ID: 1162495783

View in Genome Browser
Species Human (GRCh38)
Location 19:11022677-11022699
Sequence GCCCTGGACCTGTCTAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162495783_1162495790 -6 Left 1162495783 19:11022677-11022699 CCCACCTTAGACAGGTCCAGGGC 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1162495790 19:11022694-11022716 CAGGGCAGCTGGGGCCTTCCTGG 0: 2
1: 1
2: 4
3: 86
4: 556
1162495783_1162495794 23 Left 1162495783 19:11022677-11022699 CCCACCTTAGACAGGTCCAGGGC 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1162495794 19:11022723-11022745 GCGTGAGTTCCCTGCCCTCTCGG 0: 1
1: 0
2: 1
3: 17
4: 173
1162495783_1162495795 30 Left 1162495783 19:11022677-11022699 CCCACCTTAGACAGGTCCAGGGC 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1162495795 19:11022730-11022752 TTCCCTGCCCTCTCGGCTGCTGG 0: 1
1: 0
2: 1
3: 30
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162495783 Original CRISPR GCCCTGGACCTGTCTAAGGT GGG (reversed) Intronic
902242291 1:15096982-15097004 GCCCTGGGGGTGTCTAAGGGTGG - Intronic
903215970 1:21843430-21843452 GCCGTGGACCTGGCCAAGGTGGG + Exonic
904265558 1:29316795-29316817 TCCCTGGACCAGTCACAGGTTGG + Intronic
905305588 1:37015660-37015682 ACCCTGTTCCTGTCTAGGGTGGG + Intronic
906058084 1:42931283-42931305 GCCCTGGCCCTCTCTTAGGGAGG - Intronic
906825116 1:48971116-48971138 GCCCAGTACCTGTCCAAGGCTGG - Intronic
911409776 1:97488656-97488678 GCCCTGGCCCTGTTTTAGCTAGG - Intronic
915601919 1:156927799-156927821 GCCCTGAAGCTGGCTGAGGTGGG + Exonic
915971498 1:160358363-160358385 TCCCTGGGCCTGTCTCAGATTGG + Exonic
919567766 1:199210011-199210033 CACCTGGACCTGTCAGAGGTGGG - Intergenic
919758462 1:201081149-201081171 GCCCTGGACCTGCATGAGGTGGG - Intronic
920190681 1:204191761-204191783 GCCCAGGGCCTGGCTGAGGTAGG + Intronic
922749859 1:228065235-228065257 GTCCTCGGCCTGTCCAAGGTTGG + Intergenic
923048396 1:230372324-230372346 GCAACTGACCTGTCTAAGGTGGG - Intronic
923365680 1:233258546-233258568 ACCCTGGACCTGCCTGAGGGTGG - Exonic
1063615572 10:7597211-7597233 GCCTTTGTCCTTTCTAAGGTGGG + Intronic
1063679060 10:8169663-8169685 GGCCAGGACCTGCCCAAGGTGGG - Intergenic
1064816147 10:19264874-19264896 GCCCTGGACTTTTCTTTGGTGGG + Intronic
1070043811 10:72810072-72810094 GAACTAGACATGTCTAAGGTTGG + Intronic
1071224498 10:83512614-83512636 CCCCTGGCCCTGCCTGAGGTGGG - Intergenic
1072662993 10:97373873-97373895 GCCATGGACCTGGCTCAGGCAGG - Exonic
1074093931 10:110291222-110291244 GGCCTGGATAAGTCTAAGGTTGG + Exonic
1075644265 10:124087261-124087283 GCCCTGGATCTATCTCAGGGAGG - Intronic
1077036179 11:495592-495614 GCACTGGACCTCTCCAAGGTGGG + Intronic
1077095289 11:796523-796545 GGCCTGGATCTGTCTAGGGCTGG + Intronic
1079535633 11:21511979-21512001 GCCCTGGATCTGACTCAAGTAGG - Intronic
1084219251 11:67667468-67667490 GCCCAGGACCTGCATAAGGTGGG - Exonic
1084268162 11:68015442-68015464 GCCCAGGACCTGCACAAGGTGGG + Exonic
1084690386 11:70721749-70721771 ACACTGCACCTGTCTAGGGTTGG - Intronic
1085036651 11:73304896-73304918 GTTCTGGGCCTGTTTAAGGTGGG - Intergenic
