ID: 1162486140

View in Genome Browser
Species Human (GRCh38)
Location 19:10961433-10961455
Sequence CGGCGAGAGCGCGCGCGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 1, 2: 4, 3: 24, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162486140_1162486148 11 Left 1162486140 19:10961433-10961455 CCTCTCCGCGCGCGCTCTCGCCG 0: 1
1: 1
2: 4
3: 24
4: 149
Right 1162486148 19:10961467-10961489 CAAAGCTCGCCCCCCTCGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162486140 Original CRISPR CGGCGAGAGCGCGCGCGGAG AGG (reversed) Intronic
901242864 1:7704952-7704974 CGGCGGGGGCGCGCGCGGGGCGG + Intronic
901433885 1:9234728-9234750 CGGCGGGGGCGCGCGCGGCGGGG - Intergenic
901641372 1:10694699-10694721 CGGCGCGGGCGCGCGCGGCGGGG - Intronic
902586172 1:17439731-17439753 CGGCAAGCGAGCGCGCGGCGGGG + Intergenic
903514768 1:23902960-23902982 CGGCGCGAGGGCGCGGGGCGGGG - Intronic
905779160 1:40692291-40692313 CGGCGAGAGGGCGAGCCTAGAGG + Intronic
906678462 1:47709495-47709517 CGGAGAGGGCTCGCGCGTAGGGG + Intergenic
912716956 1:111989830-111989852 CCGCGAGCCCGCGAGCGGAGCGG - Intergenic
920120239 1:203650644-203650666 GGGCGAGGGCGGGCGGGGAGCGG + Intronic
922648691 1:227318399-227318421 GGGCGCGAGCGCGAGAGGAGAGG - Exonic
1065099739 10:22321337-22321359 GGGGGAGGGCGCGCGCGGAGGGG - Exonic
1067091347 10:43267088-43267110 GGGCGCGAGAGCGCGGGGAGCGG + Intergenic
1068955908 10:62818554-62818576 CCGCCAGAGCGCAGGCGGAGTGG - Intronic
1073196394 10:101695039-101695061 CGGCGAGGGCGAGGGCGGAGAGG - Exonic
1076868826 10:133182821-133182843 CGGCGAGGGCGCGGGCAGTGTGG + Intronic
1082814594 11:57499695-57499717 CGGCCAGAGGGAGCGGGGAGAGG + Intronic
1083595574 11:63917079-63917101 CGGGGAGAGCGAGCGCGCCGGGG - Intergenic
1084336459 11:68460696-68460718 CGGCCAGAGGGCGGGCGGGGGGG + Intergenic
1090086301 11:123654042-123654064 CGGCGAGAGCGGGCGCGGAGCGG - Exonic
1090653222 11:128824613-128824635 AGCCGAGAGCGCGCGGGGCGGGG + Intergenic
1091000905 11:131910469-131910491 CGGCGGGAGGGCGCGGGGCGCGG - Intronic
1092045941 12:5431977-5431999 GGGCGCGGGCGCGCGCGGCGCGG + Intergenic
1094041710 12:26126101-26126123 GGGCGAGCGCGCGCGCGCACGGG - Intronic
1096127681 12:49131497-49131519 CGGCCAGGCCGGGCGCGGAGTGG - Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096670918 12:53197798-53197820 CAGCCAGGGCGCCCGCGGAGAGG - Exonic
1096983623 12:55743145-55743167 CGGCGGGCGCGCGGGCGGGGCGG - Intergenic
1101605986 12:106247977-106247999 CGGCGAGAGGACGCGCGGCCGGG + Exonic
1104977761 12:132559934-132559956 AGGCGGGAGCGCGGGCGGGGCGG - Intronic
1105405325 13:20128185-20128207 CGGCCAGGGCCCGGGCGGAGGGG + Intergenic
