ID: 1162496481

View in Genome Browser
Species Human (GRCh38)
Location 19:11025980-11026002
Sequence CCTGCTGCCCCGAGAGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 574
Summary {0: 1, 1: 2, 2: 3, 3: 53, 4: 515}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162496481 Original CRISPR CCTGCTGCCCCGAGAGCCCC TGG Intronic
900130603 1:1085581-1085603 CGTGATGCCCTGAGGGCCCCGGG + Intronic
900184125 1:1325028-1325050 CCTGCTCCACCGAGAGGCCCAGG - Exonic
900191664 1:1354710-1354732 GCCGTTGCCCGGAGAGCCCCGGG + Exonic
900203230 1:1420504-1420526 CCTGCTGCAGCGAGGGGCCCCGG - Exonic
900255070 1:1693575-1693597 CCTGCGGCCCCGAGGACCCCCGG + Intronic
900263813 1:1746841-1746863 CCTGCGGCCCCGAGGACCCCCGG + Intergenic
900491359 1:2950737-2950759 CCTGGGGCCCCGACAGTCCCTGG - Intergenic
900820014 1:4879397-4879419 CCTGTTGCCCCGAGAGTACCGGG - Intergenic
901046986 1:6402812-6402834 CCTGCAGCCCCCAGGACCCCAGG - Intergenic
901051740 1:6428910-6428932 CCTCCTGGCCCCAGAGCCCCTGG + Intronic
901258873 1:7856592-7856614 CCTGCTGGCAGGAGAGCCCAGGG + Intergenic
901405114 1:9040107-9040129 CCTTCTTCCCCGAGAGCCCCAGG - Exonic
901610651 1:10495300-10495322 TGTGCTGCCTCGAGAGCCGCTGG + Exonic
901860675 1:12072517-12072539 TCTGCTGCCTCCAGAGCCCTGGG - Intronic
902174182 1:14637048-14637070 CAGGCTGCCCAGAGAGCCCAGGG + Intronic
902482584 1:16719451-16719473 CCTCCTGACCCCAGAGCCCCTGG - Intergenic
902580034 1:17402404-17402426 CCTGCTGCCCACAGAGCCCCAGG - Intergenic
902607735 1:17578165-17578187 TCTGCTGCCCCAAGAGTTCCAGG - Intronic
902686158 1:18079101-18079123 CCTGCTGCCTGAAGAGCGCCTGG - Intergenic
902940986 1:19799976-19799998 CCGCCTGCCCCGAGCGCGCCTGG + Intergenic
903044177 1:20553359-20553381 CCTGCGGCCCCCCGAACCCCCGG - Exonic
903809736 1:26028655-26028677 ACTGCTGCCCAGAGGTCCCCTGG - Intronic
904068411 1:27773340-27773362 GCTGGGGCCCCGAGGGCCCCGGG - Exonic
904499189 1:30904399-30904421 CCTGCTGCCCCGGACCCCCCAGG + Intronic
905011546 1:34750530-34750552 CCAGAAGCCCAGAGAGCCCCAGG + Intronic
906297785 1:44659634-44659656 CCTGCTGCCCGCAGAGGCACTGG + Intronic
906466170 1:46081648-46081670 ACTGCTGCCCTGAGAGGTCCTGG + Intronic
907265485 1:53257389-53257411 CCTGCCACCACAAGAGCCCCCGG - Exonic
908242291 1:62197575-62197597 CCTGCTGCCCCGAAAGGTGCTGG + Intronic
908247337 1:62238267-62238289 TCTGCAGCCCCTACAGCCCCAGG + Exonic
910289750 1:85588629-85588651 CCTGCTGACTAAAGAGCCCCCGG + Intergenic
910423929 1:87100398-87100420 CCTGCTGCCCTGAGAAGCCTTGG - Intronic
911088667 1:94000730-94000752 CCTGCTGCTCCGTCATCCCCTGG - Intronic
911367702 1:96959149-96959171 CCTGCTGGACTGTGAGCCCCTGG - Intergenic
911858661 1:102915638-102915660 CCTGCTTCCCCAGGAGGCCCTGG + Exonic
912135935 1:106660072-106660094 CCTGCTGACTGTAGAGCCCCAGG + Intergenic
912906545 1:113714079-113714101 CCTGCTGACCAAAGAGCCCTTGG + Intronic
916507289 1:165439573-165439595 CCTTCTGCCCCCAGAGGCTCAGG - Intronic
918814678 1:189167768-189167790 CCTGAAGGCCTGAGAGCCCCTGG - Intergenic
919501676 1:198345216-198345238 CCTGCTGCCCAGAGACCACTGGG + Intergenic
920007678 1:202845248-202845270 CAGGCTGCCCAGAGTGCCCCAGG + Intergenic
922210216 1:223480669-223480691 CCTGCTGCACAGAGCGCCCTTGG + Intergenic
922505266 1:226122269-226122291 CCGGCGGCCCCGAGAGGCCGGGG - Intergenic
922586140 1:226736432-226736454 CCTGCAGCCCCCAGAGGCCCTGG - Exonic
922776020 1:228214533-228214555 CCTGCTGTACCGAGGGCCGCCGG + Intronic
923235122 1:232025552-232025574 GCTGCTATCCCTAGAGCCCCTGG - Intronic
923825395 1:237494275-237494297 GCTGAAGGCCCGAGAGCCCCTGG + Intronic
924754777 1:246931455-246931477 GCTTCTGCCCCGCGAGCGCCGGG - Intronic
924784861 1:247185242-247185264 CAGGCTCCCCAGAGAGCCCCTGG - Intergenic
924934501 1:248756663-248756685 GCTGATGGCCTGAGAGCCCCTGG + Intergenic
1062944589 10:1450758-1450780 CCTGCAGCCCCCAAAGCCCCAGG - Intronic
1067153281 10:43753604-43753626 TCTGCTGCCCCAGGAGGCCCTGG - Intergenic
1067324469 10:45253801-45253823 CCTGCTGACTAAAGAGCCCCTGG + Intergenic
1067427294 10:46219915-46219937 CCTGCTGTCCCCTGGGCCCCAGG + Intergenic
1067582727 10:47455800-47455822 CCTGCTGTCCCCTGGGCCCCAGG + Intergenic
1069168898 10:65200219-65200241 ACTGAAGGCCCGAGAGCCCCTGG - Intergenic
1069526850 10:69180197-69180219 CCTGCTGTCCAGAAAGACCCAGG - Intergenic
1069557246 10:69406499-69406521 CCAGCTGCCCTGAAAGTCCCTGG + Intronic
1070509340 10:77146342-77146364 CCTGATGCACTGAGAGACCCTGG + Intronic
1070587831 10:77779952-77779974 CTTCCTGCCCCCAGACCCCCAGG - Intergenic
1070797342 10:79224426-79224448 TCTGGTTCCCCGAGAGCTCCAGG + Intronic
1071652164 10:87401916-87401938 GCTGAAGGCCCGAGAGCCCCTGG - Intergenic
1071966561 10:90857990-90858012 TCGGCTGCGCCGAGAGCGCCCGG + Intergenic
1071977515 10:90969719-90969741 CCTGGTGCTGCCAGAGCCCCCGG + Intergenic
1072225722 10:93367162-93367184 CCTGCTTCCCAGAGAGGCCTTGG - Intronic
1072679868 10:97498875-97498897 CCTGGTGCCCCGAGCGAGCCGGG + Exonic
1072718083 10:97764892-97764914 TGTGCTGCCCCAAGAGCACCTGG - Intergenic
1072986991 10:100149574-100149596 CCTGCTGGCCCAAGATCACCAGG + Intergenic
