ID: 1162480237

View in Genome Browser
Species Human (GRCh38)
Location 19:10923371-10923393
Sequence GTCGCTGCCTCCGGAGAACG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162480237_1162480245 22 Left 1162480237 19:10923371-10923393 CCACGTTCTCCGGAGGCAGCGAC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1162480245 19:10923416-10923438 GACCCCTGGGGTCAGAGGCAGGG 0: 1
1: 0
2: 2
3: 42
4: 381
1162480237_1162480244 21 Left 1162480237 19:10923371-10923393 CCACGTTCTCCGGAGGCAGCGAC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1162480244 19:10923415-10923437 AGACCCCTGGGGTCAGAGGCAGG 0: 1
1: 0
2: 1
3: 51
4: 422
1162480237_1162480243 17 Left 1162480237 19:10923371-10923393 CCACGTTCTCCGGAGGCAGCGAC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1162480243 19:10923411-10923433 CACAAGACCCCTGGGGTCAGAGG 0: 1
1: 0
2: 6
3: 27
4: 298
1162480237_1162480242 10 Left 1162480237 19:10923371-10923393 CCACGTTCTCCGGAGGCAGCGAC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1162480242 19:10923404-10923426 ACAACTGCACAAGACCCCTGGGG 0: 1
1: 0
2: 1
3: 9
4: 117
1162480237_1162480241 9 Left 1162480237 19:10923371-10923393 CCACGTTCTCCGGAGGCAGCGAC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1162480241 19:10923403-10923425 TACAACTGCACAAGACCCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 94
1162480237_1162480240 8 Left 1162480237 19:10923371-10923393 CCACGTTCTCCGGAGGCAGCGAC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1162480240 19:10923402-10923424 GTACAACTGCACAAGACCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162480237 Original CRISPR GTCGCTGCCTCCGGAGAACG TGG (reversed) Exonic
904375680 1:30080792-30080814 GCCGCTTCCTCCAGAGAAGGAGG - Intergenic
907570439 1:55478279-55478301 CTCGCTGCCTGCGGAGAAGATGG + Intergenic
910408552 1:86915210-86915232 GGCGCTGCCGCCGGAGCAAGTGG + Intronic
917755635 1:178094573-178094595 GCCGCTGCCCCCGGAGGACCTGG + Exonic
922751771 1:228073450-228073472 CTCCCTGCCTCCTGAGAAAGGGG + Intergenic
924052006 1:240088696-240088718 GCCGCAGCCTCCGGAGAAGCTGG + Intronic
1064882557 10:20072253-20072275 GTCGCCGCCTCCTGAGTAGGTGG - Intronic
1077038675 11:507636-507658 GGCGCGGCCCCCGGAGAAAGCGG + Intergenic
1077151589 11:1075318-1075340 GTCTCTGCCACCTGAGAATGGGG - Intergenic
1078064079 11:8066500-8066522 CCTGCTGCCTCCAGAGAACGAGG - Intronic
1078527228 11:12110453-12110475 GCCGCTGCCGCCGGCGCACGTGG - Intronic
1083947401 11:65931935-65931957 GACGCTGCCTTTGGAGAACAGGG + Intergenic
1088316510 11:108512271-108512293 TTCGCTGACTCAGGAGAACTGGG + Exonic
1092479709 12:8848874-8848896 GTCCGTGCCTTCAGAGAACGAGG - Exonic
1094041014 12:26122236-26122258 GTCGCCCCCTCCCGAGAAGGCGG - Exonic
1094100675 12:26758745-26758767 GTGGCTGCCTACATAGAACGAGG + Intronic
1094137711 12:27146839-27146861 GCCTCTGCCTCCGGAGTAGGTGG + Intergenic
1098360616 12:69650995-69651017 GTCTCAGCCTCCGGAGAAGCTGG - Intronic
1103822175 12:123707824-123707846 GCCTCAGCCTCCGGAGAACTGGG + Exonic
1109581759 13:64348459-64348481 GTCTCAGCCTCCGGAGTACCTGG - Intergenic
1113415564 13:110125865-110125887 GTGGCTGCCTCCGTAAAACATGG - Intergenic
1117566077 14:56994867-56994889 GTCTCTGCCTCCTGAGTAGGTGG - Intergenic
1119298215 14:73550247-73550269 GTCGCTGCATCCCGAGAACACGG - Intronic
1119302503 14:73582431-73582453 GTCGCTGCATCCTGAGAACACGG - Intergenic
1121733897 14:96204941-96204963 GCCGCTTGCTCCGGAGAAGGTGG + Exonic
1126838513 15:52692772-52692794 GTCTCTGCCTCCTGAGTAGGTGG + Intronic
1136490537 16:30605029-30605051 GTCGCTGCTTCCGGAGGAGCCGG - Exonic
1138362208 16:56440851-56440873 GTCTCAGCCTCCGGAGTAGGTGG + Intronic
1139679132 16:68546625-68546647 GTCTCAGCCTCCTGAGAACTGGG + Intronic
1142033913 16:87852163-87852185 GTCACTGCCTCCAGAGACCCAGG + Intronic