1106208367 13:27620330-27620352 CAGCGAGAGGGCGCGCAGCGAGG + Intronic
1106422498 13:29595497-29595519 CGGCGAGACCGGGCGGGGCGGGG + Exonic
1108542071 13:51453635-51453657 CGGCGCGAGCGGGCGCGGGCGGG + Intronic
1113643234 13:111973299-111973321 CGGCGAGAGCGCGTGTGGTCAGG + Intergenic
1115911023 14:38256150-38256172 CGTCGGGAGCGAGGGCGGAGGGG - Exonic
1119438472 14:74612652-74612674 CGGCCAGGGCGCAAGCGGAGGGG - Intergenic
1121617020 14:95319998-95320020 TGGCGCGAGCGAGCGCGGGGCGG + Intergenic
1122220998 14:100239116-100239138 CGGCGAGCGGGCGGGGGGAGAGG - Exonic
1122634440 14:103123519-103123541 GGGCGAGAAGCCGCGCGGAGCGG - Exonic
1122637897 14:103138799-103138821 CGGGGACAGGGCGGGCGGAGCGG + Intergenic
1122993255 14:105248804-105248826 CGGCGCGAGGGCGCGGGGCGCGG + Exonic
1125300737 15:38252159-38252181 AGGCCAGAGCGGGCGCGGGGTGG - Intergenic
1126134656 15:45378519-45378541 TCCCGAGAGCGCGCCCGGAGCGG + Exonic
1128582660 15:68820096-68820118 CGGGGAGAGCGCGTGGGGAGGGG - Intronic
1128743692 15:70099374-70099396 CGGCCGGAGCGGGCGCGGGGAGG - Intergenic
1128992535 15:72272655-72272677 CCGCGCGAGCGTGCGCAGAGTGG - Intronic
1129052844 15:72796990-72797012 CCGCGAGAGCGGCCGCGGCGCGG + Intergenic
1129644835 15:77420215-77420237 GGGCGAGGGCGCGCGCGGAGGGG - Intergenic
1129919855 15:79311035-79311057 CGGCCAGCGCGCACGCGCAGCGG + Intergenic
1130115594 15:81002081-81002103 CGGCGGGAGCCCGGGCGGCGCGG - Exonic
1131054415 15:89367294-89367316 GGCCGAGAGCGCTCACGGAGAGG - Intergenic
1131475388 15:92734227-92734249 CAGCGGGAGGGCGCGCGGCGGGG - Intronic
1132314351 15:100879592-100879614 GGGCGAGAGAGCGCGCGGCGCGG + Exonic
1132724590 16:1333379-1333401 CGGGGAGGGCGCGCGCGGCCAGG + Intergenic
1136141601 16:28292410-28292432 GCGCGAGGGCGCGCGCCGAGCGG + Intergenic
1137531760 16:49282403-49282425 GGGCGCGTGCGCGCGCGGCGGGG + Intergenic
1139775062 16:69311650-69311672 CGGCGAGGGGGCGGCCGGAGCGG - Intronic
1142350312 16:89576481-89576503 CGGCGAGGGAGCGCGCGCTGGGG + Intronic
1143183490 17:4997904-4997926 ACGCGCGAGCGCGCGCGGAGGGG - Intergenic
1144724494 17:17495026-17495048 GGCCGGGAGCGCGCGCGGACTGG - Exonic
1144756201 17:17681904-17681926 CGCCGAGCGCGCGCGCTGGGTGG + Intronic
1145063139 17:19744787-19744809 CGGCGGGGGCGCGCGGGGCGCGG + Intronic
1146281967 17:31550350-31550372 CGGCGAGGGCGCACGCGGCGCGG - Intergenic
1146794269 17:35770140-35770162 CGCCATGAGCGCGCGCGGCGCGG + Exonic
1147168680 17:38605987-38606009 GGGCGGGCGCGCGCGCGGCGCGG + Intergenic
1147842082 17:43378976-43378998 CTGCGAGATCGCGCCCTGAGGGG + Intergenic