1073083203 10:100872749-100872771 CCTGCTGGCTGGAGACCCCCAGG + Intergenic
1073427977 10:103467670-103467692 AGTGCTGCCCAGAGAGGCCCGGG + Intergenic
1074377695 10:112952424-112952446 CCTGCTGCCCTGCGCGGCCCGGG - Intronic
1075013517 10:118894340-118894362 ACTGCTGCTCCTAAAGCCCCTGG + Intergenic
1075195024 10:120348762-120348784 CCTGCTGACTGTAGAGCCCCAGG + Intergenic
1075217173 10:120546054-120546076 GCTGTAGGCCCGAGAGCCCCTGG - Intronic
1075782396 10:125026033-125026055 CCTGCTCCCCCCAGGTCCCCAGG + Intronic
1075801744 10:125159084-125159106 CGCGCTGCCCCCAGCGCCCCGGG - Intronic
1076209036 10:128625923-128625945 CCTGCTGCAGAGAGACCCCCAGG - Intergenic
1076221201 10:128734487-128734509 CCTGCCACCCCGGCAGCCCCAGG + Intergenic
1076226856 10:128783812-128783834 CCTGATCCCCCGAAAGGCCCTGG + Intergenic
1076402693 10:130194205-130194227 CCTGCTGCCCTGCAGGCCCCTGG + Intergenic
1076694186 10:132239236-132239258 CCGGCTGGACCGAGGGCCCCAGG - Intronic
1076731780 10:132442825-132442847 CCTGCCTCCCCGAGGTCCCCGGG + Intergenic
1076735093 10:132455460-132455482 CCGGCTGCCCCGAGTGGCCGAGG + Intergenic
1077140829 11:1024137-1024159 CCTGATGCCCCGCCATCCCCCGG - Intronic
1077350931 11:2092884-2092906 CCAGCTGCCCAGGGAGCTCCTGG + Intergenic
1077371108 11:2182032-2182054 CCTGTGGCCCCCAGGGCCCCAGG - Intergenic
1077383820 11:2259784-2259806 CCTGCTGCCCCCAGAAGACCAGG + Intergenic
1077420871 11:2449290-2449312 CCTCCTGCCCCCAGTACCCCAGG - Intronic
1079792004 11:24749805-24749827 GCTGATGGCCTGAGAGCCCCTGG - Intronic
1080580970 11:33643353-33643375 CCCACTGCCCCAAGAGCCCTGGG - Intronic
1081057728 11:38431326-38431348 CCTGAAGGCCTGAGAGCCCCTGG - Intergenic
1081073739 11:38642556-38642578 CCTGCTGACTAGAGAGCCCTTGG - Intergenic
1081555495 11:44157258-44157280 CCTGCTGACTGAAGAGCCCCTGG - Intronic
1081932111 11:46878779-46878801 CCTGCTGCTTCTAGAGGCCCAGG - Intronic
1083172405 11:60930739-60930761 CATGCTGCCTCTAGATCCCCAGG + Intronic
1083254760 11:61489306-61489328 CCTGGTGCGCGCAGAGCCCCGGG + Intronic
1083256200 11:61496773-61496795 CCTGCTCATCCGAGACCCCCAGG - Intergenic
1083744375 11:64727048-64727070 CCTCCTGCCCCGACACCCCCAGG + Exonic
1084526983 11:69703885-69703907 GGAGCTGCGCCGAGAGCCCCAGG - Exonic
1084572721 11:69969223-69969245 CCTGCTGTCCCCAAAGCCCCAGG + Intergenic
1085294204 11:75421516-75421538 GTTGCTGCCCCTAGAGCCCCAGG + Intronic
1086312511 11:85550331-85550353 CCTGCAGCTCCCAAAGCCCCAGG - Intronic
1086821912 11:91445703-91445725 GCTACTGGCCTGAGAGCCCCAGG - Intergenic
1088356046 11:108944802-108944824 CCTGCTGATCCGACAGCCCAGGG + Intergenic
1090268641 11:125370646-125370668 CCTCCTGGCCCGGCAGCCCCAGG + Intronic
1090645148 11:128761156-128761178 GCTGCTGCTCCTAGACCCCCAGG + Intronic
1090736871 11:129618111-129618133 CCTGCTCCACCGCAAGCCCCTGG + Intergenic
1092524227 12:9299639-9299661 CCTGCTGCCTGGAGACCCCAAGG - Intergenic
1092543036 12:9432173-9432195 CCTGCTGCCTGGAGACCCCAAGG + Intergenic
1094169829 12:27480044-27480066 GCTGCAGGCCCAAGAGCCCCTGG + Intronic
1094509981 12:31090265-31090287 CCTGCTGCCTGGAGACCCCAAGG - Intronic
1096518579 12:52171629-52171651 CCTCTTGCCCCGAGAACCCATGG - Intronic
1096647744 12:53047627-53047649 CGTGCGGCCCCGTGCGCCCCGGG - Intronic
1096658019 12:53103761-53103783 CCTGCTGTCCAGAGAGGCCAAGG + Intronic
1096801330 12:54112554-54112576 CTGGCTGCCCCTGGAGCCCCAGG - Intergenic
1098667254 12:73179917-73179939 CCTACTGACTTGAGAGCCCCAGG - Intergenic
1102108689 12:110347908-110347930 CCTGATGCCCTGTGAGCACCGGG + Intronic
1102200594 12:111055374-111055396 GCTGCTGGCCCGAGGGTCCCAGG - Intronic
1102346823 12:112166127-112166149 TGTGCTGCACCCAGAGCCCCAGG + Intronic
1102518793 12:113466560-113466582 CCTCCAGCCCCGAGACCCCTGGG - Intronic
1103509772 12:121466753-121466775 CCGGCTGCCCCGGGAGCACCCGG - Intronic
1103623136 12:122200847-122200869 CCTGCTCGCCGGGGAGCCCCTGG + Exonic
1103972676 12:124681913-124681935 CCTGCTCCCTCCAAAGCCCCTGG + Intergenic
1104035012 12:125092033-125092055 CCAGCTGCCCAGAGTGGCCCAGG + Intronic
1104584496 12:130037148-130037170 TCTGCGGCCCAGAGAGCACCCGG + Intergenic
1104714021 12:131004958-131004980 CCTGCTTGCCCGAGGTCCCCAGG - Intronic
1104783770 12:131437115-131437137 CCTGCTGTCTCCAGAGTCCCTGG + Intergenic
1104858274 12:131912015-131912037 CTTGCTGCCACCAGAGTCCCGGG - Exonic
1104895925 12:132163565-132163587 CCTGCAGCCCCTATACCCCCTGG - Intergenic
1105454224 13:20525712-20525734 GCTGCTGCCCCTGGAGCCCGGGG - Intronic
1105454433 13:20527013-20527035 TCTGCTGCCCCCATAGCCTCCGG - Intergenic
1105605169 13:21920927-21920949 CCGGCTGCCCCGCCGGCCCCAGG - Intergenic
1105766415 13:23564515-23564537 CCTCCTTCCCCTAGAGCCCCTGG - Intergenic
1105964552 13:25372402-25372424 CCTGCAGCCCAGAGAGCCCAGGG - Intronic
1106099737 13:26683833-26683855 TGGGCTGCCCAGAGAGCCCCTGG + Intronic
1106200531 13:27533181-27533203 CCTCCTGCACCGGGAGCCACCGG + Intergenic
1107337767 13:39373605-39373627 CCAGCTGCCTTGAGAGCCGCAGG + Intronic
1108676099 13:52739219-52739241 CCTGCGGCCCCCAGCGCACCCGG + Intronic
1111957984 13:94779177-94779199 GCTGAAGTCCCGAGAGCCCCTGG - Intergenic
