAGTGG + Intronic
1047115455 8:121836989-121837011 CTTGCCTTCTGCCATGATGGTGG + Intergenic
1047674201 8:127182524-127182546 CTTGCCTTCTGCCATGATTGTGG - Intergenic
1048375394 8:133818507-133818529 TTCACCTTCTGCCATGATTGTGG + Intergenic
1048864561 8:138750132-138750154 CTTGCCTTCTGCCATGATTGTGG + Intronic
1050162580 9:2733797-2733819 CTCTTCTTCTGCCCTCATGGTGG + Intronic
1050303882 9:4286691-4286713 CTCCCCTTCTGCACTCATGGTGG + Intronic
1050921768 9:11212615-11212637 TTCACCTTCTGCCATGATGGTGG - Intergenic
1053099421 9:35358409-35358431 GAACCCTTGTGCCCTGATGGTGG - Intronic
1053274378 9:36772111-36772133 TTCCCCTACTTCCCTGATTGTGG - Intergenic
1053754686 9:41293566-41293588 ATCCCCATCTGCCATGCTGGAGG - Intergenic
1054260208 9:62857870-62857892 ATCCCCATCTGCCATGCTGGAGG - Intergenic
1054331560 9:63762135-63762157 ATCCCCATCTGCCATGCTGGAGG + Intergenic
1055168036 9:73220215-73220237 TTCACCTTCTGCCAGGATGGTGG + Intergenic
1056432288 9:86539926-86539948 ATTCCCTTGTGCACTGATGGTGG + Intergenic
1056678287 9:88695375-88695397 CTCCCCACCTGCCATGATGCAGG - Intergenic
1057814700 9:98285927-98285949 CTCCCCTTCTTCCCTCAGAGTGG + Intergenic
1061671257 9:132189561-132189583 CTGCCCTTCTTCCCTGAAGCAGG - Intronic
1062044979 9:134420811-134420833 CTCCCCTCCTGCCCTGTTCAAGG + Intronic
1062206141 9:135338491-135338513 CTCCCCTTCTCCCCTTCTTGTGG - Intergenic
1062218919 9:135403922-135403944 CTCTCCTCCTGCCCTGAGGGAGG + Intergenic
1062564640 9:137158755-137158777 CACCCCCTCTGGCCTGAAGGAGG + Intronic
1062634176 9:137481259-137481281 CCTCCCATCTGCCCTGAAGGAGG + Intronic
1185451236 X:281377-281399 CTTCCCTGCTGCCCGGAAGGAGG - Exonic
1186546163 X:10451785-10451807 CTTGCCTTCTGCCATGATTGTGG + Intronic
1187138898 X:16574797-16574819 CTGCCCTTCTCCTCTGACGGAGG + Intergenic
1187924124 X:24234881-24234903 TTCACCTTCTGCCATGATTGTGG + Intergenic
1189346817 X:40248148-40248170 CCCTCCTTTTGCCCTCATGGGGG + Intergenic
1190025103 X:46914864-46914886 CTCCCCTACGGGCCTGAAGGTGG - Intronic
1190109735 X:47582307-47582329 CTTGGCTTCTGCACTGATGGTGG + Exonic
1190469594 X:50764912-50764934 TTCGCCTTCTGCCATGATCGTGG - Intronic
1191693102 X:63961018-63961040 CTCCCCTTCTGCCCTGACAGGGG + Intergenic
1191722500 X:64245738-64245760 CTTCCCTTCTGCTCTGATTTTGG + Intergenic
1193079183 X:77389179-77389201 CTTCCCTTCTGCCATGATTGCGG + Intergenic
1193910123 X:87294383-87294405 GTCCCCTTGTGCACTGTTGGAGG - Intergenic
1196686217 X:118512754-118512776 CTCCCCTTCTACCCTGGTAGAGG - Intronic
1198379973 X:136074744-136074766 TTCACCTTCTGCCATGATTGAGG + Intergenic
1198728007 X:139697091-139697113 CTACCCTCCTGCCCTGAAGCAGG - Intronic
1199158060 X:144572995-144573017 CTTGCCTTCTGCCATGATTGAGG + Intergenic
1199736212 X:150689056-150689078 ACCCCCTTCTGCCCACATGGGGG - Intergenic
1200123206 X:153800900-153800922 CTTCCCCTCTTCCCTGCTGGTGG + Intergenic
1201224051 Y:11799840-11799862 CTCACCTTCTCCCCTGAAGCTGG + Intergenic