ID: 1162489979

View in Genome Browser
Species Human (GRCh38)
Location 19:10986255-10986277
Sequence CGGGGCCCCAGATGTCTTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162489968_1162489979 10 Left 1162489968 19:10986222-10986244 CCTCTAGTCCAGTTCCAGCCAGT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1162489979 19:10986255-10986277 CGGGGCCCCAGATGTCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 136
1162489967_1162489979 30 Left 1162489967 19:10986202-10986224 CCTGGGTGGCTCTGAGCATGCCT 0: 1
1: 0
2: 1
3: 35
4: 278
Right 1162489979 19:10986255-10986277 CGGGGCCCCAGATGTCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 136
1162489975_1162489979 -8 Left 1162489975 19:10986240-10986262 CCAGTGGCCCGTCTTCGGGGCCC 0: 1
1: 0
2: 0
3: 8
4: 84
Right 1162489979 19:10986255-10986277 CGGGGCCCCAGATGTCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 136
1162489970_1162489979 2 Left 1162489970 19:10986230-10986252 CCAGTTCCAGCCAGTGGCCCGTC 0: 1
1: 0
2: 0
3: 13
4: 115
Right 1162489979 19:10986255-10986277 CGGGGCCCCAGATGTCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 136
1162489972_1162489979 -4 Left 1162489972 19:10986236-10986258 CCAGCCAGTGGCCCGTCTTCGGG 0: 1
1: 0
2: 0
3: 7
4: 58
Right 1162489979 19:10986255-10986277 CGGGGCCCCAGATGTCTTCCGGG 0: 1
1: 0
2: 0
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162489979 Original CRISPR CGGGGCCCCAGATGTCTTCC GGG Exonic
900394813 1:2448894-2448916 GGAGGCCCCAGGTGCCTTCCGGG - Intronic
901028571 1:6292481-6292503 AGTTGCCCCAGATGTCTTCTAGG + Intronic
901465364 1:9417801-9417823 CGGGGCCCCAGAGGCTGTCCTGG - Intergenic
901638719 1:10682402-10682424 CGGGCCCCCAGGAGTCTTCCGGG - Intronic
901882749 1:12203623-12203645 TAGGGCCCCTGATCTCTTCCAGG - Intronic
902450653 1:16494811-16494833 GGGGGCCCCAGATGTCCTTGAGG + Intergenic
902502213 1:16918531-16918553 GGGGGCCCCAGATGTCCTTGAGG - Intronic
902852088 1:19167110-19167132 CAGGGCCCAAGATGCGTTCCAGG + Exonic
906524515 1:46486359-46486381 CAGGGTCCCAGCTGTCTGCCCGG - Intergenic
907443007 1:54489974-54489996 CGGGGCCCCAGATGACAACCAGG - Intergenic
913554200 1:119948703-119948725 CTAGGCCACAGAAGTCTTCCTGG - Intronic
920616505 1:207497342-207497364 CGGCTCCCCAGAAGTCTTCTTGG + Intronic
920716515 1:208345262-208345284 AGGGGACCCAGTTGTCTTTCCGG + Intergenic
921699725 1:218254547-218254569 AGGGGCCCCAGCTGACTTCAGGG + Intergenic
922780555 1:228249572-228249594 CTGGGCCTCCCATGTCTTCCTGG - Intronic
1063667826 10:8075416-8075438 GGGGACCCCAGATGTCACCCCGG - Intergenic
1065198598 10:23291569-23291591 AGGGGCCCCAGCTGCCTCCCCGG - Intronic
1066064137 10:31750167-31750189 CAGGGCAGCAGATGTCTTGCTGG - Intergenic
1067016639 10:42761192-42761214 CTGGATGCCAGATGTCTTCCAGG - Intergenic
1067229312 10:44395664-44395686 CCTGGCCCCAGATGTCCTCTGGG - Intergenic
1067368699 10:45661590-45661612 TGTGACCCCAAATGTCTTCCAGG + Intronic
1067756711 10:49011201-49011223 CTGGGCCTCAGCTGTCCTCCAGG + Intergenic
