ID: 1162490946

View in Genome Browser
Species Human (GRCh38)
Location 19:10991289-10991311
Sequence TCGAGCAGGAGCGCAAGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162490943_1162490946 13 Left 1162490943 19:10991253-10991275 CCCGCATCACTGAGAAGCTGGAG 0: 1
1: 1
2: 1
3: 30
4: 260
Right 1162490946 19:10991289-10991311 TCGAGCAGGAGCGCAAGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 72
1162490941_1162490946 24 Left 1162490941 19:10991242-10991264 CCTGCGCGAGGCCCGCATCACTG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1162490946 19:10991289-10991311 TCGAGCAGGAGCGCAAGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 72
1162490944_1162490946 12 Left 1162490944 19:10991254-10991276 CCGCATCACTGAGAAGCTGGAGA 0: 1
1: 0
2: 0
3: 21
4: 311
Right 1162490946 19:10991289-10991311 TCGAGCAGGAGCGCAAGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 72
1162490940_1162490946 25 Left 1162490940 19:10991241-10991263 CCCTGCGCGAGGCCCGCATCACT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1162490946 19:10991289-10991311 TCGAGCAGGAGCGCAAGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 72
1162490939_1162490946 30 Left 1162490939 19:10991236-10991258 CCAGTCCCTGCGCGAGGCCCGCA 0: 1
1: 0
2: 2
3: 7
4: 104
Right 1162490946 19:10991289-10991311 TCGAGCAGGAGCGCAAGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162490946 Original CRISPR TCGAGCAGGAGCGCAAGCGC CGG Exonic
902897337 1:19487831-19487853 TCGAGCAGGAGCTGAAGGACAGG + Intergenic
919621138 1:199865794-199865816 CCGAGCAGCAGCTCAAGGGCTGG + Intergenic
919807537 1:201389249-201389271 AGGAACAGGAGCGCGAGCGCAGG - Exonic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1065119921 10:22518474-22518496 TCAAGCAAGAGAGCAAGCGAGGG + Intergenic
1077201518 11:1309743-1309765 GAGAGCAGGTGCGCAGGCGCCGG - Intergenic
1082188072 11:49208440-49208462 TAGAGCAGCAGCACAGGCGCGGG - Exonic
1088566994 11:111182992-111183014 AAGAGCAGGAGAGCAAGAGCAGG - Intergenic
1089359605 11:117876976-117876998 CCGAGGAGGCGTGCAAGCGCCGG + Exonic
1090238720 11:125166977-125166999 GAGAGCAGGAGGGCAAGGGCAGG - Intronic
1090657169 11:128854928-128854950 TCTAGCTGGAGCGCACGTGCAGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1103856294 12:123973045-123973067 GCGAGCGGGAGCGCGCGCGCCGG + Intronic
1111672372 13:91347799-91347821 TCGCGGAGGAGCGCGAGCCCCGG - Intergenic
1111980771 13:95013066-95013088 ACGAGAAGGAGCCCAAGCTCTGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116653745 14:47626588-47626610 TCGCGCTGGCCCGCAAGCGCCGG - Intronic
1122070014 14:99200239-99200261 TGGTGCAGGAGCACAGGCGCTGG + Intronic
1124151461 15:27182547-27182569 TAGACCAGGAGCGGAAGCCCAGG - Intronic
1133316104 16:4885046-4885068 TGGAGCAGGAGCGAAAGTACCGG - Exonic
1151745621 17:76010247-76010269 TGGAGGAGGAGGGCAAGCGGCGG - Exonic
1152912555 17:83013502-83013524 TCGGGCAGGGGGGCAAGGGCAGG - Intronic
1160993523 19:1871483-1871505 TCCTGCAGGAGCGCCAGCCCCGG - Intergenic
1162121163 19:8469805-8469827 TGGAGCAGCAGCTCAAGCTCAGG + Intronic
1162490946 19:10991289-10991311 TCGAGCAGGAGCGCAAGCGCCGG + Exonic
