ID: 1162484776

View in Genome Browser
Species Human (GRCh38)
Location 19:10952886-10952908
Sequence CAGTCTGAGAAGAGTGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162484776_1162484783 29 Left 1162484776 19:10952886-10952908 CCAGACTCACTCTTCTCAGACTG No data
Right 1162484783 19:10952938-10952960 ACCCCGGCTTGGCTTGCCTTGGG No data
1162484776_1162484781 18 Left 1162484776 19:10952886-10952908 CCAGACTCACTCTTCTCAGACTG No data
Right 1162484781 19:10952927-10952949 ATGTTTGGGAAACCCCGGCTTGG No data
1162484776_1162484779 4 Left 1162484776 19:10952886-10952908 CCAGACTCACTCTTCTCAGACTG No data
Right 1162484779 19:10952913-10952935 CACATCTGCAGGTGATGTTTGGG No data
1162484776_1162484778 3 Left 1162484776 19:10952886-10952908 CCAGACTCACTCTTCTCAGACTG No data
Right 1162484778 19:10952912-10952934 GCACATCTGCAGGTGATGTTTGG No data
1162484776_1162484782 28 Left 1162484776 19:10952886-10952908 CCAGACTCACTCTTCTCAGACTG No data
Right 1162484782 19:10952937-10952959 AACCCCGGCTTGGCTTGCCTTGG No data
1162484776_1162484780 13 Left 1162484776 19:10952886-10952908 CCAGACTCACTCTTCTCAGACTG No data
Right 1162484780 19:10952922-10952944 AGGTGATGTTTGGGAAACCCCGG No data
1162484776_1162484777 -7 Left 1162484776 19:10952886-10952908 CCAGACTCACTCTTCTCAGACTG No data
Right 1162484777 19:10952902-10952924 CAGACTGAGAGCACATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162484776 Original CRISPR CAGTCTGAGAAGAGTGAGTC TGG (reversed) Intergenic
No off target data available for this crispr