1112658144 13:101474539-101474561 CCTGCTGACTGAAGAGCCCCTGG + Intronic
1113025751 13:105939022-105939044 CCCAGTGCCCAGAGAGCCCCAGG - Intergenic
1113090392 13:106611978-106612000 GCTGAAGGCCCGAGAGCCCCTGG - Intergenic
1113615158 13:111675334-111675356 CCTGCTCCCTCGGAAGCCCCTGG + Intergenic
1113620625 13:111760247-111760269 CCTGCTCCCTCGGAAGCCCCTGG + Intergenic
1113711335 13:112467280-112467302 CCTCCTCCCCCAGGAGCCCCAGG + Intergenic
1115381533 14:32745695-32745717 CCTGCTGCCTGTAGAGCCCCAGG - Intronic
1115849991 14:37583749-37583771 CCTTCTGCCCAGCGCGCCCCGGG + Intergenic
1115956089 14:38781031-38781053 GCTGAAGACCCGAGAGCCCCTGG - Intergenic
1116241728 14:42352182-42352204 GCTGCAGGCCCAAGAGCCCCTGG - Intergenic
1116426513 14:44798691-44798713 CCGGCCGCCCCGCCAGCCCCGGG + Intergenic
1117156926 14:52950943-52950965 CCTGTTGCCGCGCGAGTCCCGGG - Exonic
1117776400 14:59188893-59188915 CCTACTGGCCCGGGAGCTCCGGG - Intronic
1118469418 14:66061290-66061312 TCTGCTGCCCTCAGAGCTCCTGG - Intergenic
1119228995 14:72965459-72965481 CGTGGTGTCCCGAGAGCACCAGG - Intergenic
1119437822 14:74609661-74609683 CATGCTGCCCACAGAGCCCCAGG + Intronic
1119651525 14:76387299-76387321 CCTGATGCCCTCACAGCCCCGGG + Intronic
1121308048 14:92919251-92919273 CAGGCTGACCCTAGAGCCCCGGG + Intergenic
1121667936 14:95686607-95686629 TCTGCTGCCCTGGGAGGCCCTGG - Exonic
1122129851 14:99598637-99598659 CCTGCTGCCCAGAGAGTTCCAGG - Intronic
1122137861 14:99645135-99645157 CCTGCCGCCGCGAGCGCCCCGGG + Exonic
1122208211 14:100159066-100159088 CCTGCTGCGCTCAGAGCCCCTGG - Intronic
1123018959 14:105388666-105388688 CCTGTTGCCCCTGGAGCGCCGGG - Intronic
1123203572 14:106691573-106691595 CCTGCTGTCCTGAGTGTCCCTGG + Intergenic
1124118057 15:26866509-26866531 CCTGCAGCCCCCAGGGCTCCTGG + Exonic
1126066916 15:44832882-44832904 CCAGGTGCCCAGATAGCCCCAGG + Intergenic
1126087520 15:45023492-45023514 CCTGCTGCCCCCACACCCCGAGG - Intronic
1126092917 15:45067666-45067688 CCTGGTGCCCAGATAGCCCCAGG - Intronic
1126392869 15:48178159-48178181 CCTGCAGCCCGCAGAGCCGCCGG - Exonic
1126959758 15:53978389-53978411 CCTCCTCCACCGAGAGCGCCCGG - Intergenic
1128548848 15:68584809-68584831 CCAGCTGCCCCAAGCTCCCCAGG - Intronic
1128757755 15:70195020-70195042 CCTGCTTCCCTGAGAGCTGCTGG + Intergenic
1128760000 15:70210144-70210166 CCTGCTGCACTGAAAGCCCTGGG - Intergenic
1129030646 15:72615399-72615421 CCTGCTGACTCAAGAGCCCTTGG - Intergenic
1129193494 15:73951280-73951302 CCTGCTGCCCACAGGCCCCCGGG - Intronic
1129210474 15:74065189-74065211 CATCCTGTCCTGAGAGCCCCAGG + Intergenic
1129477370 15:75795248-75795270 CCTGCTGACAGTAGAGCCCCAGG - Intergenic
1129835424 15:78702508-78702530 CCTGCTGACTGTAGAGCCCCAGG - Intronic
1129835554 15:78703190-78703212 CCTGCTGACTCAAGAGCCCTTGG - Intronic
1131048792 15:89333253-89333275 CCAGCTGCCCCCGAAGCCCCCGG - Exonic
1131353590 15:91723911-91723933 CCTGCTGCCCTCCGAGCTCCAGG - Intergenic
1131509066 15:93039199-93039221 ACTGAAGGCCCGAGAGCCCCTGG - Intronic
1132586369 16:707262-707284 CCTGCTGTGGTGAGAGCCCCAGG - Intronic
1132723028 16:1326265-1326287 CCTGCTGCCCTGGCACCCCCCGG + Exonic
1132750476 16:1455298-1455320 CCTGCTGGTCCGTGAGCCCTGGG - Intronic
1132990010 16:2787499-2787521 CCTGCAGCCCCCACAGCCCCTGG + Intronic
1133038037 16:3045794-3045816 CCTCCCGCGCCGAGAGCACCGGG - Intergenic
1133315516 16:4881279-4881301 CCCACTGCCTGGAGAGCCCCAGG - Exonic
1133315650 16:4882169-4882191 CCTGCAGCCCCCAGACCCCGAGG - Exonic
1133348376 16:5085251-5085273 CCTGCTGCACCGTAAGCCCAGGG + Exonic
1133771404 16:8868901-8868923 CCCGCGGCCCCGGGAGCCGCAGG - Intronic
1134096818 16:11423888-11423910 CCTGCAGCCCCGAGAGGCCATGG + Intronic
1135142759 16:19935835-19935857 GCTGCTGCCCAGGGAGTCCCTGG + Intergenic
1136025488 16:27465644-27465666 ACTGCTTCCCCGACAGCCACAGG + Intronic
1136113314 16:28078673-28078695 CCTTCTGCCCACAGACCCCCTGG + Intergenic
1136134940 16:28250074-28250096 GCTGAAGGCCCGAGAGCCCCTGG - Intergenic
1136428779 16:30185415-30185437 GCTGCTCCCCCCAGGGCCCCAGG - Intronic
1137056338 16:35748228-35748250 CCTGCTCCCCTGTGAGTCCCAGG + Intergenic
1137396041 16:48116797-48116819 CCTGCCACCCCAAGAGACCCAGG - Intronic
1138584504 16:57961138-57961160 CCTGCTGCCCCAGGAGGCCATGG - Intronic
1139246067 16:65445223-65445245 CCTGATCCCCCGACAGGCCCTGG + Intergenic
1139435206 16:66932879-66932901 CCTGCAGCCCCCAGACCCTCAGG + Intronic
1140469621 16:75206824-75206846 CCTCCTCCCCTGAGAGCCTCAGG + Intronic
1140893062 16:79301273-79301295 CCTGCTGACCAGCGAGACCCTGG + Intergenic
1141170237 16:81686365-81686387 CCTGCAGCTCTGAGAACCCCAGG + Intronic
1141264983 16:82488539-82488561 CCTGCGGCCCAGAGAGCCTAGGG - Intergenic
1141592377 16:85077435-85077457 GCTGCTGCCCCCGGAGTCCCGGG + Exonic
1141896819 16:86963624-86963646 CCCGATGCCCCGAGAGGCCTGGG - Intergenic
1142107901 16:88316060-88316082 CATGCTGCCACCACAGCCCCGGG + Intergenic
1142156413 16:88534592-88534614 CCTGCTGCTCGGCGCGCCCCTGG + Exonic
1142191309 16:88719485-88719507 ACTGCTGCCACGAGAACCCGTGG - Intronic
1142267316 16:89070639-89070661 CTTGCTGCACCGAGGGACCCTGG - Intergenic