1089253938 11:117183890-117183912 GCCCTGGGCCTGGCTAGGGATGG + Intronic
1095907181 12:47390374-47390396 GCCTGTGACCTATCTAAGGTTGG - Intergenic
1096595784 12:52694621-52694643 GCCCTGTACCAGACCAAGGTGGG - Exonic
1096606744 12:52772089-52772111 GCCCTGTACCAGACCAAGGTGGG - Exonic
1096609614 12:52792234-52792256 GCCCTGTACCAGACCAAGGTGGG - Exonic
1096612061 12:52808681-52808703 GCCCTGTACCAGACCAAGGTGGG - Exonic
1098770121 12:74540925-74540947 GCCCTGGATGGGTATAAGGTGGG + Exonic
1102933594 12:116879901-116879923 GCCCTAGACCCATCTATGGTGGG + Intronic
1103447490 12:121003795-121003817 TCCCTAGAACTGTCTGAGGTGGG - Intronic
1104914154 12:132256184-132256206 GCCCTGGAACTGTCCCAGGCAGG + Intronic
1106638219 13:31553942-31553964 GTTCTGAACATGTCTAAGGTAGG - Intergenic
1111058801 13:82984615-82984637 GTTCTGGACCTGCCTAAGCTTGG + Intergenic
1111833636 13:93360362-93360384 GCCCTGGACATCTCTCAGGGAGG - Intronic
1115541047 14:34421724-34421746 GCCCAGGACCTTTAGAAGGTGGG + Intronic
1120885440 14:89448358-89448380 GCCCAGGATCTGCATAAGGTGGG + Intronic
1122884167 14:104703203-104703225 GCCCTGGACCACTACAAGGTGGG + Exonic
1125713656 15:41806520-41806542 GGCCTGGACCTGTGTAGGGAAGG + Intronic
1129001880 15:72342193-72342215 GCCCTGGACTTGGCTAGGCTGGG + Exonic
1129701007 15:77768741-77768763 GCCCTGGGCCTGTCAGAGGACGG + Intronic
1132488455 16:210607-210629 TCCCTGAATCTGTCTCAGGTTGG - Intronic
1132884478 16:2176611-2176633 GCCCTGGACCTTTCTGAGCCAGG + Exonic
1133076368 16:3283741-3283763 GCCCTGAACCCATGTAAGGTTGG - Exonic
1133318675 16:4899518-4899540 GGCCTGGACGTGGCTAAGCTGGG - Intronic
1138492443 16:57384284-57384306 TCCCTGGTCCTGTCTGCGGTGGG - Exonic
1138743328 16:59335429-59335451 GCTCTGGAACTGTCAAACGTGGG - Intergenic
1149360468 17:55889660-55889682 AAACTAGACCTGTCTAAGGTAGG + Intergenic
1151262869 17:72930438-72930460 GCCGTAGACCTGTCTCAGGCTGG - Intronic
1153446670 18:5180404-5180426 GACCTGCCCCTGTCTAAGGCAGG + Intronic
1154415607 18:14173895-14173917 GCCCTGGACCTGCCTGACGCTGG - Intergenic
1157225946 18:45864991-45865013 GCCCAGGGCCTGCCTAAGATGGG - Intronic
1161684509 19:5696244-5696266 CCCGTGGACTTGTCCAAGGTGGG - Exonic
1161957390 19:7504169-7504191 GGCCTGGAACTGTCTTTGGTAGG - Exonic
1162495783 19:11022677-11022699 GCCCTGGACCTGTCTAAGGTGGG - Intronic
1164227886 19:23261875-23261897 ACCCTGGACCTGTCTACAGAGGG - Intergenic
1164484520 19:28643408-28643430 CCCCTGCTCCTGTCTAACGTAGG - Intergenic
1164776287 19:30856116-30856138 ACCTTTGACCTGTCTGAGGTGGG + Intergenic
925277522 2:2661030-2661052 GTCCTGGACCAGGATAAGGTGGG + Intergenic
926136694 2:10341639-10341661 GCCGTGGGCCTTTCTAAAGTGGG + Intronic
926337168 2:11872534-11872556 TCCCAGGACCTGTCCAAGGCTGG + Intergenic
932845616 2:75133046-75133068 GCCTAGGACCTGCCCAAGGTGGG - Intronic
939018286 2:136927301-136927323 GAGCTGGACCTGCCTCAGGTGGG + Intronic
1169568480 20:6881563-6881585 GCCATGGACCAGGCTAAGGATGG + Intergenic
1172228028 20:33318182-33318204 GGGCTGGACCTGTCGCAGGTCGG + Intergenic
1172906906 20:38377216-38377238 GCCCTTGTCCTGTCTCAGGCAGG + Intergenic
1173503197 20:43568075-43568097 CCCATGGACCTGTCAGAGGTGGG - Intronic