1162491452 19:10994973-10994995 TCGAGAAGGAGCGCATGCGGAGG + Exonic
1165886818 19:39084479-39084501 TGGAGCAGGCGGGAAAGCGCTGG + Intronic
927988231 2:27428687-27428709 CCGAGCTGGAGCTGAAGCGCAGG + Exonic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929949137 2:46393078-46393100 TCGAGCAAGACCGCCAGCGGGGG + Intergenic
930023692 2:47016798-47016820 TAGAGCAGAAGGGCAGGCGCTGG + Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
942468313 2:176232167-176232189 TCCAGCAGCAGAGTAAGCGCTGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1169081415 20:2799699-2799721 GAGAGGAGGAGCGCAAGCGGAGG - Intronic
1178924275 21:36761923-36761945 GCGAGCTGGAGCCCAAGTGCAGG - Intronic
1184057216 22:42060586-42060608 TCCAGCAGGTGCCCAAGCACGGG + Intronic
1184742039 22:46434257-46434279 TCCAGCAGGAGCTCAAGGGGTGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
962350599 3:134652963-134652985 TCCAGCAGGAGAGCAAGGGTTGG - Intronic
964156436 3:153590243-153590265 TAGAGCAGGAGAGCAAACACTGG - Intergenic
974069461 4:57110510-57110532 GCCAGCAGGAGCGCGCGCGCAGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
990382010 5:55227694-55227716 TCCTGCAGGAGCGCAAAGGCCGG - Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1001403748 5:171461507-171461529 TAGAGCAGGAGGGCAAGGGGTGG - Intergenic
1002521638 5:179795866-179795888 TGGGGCAGGGGCGCACGCGCTGG + Intronic
1010440892 6:75892591-75892613 TGGAGCAGGAGCGCAGGGACCGG + Exonic
1011981298 6:93382399-93382421 AGGAAAAGGAGCGCAAGCGCAGG + Intronic
1018626277 6:165781769-165781791 TGGAGCAGGACCACAAGCCCAGG + Intronic
1019387740 7:767903-767925 GCAAGCAGGAGCGCTAGTGCTGG + Intronic
1019387855 7:768547-768569 GCAAGCAGGAGCGCTAGTGCTGG + Intronic
1019387868 7:768612-768634 TCGAGCAGGAGCGCTCATGCTGG + Intronic
1025926790 7:65967003-65967025 AAGAGCAGGAGAGCAAGCGAGGG + Intronic
1026806822 7:73434090-73434112 TCGACCCGGAGCGCGGGCGCGGG + Exonic
1027224469 7:76235230-76235252 TGGACCACGAGCGCAAGCGGCGG + Exonic
1029105449 7:98171566-98171588 GCGAGCAGGAGCACATGCGGGGG + Exonic
1032517654 7:132518939-132518961 TCGAGCAGGAGCTCCAGCCGAGG + Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035341294 7:158164237-158164259 CAGAGCAGGAGCGCACGCGTAGG + Intronic
1036599864 8:10250633-10250655 TCGAGCAGGAGCCCAGGTGTGGG + Intronic
1045047595 8:98294150-98294172 CCGAGCCGGAGCCCGAGCGCCGG - Exonic
1048627695 8:136204173-136204195 TCGAGCTGGAGTGCAATGGCAGG + Intergenic
1060289752 9:122290620-122290642 TCTAGGAGGAGCTCAAGTGCAGG + Intronic
1061887064 9:133596481-133596503 TCAAGCAGGAGGGCAAGCCTGGG - Intergenic
1186608010 X:11111511-11111533 TGGAGCAGGTGGGCAAGCGCCGG + Intronic
1199615386 X:149651653-149651675 TTGAGCAGGAGCGAAAGGGCTGG - Intergenic
1201238355 Y:11933458-11933480 TCAAGCAGTAATGCAAGCGCTGG + Intergenic
1202272692 Y:23086092-23086114 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202293334 Y:23334590-23334612 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic
1202425689 Y:24719836-24719858 TCAAGCGGGCCCGCAAGCGCCGG + Intergenic
1202445100 Y:24950249-24950271 TCAAGCGGGCCCGCAAGCGCCGG - Intergenic