1142282951 16:89159036-89159058 CCTGCTCCCCCCAGACCCCCTGG + Intergenic
1142343179 16:89537270-89537292 CCTGCGGACCCCAGAGCCCCCGG + Intronic
1142505086 17:358068-358090 CCTGCTATCCCCAGGGCCCCAGG + Intronic
1142592262 17:1011479-1011501 CCTGCTGTCTCCAGGGCCCCAGG - Intronic
1142604351 17:1073398-1073420 CCTGCCTCCCCGGGAGCACCTGG + Intronic
1142859053 17:2749789-2749811 CCGGGAGCCCCGAGAGCCCCGGG + Intergenic
1142914793 17:3127488-3127510 CCAGCTGCTCAGAGAACCCCAGG + Exonic
1142969859 17:3604029-3604051 TCTGTTGGCCCCAGAGCCCCTGG - Intergenic
1143670529 17:8393026-8393048 CCTGCTGCCCAGCCTGCCCCGGG - Exonic
1144077202 17:11729924-11729946 CCAGCTGCCCTGAAAGCCACAGG + Intronic
1144547944 17:16215280-16215302 GCTGCTGCCCCGGGAGCCCTCGG + Intronic
1144734477 17:17547323-17547345 CCTGCTTGCCCTAGTGCCCCAGG - Intronic
1146167533 17:30601215-30601237 GCTGCTGCTCCCCGAGCCCCGGG - Intergenic
1146224074 17:31050798-31050820 CCTGCTCCCCCAGCAGCCCCAGG - Intergenic
1146341244 17:32021333-32021355 CCTGCTCCCCCAGCAGCCCCGGG + Exonic
1146399405 17:32491651-32491673 CCTGCTGGCCTGGGAGACCCCGG - Intergenic
1146821286 17:35985140-35985162 CCTGAGGCCCCCAGAGCTCCAGG - Intronic
1147142243 17:38466347-38466369 CCTGCTGCCTGGAGTGACCCGGG + Exonic
1147400623 17:40178192-40178214 CCCCCTCCCCCGAGAGGCCCGGG - Intronic
1147742302 17:42676235-42676257 GCTGCTGCTCCGAGAGCTCCCGG + Intronic
1148151318 17:45397915-45397937 CCCACTGCCCCTAGAGGCCCTGG + Intronic
1148152590 17:45405274-45405296 CCTTCTGCTCCCACAGCCCCAGG - Intronic
1148152690 17:45405600-45405622 CCTCCTGCTCCCAGAGGCCCAGG - Intronic
1148198857 17:45734560-45734582 CCTGGTGGCCCCAGAGTCCCTGG - Intergenic
1148451094 17:47778314-47778336 CCTGCTGCACCGAGAGCCCCGGG - Intergenic
1148646548 17:49222719-49222741 TCAGCTGCCCAGAGAGCCCTGGG - Exonic
1148786668 17:50149190-50149212 CCTCCTCCTCCGACAGCCCCGGG + Exonic
1150069664 17:62140102-62140124 CCAGGCCCCCCGAGAGCCCCTGG - Intergenic
1150692572 17:67378260-67378282 CCTCCTGGCCGGCGAGCCCCGGG + Intronic
1150871114 17:68911554-68911576 CCTGCTGCCTGAAGAGCCCTTGG + Intronic
1151495361 17:74455061-74455083 CCTTCAGCCCGGACAGCCCCTGG - Intergenic
1151745218 17:76008278-76008300 CCTCCAGCCGCGAGAGCTCCTGG + Exonic
1151948084 17:77330237-77330259 CCTGCTGCTCCGGGTGCCTCTGG + Intronic
1152027181 17:77818258-77818280 CCTCCTGCCTTGAGAGCTCCTGG - Intergenic
1152239745 17:79155095-79155117 GCTGCTGCCCCGGGAACCGCTGG - Intronic
1152297958 17:79479279-79479301 CCTCCTGCCCCGCGAGCTCCTGG - Intronic
1152300425 17:79492286-79492308 CCTGGTGCCCAGACACCCCCTGG + Intronic
1152318785 17:79596379-79596401 CCTGCTGATCAGAGAGCCCCAGG - Intergenic
1152375029 17:79914546-79914568 CCTGCTGCCTCCAGAACCCAGGG - Intergenic
1152467219 17:80473167-80473189 CCTGCCGCCCTGTGAGCCCGGGG + Intronic
1152482221 17:80562118-80562140 CCGGCAGCCCCAAGAGCCCCTGG + Intronic
1152521677 17:80860123-80860145 CCTGCTGCCCGGCGCTCCCCAGG + Intronic
1152608795 17:81305754-81305776 CCTGCTGCCCCCAGAGGCTCTGG - Intergenic
1152690753 17:81716707-81716729 TCTGCTTCCTCGAGAACCCCCGG + Intronic
1152946260 17:83199119-83199141 CGGGATGCCCCGTGAGCCCCTGG + Intergenic
1153074635 18:1148473-1148495 CCTGCTGACTCAAGAGCCCTTGG + Intergenic
1153840729 18:9005623-9005645 CCTGCAGCCCTGGAAGCCCCAGG - Intergenic
1154231180 18:12557474-12557496 CATGCTGGCCCGCGAGCGCCTGG + Intronic
1154485320 18:14867706-14867728 CTTGCTCCCCAGGGAGCCCCGGG + Intergenic
1155326909 18:24673457-24673479 CGTGCTGGCCCAAGTGCCCCAGG + Intergenic
1155991920 18:32287086-32287108 ACTGCTGCTCCCAGAGTCCCAGG + Exonic
1156409005 18:36810153-36810175 CCTTCTGCCCCAAGCACCCCTGG + Intronic
1156458490 18:37307992-37308014 CCTGCTGCCTCCAGACCTCCAGG - Intronic
1156702317 18:39840740-39840762 GCTGCATCCCCGAGGGCCCCAGG - Intergenic
1157097503 18:44699749-44699771 CCTGCTCCCCAGAGAAGCCCAGG - Intronic
1157786597 18:50489067-50489089 GCTGAAGGCCCGAGAGCCCCTGG - Intergenic
1160418167 18:78726437-78726459 CCTGCTGTCCCCCGAGCTCCAGG + Intergenic
1160620579 18:80167712-80167734 CCTGCTGCTCAGAAATCCCCTGG - Intronic
1160799938 19:963091-963113 CCTGCTACCCCCGGAACCCCCGG - Intronic
1160951105 19:1667785-1667807 CCAGCTGCCCCGGGACCCCACGG - Intergenic
1161059639 19:2208453-2208475 ACTGCTCCCCCGAGGGCCCTGGG + Intronic
1161619126 19:5289193-5289215 CCTGCTTCCACGAAAACCCCAGG + Intronic
1161681091 19:5680240-5680262 CCTGCTTCCCAGCGAGCCCTTGG - Intronic
1161864930 19:6826752-6826774 CCTGCTGCCCCCAGGGCCTGGGG - Intronic
1162470977 19:10871843-10871865 CCTGCTGCTCCGCGTGCCGCTGG - Exonic
1162496481 19:11025980-11026002 CCTGCTGCCCCGAGAGCCCCTGG + Intronic
1162728187 19:12702177-12702199 CCTGCAACCCCGAGCGGCCCCGG + Exonic
1162948531 19:14057534-14057556 CTCGCTGCCTCGGGAGCCCCGGG - Intronic
1163478750 19:17542207-17542229 CCAGCTGCCCCAAGCGCCCCCGG - Exonic
1163639136 19:18451583-18451605 CCTGCTGCCTCCAGCCCCCCAGG - Exonic
1165068352 19:33241551-33241573 CCCTCTGCCCAGAGGGCCCCAGG + Intergenic
1165772411 19:38387060-38387082 CATGGTACCCCGGGAGCCCCAGG - Exonic
1166408363 19:42539834-42539856 CCTGCTGACTAAAGAGCCCCTGG - Intronic