1173604906 20:44324907-44324929 GGCCATGACCTGTCTAAGATAGG - Intergenic
1173998709 20:47358849-47358871 GCCCTGGAGCTTTGTCAGGTTGG - Intergenic
1174851175 20:53996699-53996721 GCCCTGGCCTTGTCTCTGGTTGG + Intronic
1175060092 20:56234037-56234059 GCTCTGGAGCTGTCCAAAGTTGG + Intergenic
1179083018 21:38191169-38191191 GCCCTGGCCCTGTCTCTGATGGG + Intronic
1180247089 21:46555373-46555395 GCCGTGGACCTGTCTCAGCCTGG + Intronic
1180899312 22:19359253-19359275 GGCCTGGGCCTGTCTAGGGGAGG - Intronic
1181297997 22:21857395-21857417 GCTCTGAACATGTTTAAGGTAGG - Intronic
1182563215 22:31178129-31178151 GCCCTGGACATCTCAAAGTTAGG + Intronic
1184769956 22:46591115-46591137 GCCCTGGAATGGCCTAAGGTGGG + Intronic
1185341951 22:50294929-50294951 GCCCTGGAGGTGTCTGAGGAAGG - Intronic
953024014 3:39134538-39134560 CTCCTGGGCCAGTCTAAGGTGGG + Intronic
954453663 3:50585475-50585497 GCCCTGTCCCTGTCCAAGCTGGG + Intergenic
961034189 3:123630960-123630982 GCACAGGGCCTGTCTAAGGGTGG - Intronic
969470078 4:7382429-7382451 GCCCTGGGGCTGTCTCAGGAGGG - Intronic
975069736 4:70119062-70119084 AACCTGGACCTGCCTAAAGTAGG - Intergenic
975069776 4:70119401-70119423 AACCTGGACCTGCCTAAAGTAGG - Intergenic
976073305 4:81267410-81267432 GTCCTGGACCTTTCTATGATGGG + Intergenic
977179463 4:93856714-93856736 GCCTTGCTCCTGTCTCAGGTGGG - Intergenic
979410219 4:120368339-120368361 GTCCTGAACATGTTTAAGGTAGG - Intergenic
987414592 5:17649514-17649536 GCCCTGGACATGTGTGAGATGGG + Intergenic
999178619 5:149652494-149652516 AGCCTGGACAAGTCTAAGGTGGG + Intergenic
1000359259 5:160432541-160432563 GACCAGGAACTGTCTAGGGTAGG - Intergenic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1007695954 6:43734356-43734378 CCCCAGGACCTGGCTAAGGCAGG + Intergenic
1009970800 6:70623847-70623869 GCCCAGGACCTACCCAAGGTGGG + Intergenic
1012169612 6:96002225-96002247 GCCCTGGAGCTGTCACAGCTTGG - Intergenic
1012442659 6:99275978-99276000 TCCCTGGACCTGTTAAAGATGGG + Exonic
1013289326 6:108707128-108707150 GCCCTAGACTTGTGAAAGGTAGG - Intergenic
1016434507 6:144022026-144022048 GCCCTGCAACTGCCTGAGGTAGG - Intronic
1019732731 7:2636789-2636811 GCCCTGGACCTGCTTGGGGTGGG + Intronic
1022361098 7:29658630-29658652 TCCCTAAACCTCTCTAAGGTTGG - Intergenic
1024007643 7:45238989-45239011 TGCCAGGACCTGTCTCAGGTCGG + Intergenic
1031127465 7:117791286-117791308 GCCCTGGCCACGTCTCAGGTGGG - Exonic
1036697585 8:10987983-10988005 GCCCTGGGCCTGTCCAAAGTAGG - Intronic
1052285101 9:26776026-26776048 TCCCTGGAGCTGTCTAAGCTTGG + Intergenic
1056760970 9:89414765-89414787 GCCCTGGACCTGTGTTGGGCCGG + Intronic
1059877077 9:118646939-118646961 GCTCTGGACCTGTCATGGGTGGG - Intergenic
1061615295 9:131775103-131775125 GACCTGGCCCTGCCTCAGGTGGG - Intergenic
1187391714 X:18890611-18890633 TCCCTGGGCCTGTGGAAGGTAGG + Intergenic
1188093614 X:25994240-25994262 GTTCTGGACATGTTTAAGGTCGG + Intergenic
1189446470 X:41085572-41085594 GCCCGGGAGCTGTGTAAGGCGGG - Intergenic
1198030272 X:132747728-132747750 GCCCTGTGCCTGTCTAACCTTGG - Intronic
1198498298 X:137215886-137215908 CCCCTTGGCCTGGCTAAGGTTGG + Intergenic