ID: 1162478866

View in Genome Browser
Species Human (GRCh38)
Location 19:10916446-10916468
Sequence GTAGAGCTGTTCATCCGTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 38}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162478866_1162478869 7 Left 1162478866 19:10916446-10916468 CCTTCACGGATGAACAGCTCTAC 0: 1
1: 0
2: 0
3: 0
4: 38
Right 1162478869 19:10916476-10916498 AGTTCACCAAGGCCAACTTCTGG 0: 1
1: 0
2: 0
3: 10
4: 132
1162478866_1162478873 22 Left 1162478866 19:10916446-10916468 CCTTCACGGATGAACAGCTCTAC 0: 1
1: 0
2: 0
3: 0
4: 38
Right 1162478873 19:10916491-10916513 ACTTCTGGTGAGTGTGCCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 153
1162478866_1162478872 21 Left 1162478866 19:10916446-10916468 CCTTCACGGATGAACAGCTCTAC 0: 1
1: 0
2: 0
3: 0
4: 38
Right 1162478872 19:10916490-10916512 AACTTCTGGTGAGTGTGCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 139
1162478866_1162478868 -4 Left 1162478866 19:10916446-10916468 CCTTCACGGATGAACAGCTCTAC 0: 1
1: 0
2: 0
3: 0
4: 38
Right 1162478868 19:10916465-10916487 CTACATGGAGCAGTTCACCAAGG 0: 1
1: 0
2: 2
3: 12
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162478866 Original CRISPR GTAGAGCTGTTCATCCGTGA AGG (reversed) Exonic
904396822 1:30227854-30227876 GGGGAGCTGTTCAGCCCTGATGG - Intergenic
906984550 1:50669182-50669204 GTAGAGTTGTTAATACTTGAGGG - Intronic
907481381 1:54747750-54747772 GTAGAGCTGGCCCTCCCTGATGG + Intergenic
911229967 1:95350667-95350689 GTAGAGGAGTTCATAAGTGAAGG - Intergenic
919926926 1:202196303-202196325 GTAGAGCTGTTCTCCAGAGAGGG - Intronic
922171788 1:223161784-223161806 GTAGAGCTGGTGAGCTGTGATGG - Intergenic
924706189 1:246504236-246504258 GTAGAGATGTGCATCCCTTAAGG + Intronic
1069772951 10:70911005-70911027 GTAGACCTGTTCAACCTGGAAGG + Intergenic
1093358487 12:18197460-18197482 GTAAAGCTCGGCATCCGTGATGG - Intronic
1093636989 12:21482305-21482327 GAGGAGCTGTTCATACCTGATGG + Intronic
1111003013 13:82209780-82209802 CTATAGCTGTTCATCCCTAATGG - Intergenic
1114560784 14:23589064-23589086 GTACAGCTTTTCATCTGTGCTGG + Intergenic
1129863356 15:78881596-78881618 GTGGAGCTGTTTTTCAGTGATGG + Intronic
1136500362 16:30667110-30667132 ATAGAACTGTTCAGCAGTGATGG - Intronic
1152002414 17:77654993-77655015 GTAGAGCTGCTCATGCAGGATGG + Intergenic
1155262458 18:24057654-24057676 CTAGATCTGTTCTACCGTGATGG + Intronic
1160451526 18:78969748-78969770 GCAGAACTGCTCAGCCGTGACGG + Intergenic
1161431159 19:4233197-4233219 GAACAGCTGGACATCCGTGATGG - Exonic
1162478866 19:10916446-10916468 GTAGAGCTGTTCATCCGTGAAGG - Exonic
1164396735 19:27871861-27871883 GAAAAGCTGTGCATCTGTGAGGG + Intergenic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1172895361 20:38296156-38296178 GGAGAGCTGATCATCCCTGCTGG + Intronic
1173655335 20:44696598-44696620 GGAGAGCTGTGCATCAGTCAGGG - Intergenic
1184058517 22:42067924-42067946 GAAGAGCTGTTCACTAGTGAGGG + Exonic
956635769 3:71363279-71363301 GTAGAATTCTTTATCCGTGATGG - Intronic
962326045 3:134433122-134433144 GTAGAGCTCTTCATCACTGGAGG + Intergenic
970615269 4:17762970-17762992 GCAGAGCTGTTCAGCTGTGTAGG - Intronic
976471271 4:85431487-85431509 GTAAAGCAGTTTATCAGTGAGGG + Intergenic
982824436 4:159984704-159984726 TTAGAGCTGTAGATCCCTGAGGG - Intergenic
985353181 4:189088877-189088899 TAAGAGCTGTTCATCTGGGATGG + Intergenic
999699155 5:154212255-154212277 GGAAAGCTGCTCATCCATGAAGG - Intronic
1011428442 6:87257101-87257123 TTTGAGCTGTTCACCGGTGATGG - Exonic
1013014499 6:106148996-106149018 GTAGACCAGTGCTTCCGTGAGGG - Intergenic
1015102925 6:129502322-129502344 ATAGAGCTCTTCATATGTGAAGG + Intronic
1023091236 7:36619329-36619351 GCAGAGCTCATCATCAGTGATGG - Intronic
1037004383 8:13759361-13759383 GTAGATCTGATCATCGGGGATGG - Intergenic
1039744582 8:40412878-40412900 GTGGAGCTGATGATCCCTGAGGG - Intergenic
1049808758 8:144553778-144553800 GTAGTGCCGTGCATCCCTGAGGG - Intronic
1057077121 9:92143756-92143778 GTAGAGCTGTTCTCCAGAGAGGG - Intergenic