1166757342 19:45201500-45201522 CCTGCTGGCCGAAGAGCCCTTGG - Intronic
1166816899 19:45551743-45551765 CCTCCTGCCTCCATAGCCCCCGG - Intronic
1167044260 19:47040655-47040677 CCTGCTGCACCTACAGCTCCAGG + Intronic
1167508002 19:49881277-49881299 CCAGCTGCCCCCAGGGCTCCTGG + Exonic
1167623208 19:50569909-50569931 CCTTCTCCTCGGAGAGCCCCAGG + Intergenic
1167645315 19:50702582-50702604 GCGGCTGCCCAGGGAGCCCCCGG + Exonic
1168181309 19:54664535-54664557 CCTGCTGCCAGGAGAGCTCTGGG + Intronic
1168316766 19:55488058-55488080 GCTGCTGCACCAAGAACCCCAGG + Intergenic
1168413369 19:56153827-56153849 CCAGCTGCCTCTGGAGCCCCAGG - Intronic
1168414505 19:56159906-56159928 CCGGCAGCCCCGGCAGCCCCGGG + Exonic
925538090 2:4937770-4937792 CCTGTTGCACAGGGAGCCCCTGG - Intergenic
925644121 2:6018478-6018500 GCTGAAGTCCCGAGAGCCCCTGG - Intergenic
925841371 2:7995215-7995237 CCTGCTGCCCGGGCAACCCCAGG - Intergenic
926088682 2:10036214-10036236 CCTGGTGCCAGGAAAGCCCCTGG + Intergenic
926942655 2:18154576-18154598 GCTGAAGGCCCGAGAGCCCCTGG + Intronic
926956895 2:18311458-18311480 CTTACAGCCCCGAGAGCCTCAGG - Intronic
927259342 2:21071006-21071028 TCTTCTGTCCCCAGAGCCCCTGG - Intergenic
928094017 2:28393106-28393128 CCCGCGGCCCCGAGCGCGCCAGG - Exonic
928169508 2:28994344-28994366 CCAGCTGCCCTGAAAGCCCATGG - Intronic
928278281 2:29921555-29921577 GCTGCCGCCCCCAGAGCCGCTGG + Exonic
928314717 2:30236319-30236341 CCTGCTGCCCTTGCAGCCCCAGG - Intronic
928490180 2:31775239-31775261 GCTGAAGGCCCGAGAGCCCCTGG - Intergenic
929565003 2:42978671-42978693 CCTGATGCCCTGGGAGGCCCAGG - Intergenic
931537837 2:63298619-63298641 GCTGAAGGCCCGAGAGCCCCTGG - Intronic
931644152 2:64406271-64406293 CCGGCTGCCCGCAGAGCTCCTGG - Intergenic
932056420 2:68448225-68448247 CCTGGAGCACCGACAGCCCCTGG + Intergenic
932191064 2:69741952-69741974 CCTGCCTCTCCGAGAGCTCCTGG + Exonic
933702622 2:85266557-85266579 CCTGCTGCACTGAAAACCCCAGG - Intronic
933709470 2:85314995-85315017 CCTGCTCCCAGGAGAGCCTCAGG - Intergenic
934639777 2:96020921-96020943 CCTGCATCCCCAAGAGCACCAGG - Intergenic
934640411 2:96024275-96024297 CCTGCAGCTCCCAGGGCCCCTGG + Exonic
934793240 2:97081141-97081163 CCTGCAGCTCCCAGGGCCCCTGG - Intergenic
935216008 2:100975842-100975864 CCTCATACCCCCAGAGCCCCTGG + Intronic
935268548 2:101414607-101414629 CCTCCTGCCCTGAGAGAGCCAGG + Intronic
936818136 2:116485007-116485029 CCTGCTGCCCAGGGATCCCAGGG + Intergenic
937151285 2:119687723-119687745 ACTGCAGCCTTGAGAGCCCCTGG + Intergenic
937215103 2:120307678-120307700 CCTCCTGCCCCGACAGGGCCAGG + Intergenic
937248064 2:120506235-120506257 CCTGCTGCCCTGGGAGCCTGCGG - Intergenic
937982754 2:127624814-127624836 CCTGCTGCCCCCAGAACTTCAGG - Intronic
940009514 2:149038933-149038955 CCCGCGGCCCCGCGAGCTCCTGG - Intronic
940194838 2:151082284-151082306 CCTGACTCCCCGAGAGGCCCCGG - Intergenic
941367046 2:164621625-164621647 CCAGTGGCCCCGAGCGCCCCGGG - Exonic
943923383 2:193738958-193738980 CCTGCTGACTGTAGAGCCCCAGG + Intergenic
944078728 2:195760391-195760413 CCTGCTGACTGTAGAGCCCCAGG + Intronic
944951213 2:204751392-204751414 TCTCCTGCCCAGAGGGCCCCAGG - Intronic
946043741 2:216803968-216803990 CATGCTGCCCTGAGAGCAGCGGG - Intergenic
946249622 2:218404573-218404595 CCTGCTGCCCCTACACCGCCTGG - Exonic
946376011 2:219309292-219309314 CCGGATCCCCCGAGACCCCCAGG + Exonic
947748341 2:232520703-232520725 CAGGCTGGCCCGAGAGCCGCGGG + Intronic
948450715 2:238069437-238069459 CCGGCTGCCCCTGGAGCACCTGG + Exonic
948491221 2:238314614-238314636 CCTCCTGCCCTGGGAGGCCCTGG + Intergenic
948596240 2:239081522-239081544 CTTTCTGCCCAGAGAGACCCAGG - Intronic
948700787 2:239758403-239758425 CCTCCTGCACCGAAACCCCCGGG + Intergenic
948858297 2:240740828-240740850 CCAGCTGCCCCCAGGGCACCAGG + Intronic
1168800223 20:639989-640011 GCTGCTGTCACCAGAGCCCCAGG - Intergenic
1168830823 20:844501-844523 CCTCCTGCCCCGGGAGAACCAGG - Intronic
1170428890 20:16259711-16259733 CCTGCTGGCCCCAGCGCACCAGG + Intergenic
1171106569 20:22439126-22439148 CGTGCTGCCCCTACAGGCCCTGG + Intergenic
1171853096 20:30322353-30322375 CTGGCTGCCCCTGGAGCCCCAGG - Intergenic
1172654373 20:36528014-36528036 CCAGGTGCCCCGAGAGCCAGCGG - Exonic
1172693021 20:36803524-36803546 CCTGCTGCCCCCAAAGACCTGGG - Intronic
1172971662 20:38877699-38877721 CCTCCTGCACCGCTAGCCCCAGG + Intronic
1173423521 20:42923765-42923787 ACTGCTGGCCCAAGAGGCCCTGG - Intronic
1174253250 20:49235014-49235036 CCTGCAGCCCCATGAGCCCCAGG - Exonic
1174404478 20:50294574-50294596 CCTGCAGCCCCGAGAGCTGTGGG + Intergenic
1175909943 20:62400375-62400397 CCGGCTGTCCCGAGAGGCCCAGG + Intronic
1175964584 20:62654143-62654165 CCTGGAGCCCCGGGAGCCACTGG - Intronic
1176121903 20:63457810-63457832 GCTGCAGCTCCCAGAGCCCCTGG - Intronic
1176796014 21:13371770-13371792 CTTGCTCCCCAGGGAGCCCCGGG - Intergenic
1177792274 21:25734581-25734603 GCTGCGGGCCCGAGACCCCCGGG + Exonic
1178906297 21:36639779-36639801 CCTGAGGCCCAGAAAGCCCCAGG + Intergenic
1179465379 21:41568230-41568252 CCTGCTGCCCAGACAGTGCCTGG - Intergenic
1179800884 21:43811029-43811051 CTTGCTGCCCCGTGTGACCCAGG + Intergenic