1143880087 17:10023233-10023255 GTGGCTGCCTCGGGAGATGGAGG - Intronic
1144599763 17:16601340-16601362 GGCGCTGCCTCCAGAGCACCTGG - Intergenic
1147967138 17:44199538-44199560 GTCGCCGCCGCCGGAGGACGCGG - Intronic
1152178637 17:78803827-78803849 GGCGCTGCCTCAGGTCAACGAGG - Exonic
1155004872 18:21719559-21719581 GTCTCAGCCTCCGGAGTACCTGG + Intronic
1155524505 18:26702846-26702868 GTCTCAGCCTCCTGAGAAAGTGG + Intergenic
1157545135 18:48541124-48541146 GCCGCTGCCTTCGCAGACCGGGG + Intronic
1157673551 18:49550877-49550899 GTTGCTGCCTCCCAAGAACATGG - Intergenic
1160918890 19:1510629-1510651 GGCGCTGCCTCCGGTGAGCGGGG - Exonic
1160969969 19:1763247-1763269 GTCGCAGCCTCCGGAGTAGCTGG - Intronic
1162480237 19:10923371-10923393 GTCGCTGCCTCCGGAGAACGTGG - Exonic
935992869 2:108737661-108737683 GTCTCTGCCTCCGGAATAGGTGG + Intronic
937598155 2:123695267-123695289 GTGGCTGCCTCATGAGAACTGGG - Intergenic
941929910 2:170929219-170929241 CTCGCTGCCGCCGGAGAGCCGGG - Exonic
944388150 2:199187590-199187612 GTCTCAGCCTCCTGAGAACCTGG - Intergenic
944543262 2:200774571-200774593 GGTGCTGCGTCCAGAGAACGTGG + Intergenic
947763880 2:232623557-232623579 GTCTCTGCCTCCTGAGAAGCTGG - Intronic
1172303318 20:33864742-33864764 GTCACTGCCTCTGCAGAACCTGG + Intergenic
1173337467 20:42124501-42124523 GTCTCTGCCTCCGGAGGCCGTGG - Intronic
1173419057 20:42884472-42884494 TTGGCTACCTCTGGAGAACGGGG - Intronic
1179490848 21:41740815-41740837 CTGGCTGCCTGCGGAGACCGGGG - Exonic
1179906242 21:44424688-44424710 GTGGCTGCCTGGGGAGGACGTGG + Intronic
1180965260 22:19784804-19784826 GCCGCTGCCTCCGGTGCAGGTGG - Exonic
1181299603 22:21870082-21870104 GTCTCAGCCTCCGGAGTAGGTGG - Intergenic
950563403 3:13749103-13749125 GTCTCTGCCTCCGAGGAAGGTGG - Intergenic
951360522 3:21719362-21719384 GTTGCTGCATCCAGAGAACACGG - Intronic
958603211 3:96325886-96325908 GTCTCAGCCTCCGGAGTAGGTGG - Intergenic
965566955 3:170129812-170129834 GTCTCTGCCTCCGGAGTAGCTGG + Intronic
968915049 4:3493653-3493675 GTGGCTGCCACCGGAGGAAGGGG + Exonic
968922064 4:3527415-3527437 GTCGGTGCCTCAGGAGGAGGGGG + Intronic
977894202 4:102345529-102345551 GTCCCCGCCTCCGTAGCACGTGG + Intronic
983376828 4:166940431-166940453 GTTGCTGCCTCCCAAGAACATGG - Intronic
984484742 4:180353745-180353767 GTCTCAGCCTCCCGAGTACGTGG + Intergenic
989108975 5:37889074-37889096 GTGGCTGCCTCTGGAGATGGAGG + Intergenic
997086748 5:130808841-130808863 GTTGCTGCATCCCGAGAACATGG - Intergenic
997535517 5:134617794-134617816 GTCTCTGCCTCCCGAGTAGGTGG + Intronic
997545675 5:134705188-134705210 GTCTCTGCCTCTGGAGTAGGTGG + Intronic
1015034451 6:128636359-128636381 GTCTCAGCCTCCCGAGAAGGTGG - Intergenic
1017889750 6:158628598-158628620 GACGAGGCCTCCGGAGAACAGGG - Intronic
1023908039 7:44536128-44536150 GTGGCTGCCTGCTCAGAACGGGG - Intronic
1038834705 8:31106476-31106498 GTGGCTGCATCCGGTGAATGAGG - Intronic
1039825367 8:41169092-41169114 GTCTCAGCCTCCCGAGTACGTGG - Intergenic
1046239587 8:111473827-111473849 GTTGCTGCATCCTGAGAACATGG - Intergenic
1049608424 8:143540839-143540861 GCCTCAGCCTCCGGAGTACGTGG - Intronic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1053308907 9:37002904-37002926 GTGGCCGCCTCCGCAGAGCGAGG - Intronic
1054768516 9:69063077-69063099 GTCCCTGCCTCCAGAGAGCTGGG - Intronic
1061262580 9:129488374-129488396 GCGGCTGCCTCCGGAGCGCGGGG + Intergenic
1062183372 9:135203060-135203082 GTCTCTGCCTCCGGAGAGTCAGG - Intergenic
1062307420 9:135916543-135916565 GTCGCAGCCTCCGGAGTAGCTGG - Intergenic
1062422127 9:136487837-136487859 GACTCTGCCTCCGGGGAACATGG + Intergenic
1189924937 X:45943253-45943275 GTCTCAGCCTCCGGAGAAGCTGG + Intergenic
1190027518 X:46938940-46938962 GTCTCTGCCTCCTGAGTAAGTGG + Intronic
1199428837 X:147735699-147735721 GTCCCTGCCTCCTCAGAACTTGG + Intergenic
1199851664 X:151728185-151728207 GTCCCTCCCTCTGGAGAAGGTGG - Intergenic