1147927192 17:43953275-43953297 CGGTGAGCGCAGGCGCGGAGCGG - Exonic
1148048867 17:44759553-44759575 AGGCAAGAGCCCGCGGGGAGGGG - Intronic
1148284088 17:46372776-46372798 CGGCGGGGGCGCGCGCGCGGCGG + Intergenic
1148306309 17:46590697-46590719 CGGCGGGGGCGCGCGCGCGGCGG + Exonic
1151210462 17:72540469-72540491 GGGCGCGGGCGCGGGCGGAGCGG - Intergenic
1152212481 17:79009766-79009788 CGGGGCGAGCGCGCGCGGGGCGG - Exonic
1152581185 17:81166230-81166252 GGGCGGGAGCGCGCGCGGAGCGG + Intergenic
1153457316 18:5295561-5295583 CGGCGAGCGGGCTCGGGGAGCGG - Intronic
1155507632 18:26548422-26548444 GGGCGAGGGCGAGCGCGGCGCGG - Intronic
1160864105 19:1249608-1249630 GGGCGGGGGCGGGCGCGGAGAGG + Intronic
1160937815 19:1605478-1605500 CGGCGCGCACGCGCGCGGGGAGG + Exonic
1161006721 19:1940926-1940948 CCGCGAGGGCGCGCGCGGGCAGG - Intergenic
1162485994 19:10960957-10960979 CGGCGAGCGCGCGCGCAGCGGGG + Intergenic
1162486140 19:10961433-10961455 CGGCGAGAGCGCGCGCGGAGAGG - Intronic
1163535242 19:17872906-17872928 CGGTGGAAGCGCGCGCGGGGCGG + Intronic
1164834687 19:31349658-31349680 CGGGGAGAGGGCGGGCAGAGCGG + Intergenic
1165330631 19:35139622-35139644 CCGCGAGCGGGCGGGCGGAGAGG + Intronic
1165553194 19:36605635-36605657 CGGCGGGTCCCCGCGCGGAGCGG + Intronic
1165922389 19:39307363-39307385 CCGCGAGCGCGCGAGGGGAGGGG + Exonic
1166852703 19:45768069-45768091 CGGCGACAGCGCGACCGGACCGG - Exonic
925959822 2:9003932-9003954 GAGCGAGAGCGCGCGAGGTGGGG - Intergenic
926217118 2:10912404-10912426 CTGCGAGGGCGCGCGCGGGGAGG + Exonic
928094086 2:28393405-28393427 GGGCGGGAGGGCGCGCGCAGGGG + Exonic
928278298 2:29921619-29921641 CCGCGCGAGCGCGCGCAGGGAGG + Intergenic
929720408 2:44362037-44362059 CGGCGAGACCGCGCGAGCAGCGG + Exonic
929788676 2:45009130-45009152 CGGTGAGGGCGCGCGCGGGCGGG - Exonic
936561280 2:113541789-113541811 CAGCGAGCGGCCGCGCGGAGAGG + Intergenic
937203886 2:120223548-120223570 GGGCTAGAGCGCCCGCGGTGAGG + Intergenic
938414583 2:131093561-131093583 GCGCGAGCGCGAGCGCGGAGTGG + Intergenic
944831209 2:203535309-203535331 CGGCGGGAGCGGGGGCGGGGCGG + Exonic
945119479 2:206443460-206443482 CGGCGCGGGGACGCGCGGAGCGG - Intergenic
1168855082 20:1002396-1002418 CCGGGAGCGCGCGCGGGGAGGGG + Intergenic
1169088362 20:2840930-2840952 CGGGGAGAGCCGGCGCGGGGCGG - Intronic
1171012974 20:21518495-21518517 CGGCTGGAGCGGGCGCGGGGAGG + Intergenic
1173726893 20:45304590-45304612 CGGCGAGAGAACGCGCGGAGAGG + Exonic
1174467882 20:50731505-50731527 CGGCGACAGCGCTGGAGGAGAGG - Intergenic
1175199220 20:57266500-57266522 GGGCGAGAGCGCCAGAGGAGCGG - Exonic
1175847306 20:62065555-62065577 CGCCGAGGGCGCGCCCGGAGCGG - Exonic