1071605413 10:86983176-86983198 CTGGATGCCAGATGTCTTCCAGG - Intronic
1072292472 10:93976937-93976959 CTGGCCCCAAGATGTCTGCCTGG + Intergenic
1072768337 10:98114851-98114873 CTGGGTCCAAGAAGTCTTCCTGG + Intergenic
1073208544 10:101781151-101781173 CTGGGCCCCAGTTGCCTTGCTGG - Intergenic
1080458312 11:32434436-32434458 AGGGGCCCCAGACGCCCTCCCGG + Intronic
1081432268 11:42989392-42989414 AGGGGACACAGAAGTCTTCCTGG + Intergenic
1081793930 11:45806948-45806970 AGAGGCCTCAGCTGTCTTCCTGG + Intronic
1083341825 11:61963113-61963135 CTGGTCCCAAGAAGTCTTCCGGG - Exonic
1083756393 11:64793933-64793955 CCGGGCTCCAGATGTGGTCCTGG + Intronic
1083775458 11:64892498-64892520 CCAGGCCCCTGCTGTCTTCCAGG - Intergenic
1083932557 11:65853884-65853906 AGGAACCCCAGAAGTCTTCCAGG + Intronic
1083945415 11:65920250-65920272 AGGGGCCCCAGATGTCAGGCTGG - Intronic
1088576354 11:111275514-111275536 TGGGGAGCCAGATGCCTTCCAGG - Intronic
1090593099 11:128293176-128293198 TGGGGCCCCAGAAGTCCTCCAGG - Intergenic
1091051186 11:132374093-132374115 GGGGGCCTCAGAACTCTTCCTGG - Intergenic
1095498672 12:42812555-42812577 CTGGGCCCCAGATCACTTCTGGG + Intergenic
1102571007 12:113827000-113827022 CGGGGCCTGACATGTCCTCCAGG - Intronic
1114032037 14:18586620-18586642 CCTGGCACCAGATGTCTACCAGG + Intergenic
1122071830 14:99209947-99209969 GGGGGGCTCAGAGGTCTTCCTGG - Intronic
1128501742 15:68231442-68231464 CGGGGCCCCAGATTTAATTCTGG + Intronic
1128820398 15:70647110-70647132 CTGGGCTCCAAATGGCTTCCTGG - Intergenic
1130324671 15:82870334-82870356 TGGGGCCCCAGAAGTCTGCCAGG + Intronic
1131979532 15:97981482-97981504 CAGGCCCCCAGCTGTTTTCCAGG + Intergenic
1132674656 16:1116733-1116755 CCAGGCCCCAGAGGTCCTCCCGG + Intergenic
1133025866 16:2988727-2988749 CAGGGCCCTTGCTGTCTTCCGGG + Intergenic
1134598933 16:15518333-15518355 CAGGCCCCCAGATGTCTTGCTGG + Intronic
1135995448 16:27244465-27244487 TGGAGCCCCAGACATCTTCCAGG - Intronic
1139954898 16:70688430-70688452 CCAGGCCCCAGCTGGCTTCCTGG - Intronic
1140618895 16:76702920-76702942 CTTGCCCCCAGTTGTCTTCCTGG - Intergenic
1141680111 16:85538836-85538858 AGGAGCCCCAGAGGTCTTCCAGG - Intergenic
1145800061 17:27677013-27677035 CCAGGCCCCAGAAGTCTCCCTGG - Intergenic
1146524980 17:33559271-33559293 GGGGGCCCCAGATATCTTTGTGG - Intronic
1148480446 17:47956535-47956557 CTGGTCCCCACATGTCCTCCTGG - Intronic
1148549760 17:48543466-48543488 CAGGGTCGCAGATGTCCTCCAGG + Exonic
1150488851 17:65561136-65561158 CGGCGCACCAAATGTCCTCCGGG + Intronic
1153231980 18:2946891-2946913 CAGGGCTCCATATGTCTTACGGG - Intronic
1157385057 18:47253399-47253421 CGTGGCTCAAGATTTCTTCCTGG - Intergenic
1157918346 18:51691897-51691919 CGGGGCACTAGATGTCTTGCAGG - Intergenic
1159895205 18:73989671-73989693 CAGGGCCCCATCTGTCCTCCTGG + Intergenic
1162460474 19:10811358-10811380 CTGGGCCCCAGAGGGATTCCTGG + Intronic
1162489979 19:10986255-10986277 CGGGGCCCCAGATGTCTTCCGGG + Exonic
1162668897 19:12238017-12238039 GGAGAGCCCAGATGTCTTCCAGG + Intronic
1162935747 19:13980639-13980661 GGGGGCCCCGGCTGTCTTGCTGG + Exonic
