ID: 1162486002 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:10960988-10961010 |
Sequence | GGCGCGCGTGTGTGTGAAGG GGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 297 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 24, 4: 271} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1162485992_1162486002 | 9 | Left | 1162485992 | 19:10960956-10960978 | CCGGCGAGCGCGCGCGCAGCGGG | 0: 1 1: 0 2: 3 3: 13 4: 160 |
||
Right | 1162486002 | 19:10960988-10961010 | GGCGCGCGTGTGTGTGAAGGGGG | 0: 1 1: 0 2: 1 3: 24 4: 271 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1162486002 | Original CRISPR | GGCGCGCGTGTGTGTGAAGG GGG | Exonic | ||