1176005749 20:62861586-62861608 CGTCGAGGGCGCGGGCGGCGGGG - Exonic
1178992504 21:37367312-37367334 CGGCGAGGCCGGGCGCCGAGCGG - Intronic
1179150571 21:38805637-38805659 CGGCGAGGGAGCGCGGGGCGGGG - Intronic
1179451845 21:41473428-41473450 CGGCGAGAGCGCGCTCCCGGGGG - Exonic
1180782402 22:18528615-18528637 CGGCGCGGGAGCGCGCGGAGCGG + Exonic
1180876837 22:19178640-19178662 CCGCCAGAGCGCGCGGGGCGCGG + Exonic
1181125953 22:20702642-20702664 CGGCGCGGGAGCGCGCGCAGCGG + Intergenic
1181239291 22:21467950-21467972 CGGCGCGGGAGCGCGCGGAGCGG + Intergenic
1181831643 22:25564905-25564927 CGGGGCGGGGGCGCGCGGAGGGG + Exonic
1183411704 22:37658791-37658813 CTGCGAGAGGCTGCGCGGAGCGG + Exonic
1184086908 22:42270712-42270734 GGGCGGGAGGGCGCGCGGCGGGG + Intronic
1184680948 22:46071841-46071863 CGGAGAGGGCGAGCGCGGCGCGG - Intronic
1184759747 22:46537630-46537652 CGGGGAGAGCGCGGGCGGAGTGG - Intergenic
1184906764 22:47493150-47493172 AGGCAAGAGAGCGCGCGCAGGGG - Intergenic
1185037914 22:48489412-48489434 GGGCGCGAGCGCGGGCGGCGCGG + Intergenic
1185271082 22:49929553-49929575 CGGCGGGAGCGGGCGGGGCGCGG - Intergenic
950584170 3:13880737-13880759 CGCCGCGAGCGCGCTCTGAGCGG - Intergenic
950683874 3:14602882-14602904 CGGTGAGCGCGCGCGCGGCGCGG - Intergenic
950683992 3:14603228-14603250 CGGTGGGGGCGGGCGCGGAGAGG + Intergenic
951544477 3:23810789-23810811 CGTCGGGGGCGCGCGCGGGGTGG + Intronic
961780204 3:129316548-129316570 CTGCGGGAGCGCGAGAGGAGGGG + Intergenic
962736448 3:138329617-138329639 CGGCCAGGGGGCGCGCGCAGAGG + Intronic
963870386 3:150409030-150409052 CGGCGAGAGCGCGAACCCAGGGG - Exonic
964819575 3:160755510-160755532 CGGGGCGAGCGCGCGGGGGGCGG + Intergenic
966378794 3:179323220-179323242 GGCCGAGAGCGCAGGCGGAGGGG - Intronic
968478939 4:825581-825603 AGGCGGGAGCGCGCCAGGAGAGG + Intronic
968620775 4:1602658-1602680 CGGGGAGGGGGCGCGCGGAGGGG - Intergenic
970408702 4:15787188-15787210 CGGCCAGAGTGGGCGCGCAGAGG + Intronic
970585706 4:17512164-17512186 CGGCAGCAGCGGGCGCGGAGCGG - Exonic
971757566 4:30721998-30722020 CGGCGAGAGCCGGCGCGCCGGGG + Exonic
976390193 4:84498309-84498331 CGCCGAGGGCGCGAGCGGAGAGG + Exonic
978754285 4:112285940-112285962 GGGCGGGAGCGCGAGTGGAGCGG - Intronic
992249916 5:74866416-74866438 CGGTGGGCGCGGGCGCGGAGCGG - Intronic
992529164 5:77638824-77638846 AGGCGAGCGGGCGGGCGGAGTGG - Exonic
999727200 5:154446537-154446559 CGGCAAGCGCGGCCGCGGAGTGG + Exonic
1002140291 5:177133737-177133759 CCGCGGGGGCGCGCGCGGTGGGG + Intronic
1002521594 5:179795692-179795714 CGGCGGGAGGGCGCGGGGCGGGG + Intronic
1002711095 5:181195438-181195460 CCGCGAGAGCGTGCGCCGAAAGG - Exonic