1163354304 19:16799924-16799946 CGGGGGCCCCGACGCCTTCCAGG - Exonic
1164477241 19:28585214-28585236 AGGTGACCCAGATATCTTCCTGG - Intergenic
1164799918 19:31067890-31067912 TGGGGCCCCATCTGTGTTCCGGG - Intergenic
927090921 2:19711939-19711961 TGGGGCCCCTGATGTGATCCTGG + Intergenic
927251688 2:21000417-21000439 ACGGACCCCAGATGTCTCCCTGG - Intergenic
935022667 2:99246708-99246730 AGTGGCCCCAGAGGTCTTCATGG + Exonic
935543819 2:104379266-104379288 CTGGGCACGAGCTGTCTTCCAGG + Intergenic
935850723 2:107216122-107216144 AGGGGCCTCAGATGTCTGACTGG + Intergenic
937644470 2:124250712-124250734 CGAGGCCCCAGGTGTCTACCTGG + Intronic
938235078 2:129699413-129699435 GGGGGCCCCAGAGGTATTCAAGG - Intergenic
938491415 2:131763159-131763181 CCTGGCACCAGATGTCTACCAGG + Intronic
945040911 2:205743276-205743298 TGGGGCTCCAGAGGTATTCCTGG - Exonic
945484408 2:210378026-210378048 CAGGGCCCCTGATGTCGGCCTGG - Intergenic
946095820 2:217273395-217273417 CTGGGCCCCAGATGTGTCTCCGG - Intergenic
1168861863 20:1051536-1051558 CGAGGCCCAAGAGGGCTTCCTGG - Intergenic
1168877920 20:1184178-1184200 GGGAGCTCCAGATTTCTTCCAGG - Exonic
1168976450 20:1969650-1969672 CAAGGCCCCAAATGTCTTCCTGG + Intergenic
1169054780 20:2611554-2611576 GGGGGCCACAGAAGACTTCCGGG - Intronic
1169215118 20:3789080-3789102 CGGGGCCTCAGATGGATTGCTGG - Intronic
1172512929 20:35513149-35513171 TGGGGCCCCAGATCTGTTTCTGG - Exonic
1173459300 20:43230077-43230099 GGAGGCCCCAGAGGTCATCCAGG + Intergenic
1174054554 20:47788915-47788937 CGGGGCCCCTCATGTATCCCAGG - Intergenic
1175799325 20:61792162-61792184 CGGGGGCCCAGATGGCCTGCAGG + Intronic
1177112257 21:17042521-17042543 CTGAGCCCCAGTTCTCTTCCGGG - Intergenic
1179467171 21:41583583-41583605 CGGGGCCCCAGATAAATTACTGG + Intergenic
1180456150 22:15513677-15513699 CCTGGCACCAGATGTCTACCAGG + Intergenic
1182042457 22:27249080-27249102 ATGGGCCCCAGATGGCTTTCAGG + Intergenic
1184597996 22:45525873-45525895 CTCGGCCCCAGGTGTCCTCCGGG - Intronic
1184790452 22:46696554-46696576 ATGGGCCCCAGATGTCCTACCGG + Intronic
1185280240 22:49966787-49966809 CCGTGCCCCAGATGTCGACCAGG - Intergenic
950106109 3:10389851-10389873 CTGGGTCCCAGCTGTCCTCCTGG - Intronic
952152405 3:30607004-30607026 CGGGGCGCCGGGGGTCTTCCTGG + Intronic
952857262 3:37782583-37782605 TGGGGCCCCATCTGGCTTCCAGG - Intronic
953515513 3:43587325-43587347 CTGTGGCCCAGATCTCTTCCAGG - Intronic
954296516 3:49677353-49677375 CAGGGGCCCAGAGCTCTTCCTGG - Intronic
954972256 3:54661117-54661139 TGGGGCCTCAGAAGCCTTCCTGG - Intronic
956291965 3:67670068-67670090 CGGAGTCCCAGGTGTATTCCTGG + Intergenic
961714430 3:128848908-128848930 CGTGGCCCCAGAACTCTTCCTGG - Intergenic
961901104 3:130212829-130212851 CGAGGCCCCTGAGGTCTTCCTGG + Intergenic
963068680 3:141284223-141284245 CAGGGCCCCAGGTTTCTTCCAGG + Intronic
966944968 3:184771351-184771373 CGGGGCCCCAGACGCCCTCTGGG - Intergenic
969196486 4:5567446-5567468 CGGGCTCCCAGATGCCCTCCTGG + Intronic
980011895 4:127605099-127605121 AGGAGCCCCACCTGTCTTCCGGG + Intergenic
