ID: 1162486002

View in Genome Browser
Species Human (GRCh38)
Location 19:10960988-10961010
Sequence GGCGCGCGTGTGTGTGAAGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162485992_1162486002 9 Left 1162485992 19:10960956-10960978 CCGGCGAGCGCGCGCGCAGCGGG 0: 1
1: 0
2: 3
3: 13
4: 160
Right 1162486002 19:10960988-10961010 GGCGCGCGTGTGTGTGAAGGGGG 0: 1
1: 0
2: 1
3: 24
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162486002 Original CRISPR GGCGCGCGTGTGTGTGAAGG GGG Exonic