ID: 1162492434

View in Genome Browser
Species Human (GRCh38)
Location 19:11001355-11001377
Sequence GCTGATTGGGAGCCAGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30103
Summary {0: 1, 1: 0, 2: 21, 3: 1598, 4: 28483}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162492422_1162492434 28 Left 1162492422 19:11001304-11001326 CCAAAAAATAAAATAATTACCTG 0: 1
1: 3
2: 80
3: 1251
4: 2598
Right 1162492434 19:11001355-11001377 GCTGATTGGGAGCCAGAGGTAGG 0: 1
1: 0
2: 21
3: 1598
4: 28483
1162492427_1162492434 9 Left 1162492427 19:11001323-11001345 CCTGGGCATGGTGGTGTGCACTT 0: 2
1: 31
2: 184
3: 661
4: 1506
Right 1162492434 19:11001355-11001377 GCTGATTGGGAGCCAGAGGTAGG 0: 1
1: 0
2: 21
3: 1598
4: 28483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162492434 Original CRISPR GCTGATTGGGAGCCAGAGGT AGG Intronic
Too many off-targets to display for this crispr