1180092476 21:45540133-45540155 CCTGATGCCCAGAGAGGCCACGG + Intronic
1180592263 22:16950714-16950736 GCTGAAGGCCCGAGAGCCCCTGG + Intergenic
1180876525 22:19177640-19177662 CCGGTTGCCCCGGGAGCACCGGG + Intronic
1180967959 22:19800336-19800358 ACAGCTTCCCTGAGAGCCCCCGG - Intronic
1181309914 22:21939079-21939101 GCTGCTGCCCCGAGACCTGCTGG + Intronic
1181311186 22:21945842-21945864 CCTGCTGCCCAGAAAGCCCATGG + Exonic
1181610608 22:24009004-24009026 CCTGCTTCCCAGAGTGCCTCAGG + Intergenic
1181934585 22:26429500-26429522 CCTCCCGCCCCGGCAGCCCCCGG - Intronic
1182488565 22:30654530-30654552 CATGCTGCCCCGCGAGACCAAGG - Intronic
1182550811 22:31099961-31099983 CCAGTTGCCCTGAGAACCCCTGG + Intronic
1182879121 22:33718243-33718265 CCTCCTGCTCTGAGAACCCCCGG + Intronic
1182972117 22:34588909-34588931 CCTGCTCCCCGCTGAGCCCCAGG - Intergenic
1183697597 22:39432036-39432058 GCTGCCGCCCCCACAGCCCCGGG + Intronic
1184098574 22:42329746-42329768 CCTGCAGCCCCAAGAGCCTCTGG - Intronic
1184374855 22:44105248-44105270 CTGGCTGGCCCGAGGGCCCCAGG + Intronic
1184398997 22:44262712-44262734 CCTGCTGGCCCTAGTGGCCCTGG + Intronic
1184423726 22:44396739-44396761 CCTGCTGGACCGAGGACCCCAGG - Intergenic
1184931150 22:47682253-47682275 ACTCCTGCCCCGAGGGCCTCAGG - Intergenic
1185032008 22:48449129-48449151 CCTGAGGCCCAGAGAGCTCCAGG - Intergenic
1185037658 22:48488430-48488452 CCTGCTGCCTGGAGAGGCTCTGG - Intergenic
1185051161 22:48555039-48555061 CCTGCTGCCATGACAGCCACTGG - Intronic
1185199575 22:49493465-49493487 GCTGCTGCCCTGGGAGGCCCGGG + Intronic
1185272150 22:49934643-49934665 CCTTCTGCCCCCCGACCCCCAGG - Intergenic
1185398183 22:50603234-50603256 GCGGCTGCTCCGAGCGCCCCAGG - Exonic
950484363 3:13264348-13264370 CCTGCTGTCCTTAGAGCCCTCGG - Intergenic
950729824 3:14947758-14947780 CCCGCTGCCCCGCGAGCCCGCGG + Intronic
951032146 3:17894934-17894956 CCTGCTGACTGTAGAGCCCCAGG - Intronic
951819273 3:26790663-26790685 CCTGCTGACTGTAGAGCCCCAGG - Intergenic
953032006 3:39185532-39185554 CCTGCTGGCCAGAGAACCCCTGG - Exonic
953541973 3:43828377-43828399 ACAGCTGCCCCCAGAGCCACTGG - Intergenic
953979822 3:47408000-47408022 CCTGGGGCCCCCAGAGGCCCGGG - Intronic
954216679 3:49128660-49128682 GCTGCTGCGCTTAGAGCCCCAGG - Exonic
954284813 3:49611438-49611460 CCTGCTCCCCAGCCAGCCCCAGG - Intronic
954378855 3:50209047-50209069 CCTGCTGACCCGGAATCCCCTGG - Intronic
954407480 3:50353510-50353532 GCTGCTGCCCCGATGGCCCCTGG + Exonic
954764801 3:52905029-52905051 CCTGCAGGCCCCAGAGCCCCAGG + Exonic
955535241 3:59916306-59916328 GCTGAAGGCCCGAGAGCCCCTGG - Intronic
957923022 3:86771981-86772003 CCTGCTGCCTCGAGCCCCTCTGG + Intergenic
961336053 3:126180379-126180401 CCTGGAGCCCCTGGAGCCCCCGG + Intronic
961336057 3:126180388-126180410 CCTGGAGCCCCCGGAGCCCCCGG + Intronic
961350787 3:126300615-126300637 CCTCCTGCAACCAGAGCCCCAGG + Intergenic
961441691 3:126957369-126957391 CCTGCTGGCACCTGAGCCCCAGG + Intronic
961554356 3:127688099-127688121 CCTGCTTCCCAGAGGGTCCCTGG - Intergenic
961881075 3:130061663-130061685 GCAGCTGCTCCCAGAGCCCCTGG + Intergenic
962207363 3:133446064-133446086 CCTGCTCCCCAGTGTGCCCCAGG + Intronic
963895595 3:150682363-150682385 CCTGCTGCTCTCAGAGCCTCTGG - Intronic
966076053 3:175937472-175937494 CCAGCTGCCCTGCCAGCCCCGGG + Intergenic
966757457 3:183384762-183384784 CCTGCTGCCCAGACAGAACCAGG - Intronic
966762227 3:183428467-183428489 CGTGCCTCCCCGAGAGCCCCGGG - Intronic
968005021 3:195236787-195236809 CCTGCTGACGAAAGAGCCCCTGG - Intronic
968096235 3:195932714-195932736 CCTGCTGACTAAAGAGCCCCTGG + Intergenic
968569362 4:1331404-1331426 CCTGCTGCCCCGGGCTCTCCTGG + Intronic
968648981 4:1753004-1753026 GCTGGTGCCCCGCGAGGCCCCGG - Intergenic
968787412 4:2632922-2632944 CCTGGTGCCCAGAGAGACTCTGG + Intronic
969045612 4:4334396-4334418 GCTTCTGCCCTGAGAGCCCCGGG - Intergenic
969643922 4:8415240-8415262 CCTGCTGTCCTCAGACCCCCAGG - Intronic
972312191 4:37891486-37891508 CTTCCTCCCCCGAGAGACCCTGG - Intronic
973293434 4:48491074-48491096 GCTGCCGCCGCGAGAGGCCCAGG + Exonic
975898402 4:79121963-79121985 CGTGCTGGCCCGCGAGCACCAGG - Intergenic
976722033 4:88178367-88178389 CCTGCTGACCAAAGAGCCCTTGG + Intronic
978702487 4:111664851-111664873 CCTGATGCCCTGAGATCCCATGG - Intergenic
978934636 4:114359680-114359702 CCTGCTGACTAAAGAGCCCCTGG - Intergenic
982274047 4:153621828-153621850 CCTGCTGCCCAGAGAGAGGCAGG + Exonic
983935516 4:173500300-173500322 CCTGCTCCCCCAAGAGCTGCGGG + Intergenic
984310586 4:178053021-178053043 CCTGCTGACCCAAGTGCCCTTGG - Intergenic
985558976 5:572198-572220 CCTGCTGACCTCAGAGCCCTCGG - Intergenic
985662479 5:1164076-1164098 CCTGCGGCCCTGTGGGCCCCGGG + Intergenic
985716485 5:1466095-1466117 CCTGCAGCCCTGGGAGCCTCGGG + Intronic
986825515 5:11517608-11517630 CCTACACCCCCGAGAGGCCCCGG - Intronic
989273488 5:39559101-39559123 TCTCCTGCCCCCAGAGCACCAGG - Intergenic
992587253 5:78252847-78252869 CCTGCTGACTGTAGAGCCCCAGG + Intronic
993386510 5:87268402-87268424 CCTGCCCGCCCGGGAGCCCCAGG - Exonic
996123294 5:119695232-119695254 CCTGCTTCCCAGAAAGCCTCAGG + Intergenic