1003645602 6:7910866-7910888 CGGCGCGGGCGGGCGGGGAGAGG - Intronic
1004396216 6:15248412-15248434 AGGGGAGAGCGCGCGGGGAGGGG + Intronic
1005826143 6:29632796-29632818 CGGAGAGGGGGCGCGCGGCGTGG - Intronic
1006304129 6:33208667-33208689 GGGCGGGAGCGGGGGCGGAGAGG + Intronic
1006860645 6:37169964-37169986 CGGCCACAGAGCGCGCGGGGCGG + Intergenic
1013106184 6:107028338-107028360 CGGCGGGAGCGTGGGCGGGGCGG - Exonic
1019112198 6:169724770-169724792 CGGCGACCGCGAGCGCGTAGAGG - Intronic
1019197265 6:170290004-170290026 GGGCAGGAGCGCGCGGGGAGGGG - Intronic
1020238562 7:6374801-6374823 CCGCGGGATCGGGCGCGGAGGGG + Intronic
1026482518 7:70790634-70790656 CGGCGGGAGCACGAGCGGGGAGG + Exonic
1028417634 7:90596547-90596569 CGGCGAGGGCGCGCGCCGCGGGG - Intronic
1029238819 7:99144110-99144132 CGGCGGGCGCGCGCGCGGCTCGG - Intergenic
1033361322 7:140640686-140640708 CCACGGGAGCGCGCGCGGCGGGG - Exonic
1034969466 7:155410149-155410171 CGGGGAGGGGGCGCGGGGAGGGG + Intergenic
1035476131 7:159145132-159145154 CAGAGGGAGCGCGCGCGGCGGGG - Intergenic
1037769534 8:21790175-21790197 CGGCGAGAGCGGGAGAGGCGCGG + Intronic
1037825300 8:22156817-22156839 CGGCGGGGGCGCGCGCGGGGCGG + Exonic
1038008843 8:23457716-23457738 CGGCGGGAGCGCGCACGCCGAGG + Intergenic
1038012112 8:23483549-23483571 CGGCGGGAGGGCGGGCGGATGGG - Intergenic
1038540213 8:28385479-28385501 GGGCGAGAGCGTGCGGGCAGAGG + Intronic
1043769693 8:84183177-84183199 CGGCGAGAGGGGGAGCCGAGCGG - Intronic
1049109834 8:140635738-140635760 CGGCGGGAGCGCGCTCGCGGGGG + Intergenic
1049844213 8:144792245-144792267 CGGTGCGGGCGCCCGCGGAGAGG - Intronic
1051418814 9:16870814-16870836 CGGCGAGGGCGCGCGCGGGCGGG - Intronic
1052807493 9:33025646-33025668 CCGCGGGGGCGCGCACGGAGGGG - Intronic
1052903962 9:33817659-33817681 CGGCCGGAGGGCGAGCGGAGGGG + Exonic
1053732836 9:41074624-41074646 CAGCGAGCGGCCGCGCGGAGAGG - Intergenic
1059145644 9:111897021-111897043 AGGCGAGAGCGCGCGGGCGGGGG + Exonic
1059234533 9:112750784-112750806 CGGCGGGCTCGGGCGCGGAGCGG + Intergenic
1059321229 9:113471647-113471669 CGGAGAGAGAGAGCGGGGAGGGG - Intronic
1062584181 9:137241585-137241607 CGGCCAGGGCGCGCGGGGCGGGG + Intronic
1185747620 X:2584648-2584670 GGGGGCGAGCGCGCGGGGAGGGG + Intergenic
1185750825 X:2608903-2608925 CAGCAAGGGCGGGCGCGGAGAGG + Intergenic
1186669963 X:11758208-11758230 CGGGCGGAGCGCGCGCGGTGGGG - Exonic
1191830119 X:65407227-65407249 GGGCGAGTGCGCGCGAGGCGCGG + Intronic
1197746052 X:129932624-129932646 CGGCGAGCGAGCGAGCGGAGCGG - Intergenic
1200098186 X:153673857-153673879 TGGCGGGGGCGTGCGCGGAGGGG - Intronic