981815219 4:148823409-148823431 GGGGGCTACAGATGACTTCCAGG - Intergenic
985202790 4:187501911-187501933 GGCTGCCCCAGATGGCTTCCCGG - Intergenic
985731152 5:1549801-1549823 CTGGGCCTCAGATGACTTCAGGG - Intergenic
986707440 5:10463544-10463566 TGGGGTCCCTGAGGTCTTCCCGG + Intronic
986812775 5:11377711-11377733 GGTGGCCCAAAATGTCTTCCTGG - Intronic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
1001644876 5:173272919-173272941 TGGGGCCCTAGATGTCTTAGTGG - Intergenic
1002460252 5:179369712-179369734 TGGGGCCCCACATCTCTGCCAGG - Intergenic
1003551874 6:7107836-7107858 CGGCGCCCCAGCCGTCGTCCCGG - Exonic
1003962080 6:11218281-11218303 CAGGGCCCCAGATGGGTTGCAGG - Intronic
1006747936 6:36358009-36358031 TGGGTCCCCAGATGACTTCATGG + Intronic
1017941491 6:159057212-159057234 AGGGTCCTCAGATGTCTTTCTGG + Intergenic
1019421778 7:954196-954218 CGGGGACCCGGACGTCTTCCCGG - Intronic
1025280919 7:57626073-57626095 CTGGGCCCCAGATGAACTCCAGG + Intergenic
1028755226 7:94426465-94426487 AAGGGGCCCAGAGGTCTTCCTGG + Exonic
1029789818 7:102830516-102830538 AGGGGAACCAGATGTCTTTCTGG - Intronic
1032484602 7:132275938-132275960 CTGGCCACCAGATGTCTTCAAGG - Intronic
1034047134 7:147941234-147941256 CATGGCCCCAAATGCCTTCCAGG - Intronic
1035323581 7:158050612-158050634 CGGGGCCCGAGCTGTGCTCCTGG - Intronic
1035573674 8:690526-690548 CGGGGGCCTAGATGGCCTCCGGG + Intronic
1036166845 8:6443384-6443406 CTGTGCCCCAGGTGTCTTCAAGG - Intronic
1045254795 8:100510358-100510380 CCGGGCACCTGCTGTCTTCCTGG - Exonic
1049545418 8:143228533-143228555 CCGGGCTCCAGATGCCTTCGAGG - Intergenic
1049586466 8:143434760-143434782 GGGGGCCCACGATGACTTCCTGG - Intergenic
1052209083 9:25879557-25879579 AAGGGCCACAGATGTCTTTCAGG - Intergenic
1053645367 9:40116836-40116858 CTGGGGCACAGATTTCTTCCTGG + Intergenic
1053760347 9:41346691-41346713 CTGGGGCACAGATTTCTTCCTGG - Intergenic
1054539205 9:66259136-66259158 CTGGGGCACAGATTTCTTCCTGG - Intergenic
1054550825 9:66601052-66601074 AGGGACCCCAGATGTCTTTGAGG - Intergenic
1056632597 9:88306011-88306033 GGGGGCCCAAGATATTTTCCTGG - Intergenic
1057499634 9:95586253-95586275 CTGTGCCCCAGATGTCTGTCTGG - Intergenic
1059987693 9:119836029-119836051 CGAGGCCCCAGAGGTGTCCCAGG - Intergenic
1061852533 9:133424409-133424431 CGTGGGCCCCGATGTCTTCCAGG + Exonic
1062571543 9:137188092-137188114 CTGCACCCCAGGTGTCTTCCCGG - Exonic
1185931781 X:4211676-4211698 CGGGGTCACAGATATCCTCCTGG + Intergenic
1187507027 X:19886889-19886911 CGGGGCTGCTGGTGTCTTCCTGG - Intronic
1189336955 X:40176133-40176155 CGAGGCCACCAATGTCTTCCAGG + Intronic
1190250342 X:48718793-48718815 TGGGGCCCCTGATATCTTCGTGG - Intergenic
1194827314 X:98578857-98578879 GGGGGCCGCAGATGGCTACCTGG + Intergenic
1199435258 X:147805573-147805595 AGGAGCCCCAGTTGTCTTCAGGG - Intergenic
1200076785 X:153555179-153555201 GGGGCCCCCAGCTGTCTCCCTGG + Intronic
1200119789 X:153784827-153784849 CTGTGCTCCAGATGTCTGCCGGG - Exonic
1200138387 X:153885804-153885826 CGGGGCCCCAGATGCTGGCCTGG - Intronic