998214607 5:140227682-140227704 CCCACTGCCCCTAAAGCCCCCGG + Intronic
999141897 5:149367880-149367902 CCTGCTGCACCCTGAGCACCAGG + Intronic
1001845639 5:174918375-174918397 CATCCTGTCCTGAGAGCCCCAGG + Intergenic
1001975432 5:175994844-175994866 CCTGCTACCCCTCGACCCCCAGG + Intronic
1002242001 5:177848926-177848948 CCTGCTACCCCTCGACCCCCAGG - Intergenic
1002467323 5:179414065-179414087 GCTGCTGCCCCGAGAGCCCCAGG - Intergenic
1002900491 6:1406392-1406414 CCAGCTGCTCTGAGAGCCCGCGG + Intergenic
1003493313 6:6642316-6642338 CCTGCAGCACTGAGAGTCCCGGG + Intronic
1003652280 6:7972322-7972344 GCTGCTGCCCTGAGAGGCCTCGG - Intronic
1004740656 6:18457214-18457236 CCTGTTGCCTCGAGTGACCCAGG + Exonic
1005969323 6:30749054-30749076 CCTGCTACCCTCAGAGCCCTAGG + Intergenic
1006018656 6:31103559-31103581 CCTGCTGACTAAAGAGCCCCTGG - Intergenic
1006113257 6:31761582-31761604 ACTGCTGCCACAAGGGCCCCTGG + Exonic
1006429154 6:33984508-33984530 CCTGCTTCCCCCAGCGCCCCTGG - Intergenic
1008092796 6:47309538-47309560 CCAGCTGCCCCGCGCGCCCCGGG - Exonic
1008215176 6:48779095-48779117 CCTGCTGATCGCAGAGCCCCAGG + Intergenic
1009893765 6:69721526-69721548 CCTGCTGACTAAAGAGCCCCTGG + Intronic
1010214378 6:73388843-73388865 CCTGCTGCTCCGAGAGCCAAGGG + Intronic
1010434473 6:75813728-75813750 CCTGCTGACTAAAGAGCCCCTGG - Intronic
1011075259 6:83431383-83431405 TCTGCTGACCCCAGAGACCCAGG + Intergenic
1011446955 6:87451476-87451498 CCTGCTGACCAAAGAGCCCTTGG + Intronic
1014259951 6:119204840-119204862 ACTGCTGCCTCCAGAGGCCCAGG + Exonic
1014797877 6:125747734-125747756 CCTCCCGCCCCGAGCGCCCTGGG - Intronic
1016833622 6:148455944-148455966 CCTGCTGCCCCCAGGGCAGCTGG + Intronic
1017117955 6:150996632-150996654 CCTGCTGAGCCTACAGCCCCAGG + Intronic
1017905136 6:158752818-158752840 CCAGCTGCCCAGATGGCCCCTGG - Intronic
1018774220 6:166998873-166998895 CCTGCAGCCCCTGCAGCCCCGGG - Intergenic
1018867759 6:167759024-167759046 CCTGCTGCCCTGACAGCCCCAGG + Intergenic
1018910167 6:168097176-168097198 CCTGCTGAGCCCAGAGCACCTGG + Intergenic
1019058860 6:169241800-169241822 CGTGGAGCCCCGAGAGCTCCTGG + Exonic
1019500437 7:1361910-1361932 CCTGCAGCCCCCAGGGCCCCTGG + Intergenic
1019716749 7:2542701-2542723 CCTGCTGCCCACAGGGCCCAGGG - Intronic
1020319791 7:6931197-6931219 CCTGCTGCACCGTAAGCCCAGGG + Intergenic
1021915346 7:25426040-25426062 CCTTCTGCCCCAAGAACCCTGGG - Intergenic
1024232255 7:47371489-47371511 CCACCTGCCCAGAGAGCACCAGG + Intronic
1024415101 7:49096899-49096921 CCTGCTGATTAGAGAGCCCCAGG + Intergenic
1024498407 7:50072471-50072493 CCTGCTGATTGGAGAGCCCCAGG + Intronic
1025710221 7:63901219-63901241 CCTGCAGCCCAGGGAGCCACCGG + Intergenic
1026091328 7:67302947-67302969 GCTGCTGGCCCGAGTCCCCCCGG + Intergenic
1026891255 7:73984077-73984099 CCAGCTGCCCCGGGGGCCACGGG - Intergenic
1029365487 7:100113631-100113653 CCCTCTGCCCCGGGTGCCCCTGG - Exonic
1029650006 7:101885235-101885257 CCTCCTGGCCAGAGAGCCTCTGG - Intronic
1029653518 7:101909762-101909784 CCTCCTGCCCCCAGAACCTCTGG - Intronic
1031236414 7:119184482-119184504 GCTGATGGACCGAGAGCCCCCGG - Intergenic
1032174468 7:129612072-129612094 GCTGCCCTCCCGAGAGCCCCAGG + Intronic
1032174490 7:129612114-129612136 GCCGCGGCCCCGAGAGCCCCAGG - Intronic
1033283137 7:140019778-140019800 GCTGCTTTCCCCAGAGCCCCTGG + Intronic
1034345733 7:150384188-150384210 CCTGCTCCCCTCAGAGCCCGAGG + Intronic
1034347592 7:150396969-150396991 TCTGCTGCCCCGAGTGCGCGCGG + Exonic
1034508405 7:151515324-151515346 CCTGCTTCCCTGTCAGCCCCTGG - Intronic
1034646571 7:152652970-152652992 CCTGCTGCCCAGAGACCACAGGG + Intronic
1034953248 7:155315711-155315733 CCTACTGCCCAGAGAGCCAAGGG - Intergenic
1035018536 7:155787317-155787339 CTGGCTGCCCCGAGGGTCCCAGG + Intergenic
1035109112 7:156465423-156465445 CCCTCTGCCCAGAGAGGCCCAGG + Intergenic
1035305593 7:157929375-157929397 CCTGCAGCACCGGGAGACCCTGG + Intronic
1035555964 8:567447-567469 CCGGCTACACCGAGAGTCCCTGG + Intergenic
1035783006 8:2243790-2243812 CATTCTGCCCAGACAGCCCCAGG + Intergenic
1035809121 8:2475796-2475818 CATTCTGCCCAGACAGCCCCAGG - Intergenic
1036454163 8:8893298-8893320 CCTGCTGCCCGGCGCGCCCATGG - Exonic
1038359781 8:26865194-26865216 CCGGCAGCCCCGCGCGCCCCTGG - Exonic
1044790434 8:95841458-95841480 CCTGGTACCCCAAGAGACCCAGG + Intergenic
1044999806 8:97869413-97869435 ACTGCAGCCCCCAGCGCCCCGGG + Intronic
1045472335 8:102523679-102523701 CCTGCTGCCCAGATAGCCAATGG - Intergenic
1047333965 8:123918934-123918956 CCTGCTGGACTGAGAGCCCTTGG - Intronic
1048455052 8:134570129-134570151 CCTGCTGTTCCCAGAGCCCGGGG + Intronic
1048578254 8:135709793-135709815 CCCTCTGCCCCAATAGCCCCCGG + Intergenic
1048979171 8:139694000-139694022 CCTGTGGCCCCCAAAGCCCCCGG + Intronic
1049049736 8:140185250-140185272 CCTGCTGGACTCAGAGCCCCGGG - Intronic
1049254008 8:141604511-141604533 CCCCCTTCCCCGAGAGCCACTGG + Intergenic
1049324473 8:142014889-142014911 CCTGCTGCTGCCAGAGTCCCGGG + Intergenic
1049337296 8:142093314-142093336 CCAGCTGCCCCCACAGCCCCAGG - Intergenic
1049433101 8:142574309-142574331 CGTGCTGCTCCCCGAGCCCCAGG - Intergenic
1049451016 8:142661527-142661549 CCTGCTACCCCACGAGCCACTGG + Intronic
1049543954 8:143220969-143220991 CCTGCTGGCCCCGGAGCTCCGGG - Intergenic
1049552674 8:143267655-143267677 GCTGCTGCTCCGCGACCCCCAGG - Intronic
1049683421 8:143929896-143929918 CCTCCCACCCAGAGAGCCCCCGG + Intronic
1049800468 8:144515329-144515351 CCAACTGCCCTGAGGGCCCCAGG + Exonic
1049807167 8:144546298-144546320 CCTGCTGCTCTGAGAGAACCTGG + Intronic
1050949241 9:11566995-11567017 CCTGCTGACTAAAGAGCCCCTGG - Intergenic
1053003719 9:34591280-34591302 CCGGCGGCCCAGAGAGCCCGGGG - Intergenic
1053129578 9:35607457-35607479 TCTGATGTCCCCAGAGCCCCAGG + Intronic
1053790894 9:41685652-41685674 CTGGCTGCCCCTGGAGCCCCAGG - Intergenic
1054154260 9:61629120-61629142 CTGGCTGCCCCTGGAGCCCCAGG + Intergenic
1054179241 9:61897346-61897368 CTGGCTGCCCCTGGAGCCCCAGG - Intergenic
1054474045 9:65560240-65560262 CTGGCTGCCCCTGGAGCCCCAGG + Intergenic
1054658297 9:67683475-67683497 CTGGCTGCCCCTGGAGCCCCAGG + Intergenic
1056735929 9:89209501-89209523 CCAGCTGGCCCGCAAGCCCCAGG + Intergenic
1057129310 9:92642101-92642123 TCTGCTGCCCCTTCAGCCCCAGG + Intronic
1057700867 9:97362267-97362289 ACTGCTGCCCCGAGACCCACAGG - Exonic
1058053407 9:100427585-100427607 CCTGCTGCCTACAAAGCCCCGGG + Intronic
1058967246 9:110049236-110049258 TCTCCTGCCCCGGGAGCACCGGG + Intronic
1059249636 9:112877130-112877152 GCTGCTGGCCCAAGAACCCCTGG + Intronic
1059322612 9:113481338-113481360 ACTGCTGGCCAGAGAGACCCAGG + Intronic
1060294894 9:122336775-122336797 CCTGTGGCCCAGACAGCCCCAGG - Intergenic
1060479271 9:124008617-124008639 CCGGCAGCCCCGGGAGCCCCGGG + Intronic
1060479964 9:124012165-124012187 CGTCCTGCCCCGCGAGCGCCCGG + Exonic
1060484647 9:124039509-124039531 CATGCTGCCTGGAAAGCCCCTGG - Intergenic
1061158944 9:128882332-128882354 CCAGATGCCCCGGGCGCCCCGGG - Intronic
1061443516 9:130623767-130623789 GGTGCTGCACCGAGAGCCCCGGG - Intronic
1061505937 9:131031941-131031963 CTGGCTGCCCCGGGAGCTCCTGG - Intronic
1061677965 9:132229082-132229104 CCTGCTTCCCTGGGAGTCCCCGG + Intronic
1062264105 9:135678932-135678954 CCTGCAGCCCCCATATCCCCAGG + Intergenic
1062333734 9:136055924-136055946 CCTGCTGACTCCAGAGCACCTGG - Intronic
1062348393 9:136126243-136126265 CCTGCTGCCCGGAGAAGACCAGG - Intergenic
1062471550 9:136708004-136708026 GCTGCCGCCCCGTGAGCCACAGG + Intergenic
1062513748 9:136921855-136921877 CCTGCTGTCCCTCGAGGCCCTGG + Intronic
1062554124 9:137106376-137106398 CCTGCTGCCCCCAGCTCCCACGG + Intronic
1062566748 9:137167061-137167083 CCTGGTGCCCAGAGAGGCTCGGG - Intronic
1062601613 9:137320947-137320969 CCTGCCGCCCCTGGAGCCCAAGG + Intronic
1062601685 9:137321186-137321208 CCTTCTGCCCCCACAGCCTCAGG - Intronic
1062728962 9:138097785-138097807 CCTACTGCCCACAGAGCTCCTGG + Intronic
1203768385 EBV:38317-38339 CCGGCTGCCCCCGGAGCGCCAGG - Intergenic
1203768435 EBV:38442-38464 CCGGCTGCCCCCGGAGCGCCAGG - Intergenic
1203768485 EBV:38567-38589 CCGGCTGCCCCCGGAGCGCCAGG - Intergenic
1203768535 EBV:38692-38714 CCGGCTGCCCCCGGAGCGCCAGG - Intergenic
1203768585 EBV:38817-38839 CCGGCTGCCCCCGGAGCGCCAGG - Intergenic
1203768635 EBV:38942-38964 CCGGCTGCCCCCGGAGCGCCAGG - Intergenic
1203768685 EBV:39067-39089 CCGGCTGCCCCCGGAGCGCCAGG - Intergenic
1203768735 EBV:39192-39214 CCGGCTGCCCCCGGAGCGCCAGG - Intergenic
1203768785 EBV:39317-39339 CCGGCTGCCCCCGGAGCGCCAGG - Intergenic
1203768835 EBV:39442-39464 CCGGCTGCCCCCGGAGCGCCAGG - Intergenic
1203768885 EBV:39567-39589 CCGGCTGCCCCCGGAGCGCCAGG - Intergenic
1203768935 EBV:39692-39714 CCGGCTGCCCCCGGAGCGCCAGG - Intergenic
1185845912 X:3438218-3438240 CCTGCTGACGAGTGAGCCCCAGG + Intergenic
1186795506 X:13043943-13043965 CCTGCTCCCACGGGAGACCCGGG - Intronic
1186906919 X:14120553-14120575 GCTGAAGGCCCGAGAGCCCCTGG + Intergenic
1188716313 X:33463764-33463786 CCTGCTGACAAAAGAGCCCCTGG - Intergenic
1189019683 X:37320957-37320979 CCTGCTGATCGTAGAGCCCCAGG + Intergenic
1189887951 X:45568317-45568339 AATGCTGCCCAGAAAGCCCCAGG + Intergenic
1191143206 X:57136952-57136974 CCTCCTGCCCTGAGTGCCTCTGG + Exonic
1191732429 X:64351678-64351700 GCTGAAGGCCCGAGAGCCCCTGG + Intronic
1192251388 X:69416866-69416888 CCGGCTGGCCCGCAAGCCCCGGG + Intergenic
1193098307 X:77578593-77578615 CCTGCTGACCAAAGAGCCCTTGG + Intronic
1193276406 X:79593371-79593393 GCTGACGGCCCGAGAGCCCCTGG - Intergenic
1193601070 X:83508813-83508835 CCCGGTGCTCCGAGAGCCCCCGG + Exonic
1193664680 X:84300701-84300723 CCTGCTGACTGTAGAGCCCCAGG + Intergenic
1193931882 X:87562733-87562755 CCTGCTGGCTAGAGAGCCCTTGG + Intronic
1195999704 X:110768703-110768725 ACTGAAGGCCCGAGAGCCCCTGG - Intronic
1198430718 X:136564246-136564268 CCTGCTGACTGTAGAGCCCCAGG - Intergenic
1198546173 X:137695042-137695064 GCTGAAGGCCCGAGAGCCCCTGG - Intergenic
1199050663 X:143232898-143232920 CCTGCTGATCATAGAGCCCCAGG + Intergenic
1199849434 X:151714843-151714865 TCTTCTTCCCCCAGAGCCCCTGG - Intergenic
1200116118 X:153770436-153770458 GCGGCTGCCCCGTGAGTCCCTGG + Exonic
1200117569 X:153776055-153776077 CCTGCGGCCCCGCCAGCCCCGGG - Exonic